Answers
Answer:
Carbon dioxide is composed of one carbon atom covalently bonded to two oxygen atoms. It is a gas (at standard temperature and pressure) that is exhaled by animals and utilized by plants during photosynthesis. Carbon dioxide, CO2, is a chemical compound composed of two oxygen atoms and one carbon atom.
HOPE IT HELPS, BE SAFE KIDDO :3
Related Questions
Imagine that this is the process begins with a single parent cell in the first generation if all cells underfo mitosis every 3 minutes what is the total number of identical cells that will exist 3 minutes after the second generation is produced?
Answers
Mark the difference between Meiosis and Mitosis below.
In mitosis the daughter cells are diploids.In meiosis the daughter cells are haploids.Only second generation is asked so the product is 1 diploid only.
No of identical cells=2In an experiment or investigation, what is a control? (1 point) O The variable that changes other variables in the experiment. O The variable that the experimenter controls or changes in the investigation. O The purpose or reason for the experiment or investigation. O The variable that remains unchanged throughout the investigation.
Answers
Answer:
In an experiment or investigation, what is a control? D. the variable that remains unchanged throughout the investigation
why would a scientist most likely chose to perform a simulation instead of a lab experiment or field observation? B.The lab experiment might be dangerous or too difficult to do.
What are the four types of terrians that the Water Erosion simulation explored? D. Rocky, glacial mountain, hills and plains, and near water body.
Which river channel results from a high-gradient, high-volume river flow? C. striaght with a wide channel.
Which effect does temperature have on the glacial mountain terrain? C. hugh temperature melts glaciers faster and cause water erosion to increase
Explanation:
In the body, certain lipids ________.Multiple Choiceare used to make mineralsare necessary for the absorption of dietary fiberprovide energystimulate the production of enzymes
Answers
Answer:
Provide insulation against cold temperatures
Explanation:
Match the planets with their best description.
1. Uranus
2. Jupiter
3. Mercury
4. Venus
5. Saturn
1. Has the widest swings in temperature
2. Hottest planet in the solar system
3. Visible rings and posts of moons
4. Largest planet in the solar system
5. Rotates on its side
Answers
Answer: 1-5 3-1 4-2 2-4 5-3
Explanation:
Bottom trawling is a destructive fishing practice that destroys ocean habitats. Please select the best answer from the choices provided T F.
Answers
Answer: the answe is TRUE
Explanation: got it right on edge
Answer:
T
Explanation:
EDGE 2022
What happens in the wall of the uterus to push the baby out?
Answers
answer : Normally, the placenta detaches from the uterus and exits the vagina around half an hour after the baby is delivered...
Unlike animal cells, plant cells have ________ and ________. Unlike plant cells, animal cells have ________.
Answers
cell walls, chloroplasts, large central vacuole, plastids,
Compact bone forms concentric rings that make it extremely hard and strong to:.
Answers
Characteristics of viruses include all of the following except
They are smaller than prokaryotic cells.
They are visible with a light microscope.
They are obligatory parasites.
They are acellular.
They are composed of genetic material and protein.
Answers
Answer:
Your answer would probably be D. They are composed of genetic material and protein.
Hope this helps!
Characteristics of viruses include all the following, except is they are acellular. The correct option is D.
What is virus?A virus is an infectious microbe made up of a nucleic acid segment (DNA or RNA) encased in a protein coat.
A virus cannot replicate on its own; instead, it must infect cells and make copies of itself using the host cell's components.
Thus, the correct option is D, They are acellular.
Learn more about virus
https://brainly.com/question/1427968
#SPJ2
In what way are autotrophic protists essential to the survival of aquatic ecosystems?
A. They remove toxins from the water.
B. They produce extensive reefs.
C. They serve as the base of the food chains.
D. They convert nitrogen gas into ammonia.
Answers
Organelles is not a living things A. True B. False
Answers
Answer:
Organelles are not considered a living being. They do not contain their own DNA.
Explanation:
Suffice to say this is a touchy question due to the controversy of life itself within an Organelle. Organelles cannot replicate and are lipid/protein constructs. Naturally a living being should be able to replicate whether it be by its own self or with a partner.
Bacteria reproduce by injecting their genes into other cells. Please select the best answer from the choices provided. T F.
Answers
Answer:
false
Explanation:
I took the test
Answer:
F
Explanation:
Good luck :)
Identify the phrase that best describes a transfer of energy between the hydrosphere and the atmosphere. Ocean currents transport warm water from the equator to the poles and cold water from the poles to the tropics. These currents help regulate air temperatures and, therefore, the global climate, counteracting the uneven distribution of solar radiation reaching Earth. If there were no currents, the temperature near the equator would be extremely hot, and the temperature near the poles would be extremely cold. These areas would not be suitable for living things to survive.
Answers
These currents help regulate air temperatures and, therefore, the global climate, counteracting the uneven distribution of solar radiation reaching Earth.
What is a hydrosphere?The hydrosphere consists of water forms and all water layers of the earth.
Examples are oceans, seas, rivers, lakes, etc.
Ocean currents help in the transfer of energy between the hydrosphere and the atmosphere.
It also regulates the temperature of the air.
Thus, the correct option is B, Ocean currents help regulate air temperatures and, therefore, the global climate, counteracting the uneven distribution of solar radiation reaching Earth.
Learn more about the hydrosphere, here:
https://brainly.com/question/1155156
Answer:
2nd option
Explanation:
"These currents help regulate air temperatures and, therefore, the global climate, counteracting the uneven distribution of solar radiation reaching Earth."
HELPPPPPPPPP!!!!!!!!!!!!
James is researching the advantages of varying beak sizes of four bird species in a local habitat. He records and graphs the data to show how many individuals there are in each species with different sizes of beak. The graph is provided. If all four species of birds are transported to a new habitat with completely new food sources, which species will most likely be able to avoid extinction?
Answers
Answer:
The birds with long pointed beaks.
Explain:
Birds beaks developed different tastes for fruits, seeds, or insects picked from the ground or cacti. Long, pointed beaks made some of them more fit for picking seeds out of cactus fruits.
Birds with larger, thicker beaks are better adapted to crush and open seeds and foods that are larger. So a bird with a small beak could not eat it.
What is the mRNA transcript if the complementary DNA is TCTGAG?
Answers
Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
Explanation:
What is the genus and species of Organism 3 in this mostly fabricated taxonomy table?
Multiple choice question.
A.)Eukarya Animalia Vertebrata Mammalia Bipedia sneakeri
B.)sneakeri
C.)Bipedia sneakeri
D.)Eukarya Animalia
E.)Bipedia Sneakeri
Answers
Answer:
E
Explanation:
if it's going from the widest range (from being common) to the narrowest range ( to being more specific), the species is found at last, and the one above it is its genus.
one mnemonic to remember this is:
Kids Prefer Candies Over Fresh Green Salads.
Kingdom Phylum Class Order Family Genus Species. ( from highest rank to lowest).
i hope this helps you to better understand things,
-s.
The genus and species of Organism 3 in this mostly fabricated taxonomy table is Bipedia Sneakeri. The correct option is E.
What are species and genera?Species is a term of the organization. It is the largest group of organizations. It contains all the animals which can reproduce and produce actual offspring.
Genus is the ran of an organization that is lower than the family. It contains all living organisms. It comes above species. The scientific name of an organism contains the species and genus.
The organization table here is given to contain different ranks of the organization. The third group of organization tables contains bipedalism. It is a form of locomotion that was ancestral. The apes and monkeys walk like this, using all limbs.
Thus, the correct option is E. Bipedia Sneakeri.
To learn more about species and genera, refer to the link:
https://brainly.com/question/14306908
#SPJ2
When different genes make for greater or lesser chances of survival and reproduction, natural selection results in the more favorable genes becoming more frequent in a population over time, and populations that have those genetic changes are better able to survive and reproduce. This is called:
Answers
When different genes that make for greater or lesser chances of survival become more frequent in a population, the phenomenon is called evolution by natural selection.
What is evolution by natural selection?First, evolution is defined as gradual changes to the traits of organisms with time.
Natural selection refers to the tendency of nature to select for or against traits that confer adaptive advantages or disadvantages in organisms respectively.
In a population of the same organisms, the gene that confers greater chances of survival is selected among numerous similar genes. This gene becomes more frequent in the gene pool of the population with time.
Thus, we say that such a population has evolved through natural selection.
More on natural selection can be found here: https://brainly.com/question/2725702
Which genetically modified organism will best prevent farmers from losing their crops during transport to grocery stores?
oranges that have a prolonged shelf life
corn with a high yield
butter squash that have high nutritional value
fruit with a vaccine
Answers
Answer:
Probably oranges that have a prolonged shelf life
The main difference between a prokaryotic cell and a eukaryotic cell
is
Answers
I hope that helps!!!
Answer:
eukaryotic cells have a membrane-bound nucleus and prokaryotic cells do not.
The three major components of connective tissue are.
Answers
Answer:
1. specialized cells
2. extracellular protein fibers
3. a fluid known as ground substance
Explanation:
Cell organelle
Holds water solutions, provides support to the
cell when full
Answers
Answer:
It is the vacuole - Holds water solutions, provides support to the cell when full
Which type of electromagnetic wave has the shortest wavelength?
A. X-rays
B. Infrared
C. Radio
D. Microwaves
Answers
What is a major impact of climate change for fish species
Answers
Answer:
a major impact is the temperature rise or drop in certain oceans
Explanation:
trust me bro
The main impact of climate change on fish species is the increase in water temperature.
How does temperature affect fish?
The metabolism of fish is higher as the temperature increases, causing their food consumption to increase in the hot seasons of the year and, consequently, at these times, their growth rate also increases.
With this information, we can conclude that the main impact of climate change on fish species is the increase in water temperature.
Learn more about climate change in brainly.com/question/18784841
Based on what you learned about the roller coaster ride, which of the following statements
about energy transformations are true? select all that apply
-kinetic energy can be converted only into gravitational potential energy.
-an object’s kinetic energy changes whenever the objects speed changes.
-more than one type of energy can be converted into kinetic energy.
Answers
Answer:
I hope this really helps (A) is the answer
Explanation:
it can pysically
WILL GIVE BRAINLIESIT. PLEASE HELP. 40 PTS
1. ALL cells have the SAME genes. True/False Provide an example of this in humans: Answer here..
2. DIFFERENT genes are active in DIFFERENT cells. True/False Provide an example of this in humans: Answer here..
3. DIFFERENT genes are active at DIFFERENT time. True/False Provide an example of this in humans: Answer here..
Answers
Answer:
Explanation:
1. True, all cells in one body do have the same genes. AN example is keratin or collagen. Collagen is produced in the skin, is you have brown hair it is expressed but if you have black hair it is repressed.
2. I believe this one is true I am not sure. Every cell has a different duty but the same genetic instructions. Different types of genes can be turned off and on by different cells. The liver cells are different from the nerve cells but still have the same DNA in your body.
3. True! An example is when you are young you are growing but those genes stop when you are an adult and stop growing taller.
Life processes shown by viruses if they enter a living cell
Im 13 why does it say I am in high school
Answers
If there are 108 Guanine (G) bases in a DNA sequence, how many Cytosine (C) bases are there?
Answers
Answer:
108 cytosine because they are complimentary base pairs
Choose Griffith, Avery, or Hershey and Chase. Select evidence from the text to develop a flowchart that shows how that scientist or team of scientists used scientific methods. Be sure to identify each method. use your flowchart from the reading tool and content from chapter 1 as a guide.
Answers
Question = what is the genetic material? >> hypothesis = it is composed of DNA >> experimentation = use of radioactive isotopes. It was discovered by Avery by observing bacterial transformation.
What is the scientific method?The scientific method is a series of steps used to collect scientific evidence in favor of a hypothesis.
A hypothesis is a given explanation about an observation that emerged by analyzing the natural world.
By using the scientific method, Avery showed that DNA is responsible to store the genetic information in bacteria across generations.
Learn more about the scientific method here:
https://brainly.com/question/17216882
A student concluded:
"the bigger an animal, the more chromosomes it has in each body cell.'
This is not a valid conclusion.
Give one reason why.
Answers
Animals have different sizes during their life but the chromosome number stays the same
The effect of landforms on weather// predicting weather explore 4? I need all the answers to this
Answers
Answer:
Heating of the landmass during the day causes great convection of air and clouds quickly forms above it. This distinctive feature play a significant role in the production of winds, sea breezes to monsoon winds. hope this helps a little bit :)