How long should the first responder check for breathing and chest movement prior to performing cpr?.

Answers

Answer 1
Look-Listen-Feel for breathing and movement for no more than 10 seconds.
(hope this helps!)

Related Questions

Which factors most influenced Julia to start using tobacco products? Check all that apply.

the pressure of peers
the influence of family
the desire to lose weight
the need to reduce stress
the desire to imitate a celebrity
the lack of accurate information

Answers

Answer:

The desire to lose weight

The desire to imitate a celebrity

The lack of accurate information

Explanation:

The desire to lose weight, the desire to imitate a celebrity, and the lack of accurate information were all these factors most influenced Julia to start using tobacco products.

What are the factors that influence using tobacco products?

There are many different types of factors that determine and have an impact on tobacco use, including (1) individual factors (perceptions, self-image, peers); (2) social factors (societal norms); (3) environmental factors, like advertising and economics; and (4) cultural factors, like traditional uses of tobacco, acculturation.

Risk factors include poverty, illiteracy, unemployment, and stressful environments. Environmental risk factors are aspects of a person's surroundings, such as their neighborhood, family, place of employment, and friends, that make them more likely to develop a drug addiction.

Therefore, options C, E, and F are correct.

Learn more about smoking, here:

https://brainly.com/question/11882809

#SPJ2

A child has fallen while riding a bike. When should a bystander call 911?
A) if the child seems confused
B) if the child is bleeding
C) if the child was not wearing a helmet
D) if the child is crying loudly

Answers

Answer:a if the child is bleeding

Explanation: because he or she could be hurt

Answer:

A.

Explanation:

Trust Me Bro

Penelope is adding fractions while taking a math test. What part of her brain is at work? spinal cord cerebrum cerebellum hypothalamus.

Answers

Answer:

Cerebrum

Explanation:

This is the largest part of the brain and it's divided into two halves, they are used for controlling muscle functions and control speech, emotions, learning, thoughts, reading, and writing.

Hope this Helps!

Answer:

B. cerebrum

Explanation:

What are the three main protection methods against cave-ins?.

Answers

1. The greatest risk in an excavation is a cave-in.

2.Employees can be protected through sloping, shielding, and shoring the excavation.

3.A competent person is responsible to inspect the excavation.

4. Other excavation hazards include water accumulation, oxygen deficiency, toxic fumes, falls, and mobile equipment.
Hope this helps if right mark Brainlest!! Have a good day

The three main protection methods against cave-ins are greatest risk in an excavation is a cave-in, Employees  be protected through sloping, shielding, competent person is responsible to inspect the excavation.

What is cave-in protection ?

The cave-in protection include taking of precautions when performing excavation work to safeguard workers from risks, three ways used to protect excavations: sloping, shoring, and shielding.

Sloping is the process used to reduce the trench wall’s height at an angle that is tilted away from the excavation, frequently used to increase stability and prevent collapse.

it can be used to enhance drainage and lessen the chance of waterlogging, use variety of methods, including manual labor, machinery, or a combination of both.

Application of  aluminum hydraulic or other types  stop soil movement and cave-ins is a process known as shoring, needed during digging process of a trench or working in an area where the ground could give way.

To learn more about cave-in, refer to the link:

https://brainly.com/question/14585560

#SPJ5

Define the term values. List three values that are important to you.

Answers

In my own words, values is ones own principles and beliefs that is of an importance to them or others.
One value for me is to stay positive, being in a negative mood can not only hurt me but the others around me as well.

For another example, Honesty is another value that is important to me. Being honest can have many benefits, and can build trust and reassurance in a relationship.

Lastly, having a certain passion is of importance to me. My passion is art, painting, sketching, crafts, etc… and these interests provide me with a sense of confidence, importance, and worthiness.

*I hope this helps this is in my own words

How might exposure to smoke and asbestos affect an individual’s health?.

Answers

Answer:

Significant exposure to any type of asbestos will increase the risk of lung cancer, mesothelioma and nonmalignant lung and pleural disorders, including asbestosis, pleural plaques, pleural thickening, and pleural effusions.

Explanation:

Hope this will help you

please mark me as a brainliest

Answer:

higher risk of any type of cancer, especially lung cancer.

My grandfather smokes. :P

Explanation:

The __________ is the age at which a fetus can survive in the event that it is born early. A. Prenatal age B. Age of viability C. Age of sustainability D. Gestational age.

Answers

The answer is B , age of viability

Describe the five steps in program planning.

Answers

Answer:

Determine your personal needsConsider your program optionsSet goalsStructure your program and write it downKeep a log and evaluate your program

Explanation:

im not sure if is correct, hope it helps :>

Messages are carried back and forth between the brain and other parts of the body by
a. respiratory tissue
b. muscle tissue
c. nervous tissue
d. digestive tissue

Answers

Answer:

Fibers called nerves carry important messages back and forth between your body and your brain. That network -- your nervous system -- has two parts: Your brain and spinal cord make up your central nervous system. The nerves in the rest of your body make up your peripheral nervous system

Explanation:

Messages, in the form of electrical impulses, constantly travel back and forth between the brain and other parts of the body. A special cell called a neuron is responsible for carrying these messages. There are about 100 billion neurons in the human brain. A neuron has three main parts.  

The thalamus carries messages from the sensory organs like the eyes, ears, nose, and fingers to the cortex.

Answer:Nervous system

Explanation:

Because the nervous system is known for carrying messages to and from the brain "It is what makes you say ow after you stub your toe."

What step, on the stairway to lifetime fitness, health, and wellness, is practicing self directed-healthy lifestyles on? Question 2 options: Level of Dependence Level of Decision Making Level of Independence.

Answers

Step 1 will increase your fitness, health, and wellness (step 2) if you stick to the healthy living practices, but the outcome is still dependent on others. If you get in shape as a result of activity suggested by coaches and physical education teachers, for example, your fitness is reliant on their direction.

when there are many services and support available for people who struggle with their mental health. What supports do you know of? (like an app or different people or things that could help them)

Answers

Answer:
There are many meditation apps that help clear a person's mind, for example ( Tide) or ( Headspace(

Which of the following would NOT be an effective way to offer assistance to someone suffering from depression?

Ask someone you trust for help
Avoid any judgement or shame
Offer ideas for ways to cheer them up
Reassure them that they deserve to feel better

Answers

The answer to your question is answer choice D.

The option that would not be an effective way to offer assistance to someone suffering from depression is to reassure them that they deserve to feel better. Thus, the correct option is D.

What is Depression?

Depression may be defined as a situation of persistent sadness and a lack of interest or pleasure in previously rewarding or enjoyable activities that overall change the psychology of an individual to a negative side.

Saying or reassuring a depressed person that they deserve to feel better does not provide any assistance.

The Assistance should be done by sharing his/her emotions with yourself, furnishing some ideas that cheer them up, and building your trust with them for sharing emotions.

Therefore, it is well described above.

To learn more about Depression, refer to the link:

https://brainly.com/question/21711771

#SPJ2

Your body uses carbohydrates by breaking them down into.

Answers

Answer:

simple sugars

Explanation:

I agree with the other user simple sugars. Good luck.

Which of the following is NOT a true statement about diabetes? A. Research shows that there are more cases of type 1 diabetes than of type 2. B. Research shows that a person can live with diabetes for a long time without knowing it. C. Research shows that diabetes can interfere with the function of organs other than the pancreas. D. Research shows that type 2 diabetes can be avoided or delayed. Please select the best answer from the choices provided. A B C D.

Answers

Answer:

Research shows that there are more cases of type 1 diabetes than of type 2.

Explanation:

Answer:

A

Explanation: cause

Which type of acetylcholine receptor is present on postganglionic neurons, and which type is present on the target tissues in autonomic pathways?.

Answers

N2 receptors are on the cell bodies of postganglionic neurons within the parasympathetic and sympathetic nervous systems.

Question 6 of 10
Match each disease to the correct pathogen type.
Protist
?
Cold
Virus
Athlete's foot
Fungus
?
Giardia
SUBMIT

Answers

Answer:

The athlete's foot is a type of fungal skin infection. Fungi (the plural of fungus) are microscopic plant-like organisms that thrive in damp, warm environments.

Nations with high levels of income generally have __________. A. More endemic diseases B. Lower life expectancies C. Higher life expectancies D. More respiratory diseases.

Answers

Answer:

higher life expectancies

The auditory processing area is in the __________ lobe. A. Frontal B. Occipital C. Parietal D. Temporal Please select the best answer from the choices provided A B C D.

Answers

Answer:

here's the answer to your question hope it helps you

Explanation:

d. temporal lobe

Which governmental group is responsible for creating MyPlate? A. United States Department of Agriculture (USDA) B. Food and Drug Administration (FDA) C. United States Department of Education (USDE) D. Dietary Regulatory Committee (DRG) Please select the best answer from the choices provided. A B C D.

Answers

The United States Department of Agriculture (USDA) is responsible for creating plates.

What is the United States Department of Agriculture?

The United States Department of Agriculture is a department that makes laws related to farming and forestry.

It promotes agricultural trade and production.

It works to protect forests and natural resources.

The head of the department is the secretary of agriculture.

Thus, the correct option is A. United States Department of Agriculture (USDA).

Learn more about (USDA), here:

https://brainly.com/question/14670978

Answer:

A

Explanation:

HURRY PLSSS!! I WILL MARK BRAINLIEST!!<3
Muscular strength is BEST described by __________.
A.
the ability of a muscle to contract repeatedly
B.
the average metabolic efficiency of muscles
C.
the force produced in a single maximum effort
D.
daily levels of physical activity and exertion


Please select the best answer from the choices provided.

A
B
C
D

Answers

C will be the answer have a good rest of your day

Answer:

C. the force produced in a single maximum effort

Explanation:

The person above is correct :)

have a nice day!

How can you make people aware of health issues in your community?

Answers

Answer:

write a letter to the president or do a public speaking where there are a lot of people. Or do a video on it and post it to social media or you could just post what's happening on social media

Explanation:

If u write letter to the president or even to the news people could know more about it.  public speaking because people might tell their friends what happened when u gave ur speech and words will spread. and social media is really popular nowadays, since everybody is on their device.

Answer:

Talk with everyone you know. ...

Open up about your experience. ...

Encourage kind language. ...

Educate yourself about illness. ...

Coordinate a health screening event. ...

Volunteer. ...

Leverage social media.

Explanation:

You receive a call to a daycare center for an unresponsive 8-month-old infant. Upon arrival, you perform an assessment and determine that the infant is not breathing. Your next action should be to:____.

Answers

Answer:

preform cpr using two finger compression and call 911

Your ____________________ is the number of extra heart beats you have to spare in one minute.

A.
resting heart rate

B.
maximum heart rate

C.
target heart rate

D.
heart rate reserve

Answers

Target heart rate? Your heart rate has a comfort zone so usually when you go above that zone which meant by the extra heart beats

Sorry if this is wrong but I barely could find information and if it’s wrong probably maximum heart rate

Answer:

I'm pretty sure it's D=heart rate reserve ;)

Explanation:

:)

Orthopedic surgeons are fond of saying, it is better to break a bone than it is to tear a tendon or ligament. Why is this true?.

Answers

Answer: A bone doesn't take to long to repair, but a tendon or ligament takes a while and could cause permanent damage. It's also harder to move around with a torn ligament rather than just a broken bone.

For several reasons, orthopedic surgeons often advise patients that it is better to break a bone than to tear a tendon or ligament.

Because of their greater blood supply, bones are able to repair themselves better than tendons and ligaments. Surgery is often necessary to realign and stabilize broken bones and to speed up the healing process. While tendon and ligament tears may require more intensive and longer healing, rehabilitation for fractures can restore mobility and function.

While tendons and ligaments may never fully heal, this can result in continued instability and a higher risk of further injuries. On the other hand, bones tend to regain their initial strength and stability after healing.

Learn more about Surgeons, here:

https://brainly.com/question/16924823

#SPJ6

if the water used was warmed to 30°C ,what changes ,if any would you expect in your observation​

Answers

Answer:

the water evaporates since it is hot more

Explanation:

Evaporates bobbles solid to liquid

only pick oneeeeeeeeeeeeee

Answers

Answer:

the second to last one

Explanation:

why do i feel unhappy and not wanting to live life?​

Answers

Answer:

Depression

Explanation:

Many cases you can be depressed. But go to God about your problems instead. And if you are an athiest than there is always therapy. Believe me I feel the same way and my parents can't afford counseling so I am stuck with my own troubled mine. But you don't have to be.

3. An ELISA test, performed by a scientist in the forensic lab, uses rabbit antibodies to confirm the presence of human blood collected from a crime scene. Obj. 8.5. True or false​

Answers

In the ELISA test, rabbit antibodies are used to confirm the presence of antigen in human blood collected from a crime scene. Is false, the ELISA test cannot be used for this.

What is the ELISA test for?

The ELISA test is responsible for the detection of different infectious diseases, since most pathological agents lead to the production of immunoglobulins. It can also be used in the diagnosis of autoimmune diseases or allergies. This diagnostic method is the preferred method for detecting the HIV virus.

With this information, we can conclude that the ELISA test cannot be used for this purpose.

Learn more about  ELISA test in https://brainly.com/question/7156610

Think of a situation that might emerge in health care where the patient's wishes might disagree with the health care provider's personal ethics. Describe the situations and explain what health care provider should do in it.​

Answers

Answer:

When a healthcare provider manages a patient’s health, fusses about treatment options, waiting lists, and access to resources can be a challenge to ethical spots. Ethical decisions don’t have the same punishments as unlawful actions. If a healthcare administrator faces the front of a busy emergency room, they are not lawfully required to promise people that the process will speed up. But it can be ethically responsible for them to raise the concern with the board of administrators. Healthcare places can create ethical councils to bring out reasonable decision-making that respects the importance and concerns of patients and does not forget their families and other healthcare providers.

Explanation:

1. Do-Not-Resuscitate (DNR) order is written by a doctor and it instructs healthcare providers not to perform cardiopulmonary resuscitation (CPR) if a patient stops breathing or if their heart stops beating.

2. Ethical concerns can arise when it’s not clear if a patient was able to choose a DNR.

In this situation, the first choice of the ER employee would be to keep trying. But, the ethical ruling (DNR) tells to not give CPR if the patient does not have an active heartbeat.

1. A woman who has a check-up came early to the doctors' office for their monthly check-up. Even though they came first; they had to wait longer than the other patients.

2. The woman gets impatient with the wait time and starts to cause a fuss.

In this situation, the medical receptionist's personal/work ethic would be to tell her to calm down. And that she will have to wait and or reschedule for an earlier time.

(If this does not help just ignore honestly.)

Four stressors faced by teenagers which could develop into chronic stress

Answers

Explanation:

*School demands and frustrations

*financial concerns of their family

*Separation/divorce of parents

*negative thoughts or feelings about themselves

Teenagers face a variety of stressors in their daily lives, some of which can lead to chronic stress if left unaddressed, and four of them are academic pressure, social media, family conflicts, and financial stress.

What are teenagers' stressors?

Teenagers often feel intense pressure to perform well academically, which can be compounded by the expectations of parents, teachers, and peers. This can lead to chronic stress as they struggle to balance school work with other responsibilities. Social media can be a source of stress for teenagers, as they feel pressure to present a perfect image of themselves online and keep up with the social lives of their peers. This can lead to chronic stress as they compare themselves to others and feel like they are not measuring up. Family conflicts, such as divorce or domestic violence, can be a major source of stress for teenagers.

Hence, four of the stressors are academic pressure, social media, family conflicts, and financial stress.

Learn more about the teenagers' stressors here.

https://brainly.com/question/30897981

#SPJ5

Other Questions
PLEASE HELP ME WITH THISYour teacher asks you to produce a piece of writing in which you assess the effectiveness of a poet's use of metaphor in his poetry. The purpose of this piece of writing can BEST be described as . . . Possible Answers:To entertainTo evaluateTo informTo reflect Which organelle do alga need in order to conduct photosynthesis?. What action-reaction forces are involved when a rocket engine fires? Why doesn't a rocket need air to push on? GIVING BRAINLIEST FOR BEST ANSWER!Solve one and three fourths times two fourths.A) Fourteen sixteenthsB) Fifteen sixteenthsC) Seventeen sixteenthsD) Eighteen sixteenths In what ways can poetry be useful in better understanding both others and ourselves? What types of planning can be done to improve a nations economy? A nation can undergo planning or planning in order to improve its economy. Consider a gas at STP in a container of 22. 4 L. What is the approximate value of n according to the ideal gas law? 0. 5 1 2008. 31 224. Look at the screen shot when german troops entered Austria, Hitler announced the Anschluss or unification of Austria and germany Fast food restaurants are often robbed by employees or former employees. True or false can someone help me on these questions please!! the questions are give an example of how the principal progression could be applied to this workout overtimeAnd if your primary goal was to increase flexibility would this work out be a good example of the principal of specificity?why or why not What is the historical significance of theSupreme Court case McCulloch v. Maryland(1819)? The English bill of rights laid the foundation What is the value of the expression below when y=5y=5?4y to the second power-7y-6PLEASE HELP MEH!!!!!! What three formats/objects function in precisely the same way to create an image?A. A pinhole camera, a large format camera and a Camera Obscura.B. All of the other answers.C. A Camera Obscura, Talbot's Mouse Trap camera, and a large format camera.D. None of the other answers. find the measure of the indicated angle Which form of poetry expresses feelings or ideas about a topic?Group of answer choices1. lyric poetry2. narrative poetry3. musical poetry4. tragic poetry Please help if you answer correctly I will give brainliest thank you!!!!!!!! A field is a rectangle with a perimeter of 960 feet. The length is 400 feet more than the width. Find the width and length of the rectangular field. CSI Miami: Using DNA to Solve a RobberyThe year is 2023. You are a detective for the Miami Dade Police Department. Youre on the scene of a crime where a man single-handedly just robbed a bank. Luckily, being the ingenious detective that you are, you were able to find a little spot of the mans blood where he cut his arm as he made his escape through a broken window. You take the blood to the lab so tests can be run. Unfortunately, no one was able to see the face of the man, so there are no suspects yet. Thanks to a study done in 2022, scientists have now figured which genes in DNA code for which characteristics in a person. On the next page is a strand of the sample of DNA extracted from the blood at the crime scene. Follow the steps below to help you come up with a sketch of the man who perpetrated this crime.methionine-leucine-proline = Protein that causes DARK SKINmethionine-leucine-leucine = Protein that causes LIGHT SKINvaline-proline-proline-lysine = Protein that causes GREEN EYESproline-leucine-valine-proline = Protein that causes BLUE EYESproline-lysine-proline-proline = Protein that causes BROWN EYESlysine-arginine-threonine-valine-serine-serine = BLOND HAIRlysine-arginine-threonine-valine-serine-cystine = BLACK HAIRlysine-arginine-threonine-valine-serine-valine = BROWN HAIRasparagine-isoleucine-arginine = CURLY HAIRasparagine-asparagine-isoleucine = STRAIGHT HAIRleucine-arginine-glutamic acid-arginine = BIG NOSEleucine-asparagine-arginine-glutamic acid = SMALL NOSEleucine-asparagine-asparagine-glutamic acid = MEDIUM NOSEproline-tyrosine-tyrosine-(stop) = SMALL EARSproline-proline-tyrosine-(stop) = MEDIUM EARS proline-tyrosine-phenylalanine-(stop) = BIG EARS Step 1: Decode the DNA into mRNAStep 2: Decode the mRNA into the corresponding amino acids from pg. 211 of your book. Write the amino acids in the order of the codons from the mRNA.Step 3: On a separate sheet of paper, draw a sketch of what this person might look like based on the traits you came up with. DNA: TACGATGAAGGCAATCAAGGGTTCTCCTGTCAAAGTACATTATAGGCAGACTTAGCGGTTGGAATGAAAATC | | |AUGmRNA:Protein Sequence: 1. Methionine 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. Step 4: Change the underlined nucleotide to a G. Refigure out your mRNA sequence and resulting amino acids. How would this mutation affect your picture? What kind of mutation did you just create?Step 5: Answer the following wrap-up questions:1) When you performed step 1, what enzyme were you imitating?2) In step 2, what molecule would have brought the amino acids that the codons asked for?3) In step 2, what molecule would have helped the amino acids line up and attach to one another?4) In step 2, what connected the amino acids together?