i need help with this please!

I Need Help With This Please!

Answers

Answer 1

Volume of a sphere:

V = (4/3)πr³

Circumference of a sphere:

C = 2πr

Surface area of a sphere:

A = 4πr²

above are important sphere related equations

so to find the surface area plug in values for equation

A= 4πr²

= 4 × 3.14 × 5.4 ×5.4

= 366.25 mm²


Related Questions

The average resident of Metro City produces 630 pounds of solid waste each year, and the standard deviation is approximately 70 pounds. Use Chebyshev's theorem to find the weight range that contains at least of all residents' annual garbage weights.

Answers

The weight range that contains at least 75% of all residents' annual garbage goes between 420 pounds and 787.5 pounds.

Averages

Given that the average resident of Metro City produces 630 pounds of solid waste each year, and the standard deviation is approximately 70 pounds, to determine the weight range that contains at least 75% of all residents' annual garbage weights, the following calculation must be performed:

630 - 70 = 560630 + 70 = 700560 x 0.75 = 420630 x 1.25 = 787.5

Therefore, the weight range that contains at least 75% of all residents' annual garbage goes between 420 pounds and 787.5 pounds.

Learn more about averages in https://brainly.com/question/22801800

Number 13 please.it’s the answe.r

Answers

The answer is there what u need help with?


A bag is filled with marbles. Three fifths of the bag consists of 27 red marbles. The rest of the bag is filled with yellow marbles.
How many yellow marbles are in the bag?

Answers

Answer:

There are 18 yellow marbles in the bag.

Step-by-step explanation:

Let total marble be x,

3/5 of x = 27

or, 3x = 135

so, x = 45

Total = 45

Now,

yellow marbles = 45 - 27 = 18

Answer:

18 yellow marbles.

Step-by-step explanation:

Solve for the letter x:

Answers

im pretty sure it's 16

HELP PLEASE !!!!!!!!!!!

Answers

Answer: c because the y intercept is the only correct one, not only that, if you plug in 4 as x in the equation, the y value would be -2 and that ordered pair fits on the line in the graph

Step-by-step explanation:

The distance from A to D is 2 and 5/6km.
AB is 4/5km more than BC
CD is 2/3 less than BC
Calculate the distance from C to D.

Answers

2/15

but iam not sure check with other guy

5. The two numbers rolled can be added to get a sum. Find P(sum is even). (1 point)
1/4
15/36
1/2
3/4​

Answers

I don’t get it either but I’m thinking it’s 1/4

For the following right triangle, find the side length X. Round your answer to the nearest hundredth

Answers

Answer:

x = 7.48

Step-by-step explanation:

You need to use the Pythagorean theorem to solve this problem.

leg^2 + leg^2 = hypotenuse^2

a^2 + b^2 = c^2

5^2 + x^2 = 9^2

25 + x^2 = 81

subtract 25 from both sides.

x^2 = 81 - 25

x^2 = 56

Square root both sides.

x = sqroot(56)

x = 7.48

Dale is following this recipe to make shortbread fingers. Dale uses 240 g of flour. How many shortbread fingers does he make? Recipe: Makes 24 fingers 125 g butter 55 g sugar 180 g flour

Answers

Answer:Answer:

"For 75 g butter ≈ 27 fingers

Step-by-step explanation:

Using unitary method

For 20 fingers = 55 g butter

For 1 g butter = 20/55 fingers

=> For 1 g butter = 4/11 fingers (Simplified form)

Multiplying both sides by 75

=> for 75 g butter =

=> For 75 g butter ≈ 27 fingers ( approximately )"

Excerpt from Brainly

Mrs. Sheldon has the desks
in her room in a square
formation with the same
number of desks in each row.
If there are a total of 25 desks
in her room, how many desks
are there in the first two
rows?

Answers

Answer:

16, 21

Step-by-step explanation:

The answer is 16, 21

Vote and like this have a great day ?

PLEASE HELP SOON, WILL GIVE BRAINLYIST!!! Just look at image!

Answers

Answer:  46 degrees

Explanation:

Angle PRS = 98 degrees

The two smaller pieces add up to this larger angle, so,

(anglePRQ) + (angleQRS) = angle PRS

(3x-8) + (2x+6) = 98

5x-2 = 98

5x = 98+2

5x = 100

x = 100/5

x = 20

Then we can find each angle

angle PRQ = 3x-8 = 3*20-8 = 52 degreesangle QRS = 2x+6 = 2*20+6 = 46 degrees

Notice how 52+46 = 98 to confirm the answers.

Hi There, today we will solve your questionDefinitions

Geometry - Geometry is, with arithmetic, one of the oldest branches of mathematics. It is concerned with properties of space that are related with distance, shape, size, and relative position of figures.

Or

the branch of mathematics concerned with the properties and relations of points, lines, surfaces, solids, and higher dimensional analogs.

[tex]\huge\blue{\mid{\fbox{\tt{QUESTION}}\mid}}[/tex]

Find the measures of ∠QRS

[tex]\huge\blue{\mid{\fbox{\tt{SOLVE}}\mid}}[/tex]

∵Add

[tex](3x-8)+(2x+6)=98\\5x-2=98\\5x=100\\x=20[/tex]

__________

[tex]\huge\blue{\mid{\fbox{\tt{FIND QRS}}\mid}}[/tex]

Values

[tex]{\boxed{x=20}[/tex][tex]2x+6[/tex][tex]40+6[/tex][tex]46[/tex]

[tex]\huge\blue{\mid{\fbox{\tt{ANSWER}}\mid}}[/tex]

∠QRS ⇒ [tex]{\boxed{46}[/tex]

on a road map 1 inch represents 25 miles. how many miles would 2.5 inches represent ? explain in one sentence

Answers

Answer:

25 miles * 1 inch = 25 miles; 25 miles * 2.5 inch = 62.5 miles

Step-by-step explanation:

Hope this helps!!


Calculate the average speed for the following sections on the graph.

Answers

Answer:

A to B = 2000 m/s

C to D = 30,000m/s

Step-by-step explanation:

A to B is 10secs and the distance is 200m so you multiply them and you get 2000m/s

C to D is 60secs and the distance is 500m so you multiply and you get 30,000m/s

Answer:

a to b is 20m/s I'm in k12 and I got the same question but I don't know for c to d yet

Step-by-step explanation:

A =0

B=200

T=10s

200 divided by 10 is 20m/s

and for the question at the bottom, the answer is c bc c to d is accelerating

FINAL QUESTION PLEASE HELP MEEEE!!! CORRECT ANSWER GETS BONUS POINTS!!

Answers

Answer:

∠DFE

Step-by-step explanation:

Complementary angles mean the two angles added together would equal a sum of 90°

What is the equation of a horizontal line that passes through the point
(7, 11)

Answers

Answer:

y = 11

Step-by-step explanation:

A horizontal line passes through every single x - value, but only 1 y - value.

A vertical line hits every y-value and only 1 x-value.

The only y-value given is 11, so the equation is y = 11

-Chetan K

Please help me on the math work

Answers

Answer:  x = -20

Step-by-step explanation:

I need help on number 10 and 9

Answers

Answer: 1. 55 ft   2. 10 ft. 3.3 in.

Step-by-step explanation:

For question 9, you need to understand that the angle on the left is equal to the one on the right from the mirror priniciple. Now let's say the height of the dinosaur is x ft. We would get the equation 5.5/4 = x/40 and we get that x is 55, thus the height of the dinosaur is 55 ft

For question 10, we use the same similarity principle as we use in question 9 so given that the height of the light pole is h in. we get the equation

h/185 = 62/93

So, h is 123.33(I used a calculator, hope that's fine). Thus the height of the light pole would be 123.33 in. or 10 ft. 3.3 in.

Hope this helps!!!!

Analyze the following budget, with an income of $750, to determine how much can be spent on food for the month. Month________ Budgeted Amount Food $___ Personal Items $20 Cell Phone $75 Entertainment $85 Car Expenses – Gas, Insurance $260 College Savings $250 a. No more than $70 can be spent on food. B. No more than $75 can be spent on food. C. No more than $80 can be spent on food. D. No more than $60 can be spent on food. Please select the best answer from the choices provided A B C D.

Answers

The phrase "no more than" implies upper limit. The correct choice for food budget is: Option D. No more than $60 can be spent on food.

How to find the remaining amount after deduction?

Suppose that you had initial amount as A.

Let you deduce B, C, and D from it.

The remaining amount is obtained by subtraction.

Thus,

Remaining amount  = A - (B + C + D) = A - B - C - D

For the given case, the budget left for food is the remaining amount after all the expenses are reduced from the income.

Income = $750

Expenses except food: $20 + $75 + $85 + $260 + $250 = $690

Thus, budget left is $750 - $690 = $60

This remaining budget is left. The person can spent either full of it on food or less than it, but cannot spend more than it as that person doesn't have more than $60 left.

Thus:

Food budget is no more than $60.

or

Food budget ≤ $60

Thus,

The correct choice for food budget is: Option D. No more than $60 can be spent on food.

Learn more about inequality here:

https://brainly.com/question/11901702

the price paid for a 83.50 dollar chair with an 8 percent sales tax

Answers

Answer:

$90.18 dollars

Step-by-step explanation:

Given the following question:
Original cost = $83.50
Sales tax = 8%

In order to find the price paid for the chair, we find 8 percent of the original price. Then we add that number to the $83.50 for the chair and then we will have our answer.

[tex]\frac{8\times83.5}{100} =8\times83.5=668\div100=6.68[/tex]

Sales tax of the chair is $6.68.

[tex]83.50+6.68=90.18[/tex]

Total cost of the chair after an 8 percent sales tax is "$90.18 dollars."

Hope this helps.

Whats 29x 7.4 show work

Answers

Answer:

214.6

Step-by-step explanation:

First, split 7.4 into number, this makes it easier later.

29*7=203

0.4*29=11.6

Next add them up for your total.

203+11.6=214.6

Answer:

214.6

Step-by-step explanation:

29x7.4=214.6

Type the integer that makes the following subtraction sentence true:
_____ − –99 = 3

Answers

Your answer should be 102

Answer:

-96

Step-by-step explanation:

when there are two subtraction signs it is basically a plus sign

so

___ + 99 = 3

then you can subtract 99 from both sides

___ = -96

your answer is -96

Mike has an adjusted gross income of $85,643. He claims two exemptions and can deduct $896 for state income tax, $2,145 for charitable donations, and $3,473 for medical expenses. If the standard deduction is $5,700 and exemptions are each worth $3,650, what is Mike’s total taxable income? a. $72,643 b. $75,479 c. $71,829 d. $66,129 Please select the best answer from the choices provided A B C D.

Answers

Answer:

The answer would be C. $71,829

Hope this helped :D

The net salary after all deductions will be $66,129 and can be calculated by subtraction of gross salary from all deductions thus option (d) is correct.

What is subtraction?

To subtract in mathematics is to take something away from a group or a number of objects.

In other meaning, subtraction is a mathematical operation such that two values are going to subtract and give a resultant value.

The group's total number of items decreases or becomes lower when we subtract from it.

Gross income = $85,463

Deductions are,

Income will be $896

Exemptions is 2 x $3,650

Charitable donations is $2,145

Exemptions is 2 x $3,650 expenses is $3,473

Add all above the deduction to find out the total deduction,

$896 + $2,145 + $3,473 + 2 x $3,650 = $13,814

Thus, net income will be as by subtraction,

$85,463 - $13,814 = $66,129

Hence "The net salary after all deductions will be $66,129 and can be calculated by subtraction of gross salary from all deductions".

For more about subtraction,

https://brainly.com/question/1927340

#SPJ6

The mean of five numbers is 16.
When two extra numbers are included the mean of the seven numbers is 20.
Find the mean of the two extra numbers

Answers

Answer:

30

Step-by-step explanation:

Since we have five numbers and their mean is 16 as we all know that  

mean = summation of total numbers / summation of  total number of terms

Mean = 16 for 5 numbers

sum =  16 x 5 = 80( sum of the  five terms)

when two extra numbers are added, it then becomes 7 numbers . since the numbers are unknown we then represent each numbers with the X and Y

New sum = 80 + x + y

new number of terms = 7

new mean = 20

20 =  80 + x + y

             7                    we cross multiply to get the unknown values

20 x 7  =  80 +  x + y    ,   140  = 80 + x + y

we use y as subject of the formula to get x

140 - 80 + x =  y

60 +  x = y,   y = 60 + x

we input y = 60 + x into the equation (140= 80 + x + y) to get x

140 = 80 + x  + 60 + x    ,        140 = 80 + 60 + x  + x

140  =  140 + 2x   ,         140 -140  = 2x

0 = 2x   ,  divide both sides by 2 to get x

x = 0

we then input x = 0 into the equation to get y

140 - 80 + x = y

140 - 80 + 0 = y   ,      60 + 0 = y

y  =  60

To find the mean of the two extra numbers,  we then use the above formula for finding mean.

60 + 0 / 2   =  60 / 2 =30

mean = 30.

What is the product?

Answers

Answer:

It refers to the result of one or more multiplication.

The difference of two numbers is 8. When twice the first number is added to three times the second number, the result is 51. What are the two numbers?
А. 12 and 4
B. 15 and 7
C. 20 and 12
D. 23 and 15​

Answers

The answer would be B.15 and 7. 15•2 would be 30. And 7•3 would be 21. Which added together would be 51.
Hope this helps!
15 and 7
You will make 15 times two + 7 times 3

Help fast
Select the function table that matches the equation below.

y=1/4x+6

Answers

Answer:

It is number 3

Step-by-step explanation:

bc i said so

Find the area of a circle with radius,
r
= 6.82m.
Give your answer rounded to 2 DP.

Answers

Answer:

42.8

Step-by-step explanation:

Amount of Sleep
10
9
8
Frequency
2
0-3
4-7
8-11
12-15
Time (hours)
What percentage of Mr. Hamilton's students slept 3 hours or less?
%

Answers

Answer:

I guess 3 hours is the answer.

Tips

Answer:

3 hours

Step-by-step explanation:

3 hours is the answer

A store sells 24 greeting cards for $12.


Select the three unit rates that describe this sale.





A 2 cards per dollar



B $0.50 per card



C 10 cards per $5


D $6 per dozen cards
WICH IS CORRECT

Answers

Answer:

D

Step-by-step explanation:

SOO SORRY I EDITED THIS BC A WAS WRONG I MISREAD

if 24 cards = $12, 1 card = $2 (24 / 12)

dozen = 12

if half of 24 is 12, and 24 cards cost $12, half of 12 is 6. same goes for the price. $12 / 2 = 6.

Calculate the expected Gain of Loss of stock ABC.
Please help if you can!

Answers

Answer: $11 gain

==================================================

Explanation:

Focus on the first row only. We won't worry about the other stocks.

Convert each of the percentages to decimal form

40% = 0.4015% = 0.1545% = 0.45

Then multiply those decimal values with their respective gains or losses.

Use a negative sign to indicate losses.

0.40*(-25) = -100.15*5 = 0.750.45*45 = 20.25

The last step is to add up each of the results to get the expected value.

-10+0.75+20.25 = 11

The result is positive, so it's a gain rather than a loss.

On average, we expect an $11 gain for stock ABC.

----------

Side note: Thank you for making the screenshot much more clear.

Answer:

$11 gain

Step-by-step explanation:

Other Questions
CSI Miami: Using DNA to Solve a RobberyThe year is 2023. You are a detective for the Miami Dade Police Department. Youre on the scene of a crime where a man single-handedly just robbed a bank. Luckily, being the ingenious detective that you are, you were able to find a little spot of the mans blood where he cut his arm as he made his escape through a broken window. You take the blood to the lab so tests can be run. Unfortunately, no one was able to see the face of the man, so there are no suspects yet. Thanks to a study done in 2022, scientists have now figured which genes in DNA code for which characteristics in a person. On the next page is a strand of the sample of DNA extracted from the blood at the crime scene. Follow the steps below to help you come up with a sketch of the man who perpetrated this crime.methionine-leucine-proline = Protein that causes DARK SKINmethionine-leucine-leucine = Protein that causes LIGHT SKINvaline-proline-proline-lysine = Protein that causes GREEN EYESproline-leucine-valine-proline = Protein that causes BLUE EYESproline-lysine-proline-proline = Protein that causes BROWN EYESlysine-arginine-threonine-valine-serine-serine = BLOND HAIRlysine-arginine-threonine-valine-serine-cystine = BLACK HAIRlysine-arginine-threonine-valine-serine-valine = BROWN HAIRasparagine-isoleucine-arginine = CURLY HAIRasparagine-asparagine-isoleucine = STRAIGHT HAIRleucine-arginine-glutamic acid-arginine = BIG NOSEleucine-asparagine-arginine-glutamic acid = SMALL NOSEleucine-asparagine-asparagine-glutamic acid = MEDIUM NOSEproline-tyrosine-tyrosine-(stop) = SMALL EARSproline-proline-tyrosine-(stop) = MEDIUM EARS proline-tyrosine-phenylalanine-(stop) = BIG EARS Step 1: Decode the DNA into mRNAStep 2: Decode the mRNA into the corresponding amino acids from pg. 211 of your book. Write the amino acids in the order of the codons from the mRNA.Step 3: On a separate sheet of paper, draw a sketch of what this person might look like based on the traits you came up with. DNA: TACGATGAAGGCAATCAAGGGTTCTCCTGTCAAAGTACATTATAGGCAGACTTAGCGGTTGGAATGAAAATC | | |AUGmRNA:Protein Sequence: 1. Methionine 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. Step 4: Change the underlined nucleotide to a G. Refigure out your mRNA sequence and resulting amino acids. How would this mutation affect your picture? What kind of mutation did you just create?Step 5: Answer the following wrap-up questions:1) When you performed step 1, what enzyme were you imitating?2) In step 2, what molecule would have brought the amino acids that the codons asked for?3) In step 2, what molecule would have helped the amino acids line up and attach to one another?4) In step 2, what connected the amino acids together? What does In Truth's day-star mean in Edgar Allan Poe poem A Dream Which quotation from "Harrison Bergeron" by Kurt Vonnegut Jr. Best develops the theme that attempting to make people "equal every which way" is a dangerous and harmful goal? Question 3 options: "All this equality was due to the 211th, 212th, and 213th Amendments to the constitution, and the unceasing vigilance of agents of the United States. " "Then other people'd get away with it and pretty soon we'd be right back to the dark ages again, with everybody competing against everybody else. " The musicians scrambled back into their chairs, and Harrison stripped them of their handicaps, too. " "Every twenty seconds or so, the transmitter would send out some sharp noise to keep people like George from taking unfair advantages of their brains. ". PLSSS HELP IF YOU TURLY KNOW THISS You sell triangular flags made from felt. How much felt do you need to make 60 flags? Bill's chocolate bar is 69% cocoa. If the weight of the chocolate bar is 83 grams, how many grams of cocoa does it contain? Round your answer to the nearest tenth. Le dimanche 27 aot, Katy Perry (1)(donner) un concert au stade de France. a/C' (2)(tre) son premier concert parisien-Il y en a trois autres au programme, et il n'y (3)(avoir plus une seule place de libre l'intrieur, le public (4)(attendre) la star avec impatience quand tout coup, Katy Perry (5)(faire) son apparition. Elle(6)(sortir) d'une boule disco et elle (7)(commencer) sonspectacle. Les fans (8)(adorer)!Verbs in pass compose or imparfait. President Woodrow Wilson a. promoted racial equality. b. promised to respect Latin Americas independence. c. stopped U.S. investment in Latin America and the Caribbean. d. aligned with Dollar Diplomacy. e. designed a program to instill American values in Latin American schools. List three reasons why a study may be considered invalid. A neutral atom of Fluorine has seven valence electrons. How many valence electrons are present in the ion F-1? Conflict avoidance in relationship can someone explain the answer plz Which of the following is formed when minerals and extreme heat and pressure are combined? PLS I WILL GIVE YOU 23 POINTS IF YOU ANSWER ME CORRECTLYThe diagram shows 3/4 of a fraction strip shaded. Mary erases some of the shadings to show 5/8. Explain the steps she took to shade 5/8 of the fraction strip. Sean is filling his truck with gasoline. He knows the total cost, C, will be proportional to thenumber of gallons of gasoline, g, that he puts into the gas tank. After putting 8.5 gallons in.the tank, the cost is $23.63.(a) Find the ratio of the cost to the gallons as(b) What is the real world meaning of youra unit rate. Show the division as a fraction answer in (a)?and then state the answer with appropriateunits.(c) If c is the cost and g is the number ofgallons bought, write a proportioninvolving c and g and then solve it for c.(d) If Sean puts 17 gallons of gasoline intohis truck, what is his cost? Justify. 57 women make up an all female choir in a church.Two women are chosen to sing together for a duet.How many possible pairs could be chosen for the duet? Why is physical activity so important in preventing heart disease? Svetlana and her mother are very similar. Both have blonde hair, a love of scrapbooking, blue eyes, and a thin nose. Which statement most likely describes Svetlanas traits? Svetlana inherited her love of scrapbooking from her mother, but her blue eyes come from her environment. Svetlana inherited her blue eyes from her mother, but her love of scrapbooking comes from her environment. Svetlana inherited her thin nose from her mother, but her blonde hair comes from her environment. Svetlana inherited her blonde hair from her mother, but her thin nose comes from her environment. German troops could have entered France by going through Switzerland. Use what you know about both political and physical geography to explain why it made more sense for them to go through Belgium both carbohydrates and fats provide erorgy, why is it that you get a sugar high,ut not a fat high?