If the sales tax rate is 8%, how much tax would Luis pay for a pair of pants for $18 and two shirts for $9.99 each?

Answers

Answer 1

Answer:

$3.04 (rounded to nearest cent)

Step-by-step explanation:

Total cost without tax = $18 + $9.99 × 2

                                    = $37.98

Tax = [tex]\frac{8}{100}[/tex] × $37.98

      = $3.04 (rounded to nearest cent)


Related Questions

What is the following quotient?

Answers


2
3

3

3

18 is the answer

Answer: A edge 2021

Step-by-step explanation:

Will mark brainliest, if correct!

Answers

Answer:

Q'(15, -3)

Step-by-step explanation:

Multiply the coordinates by the scale factor to get the new coordinates.

5 · 3 = 15

-1 · 3 = -3

Therefore, Q'(15, -3).

Is x = 6 a solution to the equation 5(x – 3) = x + 13?

Answers

Answer:

x=6 is not a solution

Step-by-step explanation:

We can substitute 6 as x to find out:

5(6-3)=6+13

first, because of PEMDAS we'll do 6-3

5(3)=6+13

multiply 5 by 3 and add 6 and 13

15=19

Since the statement is not true, that means that x=6 is not a solution

Hope this helps!

1.Could 18 in, 6 in, and 13 in, form a triangle?
2. Could 34 km, 27 km, and 58 Km, form a triangle?
3. Could 29 ft, 38 ft, and 9 ft, form a triangle?
4. Could 12 cm, 12 cm, and 25 cm, form a triangle?
5. Could 31 yd, 14 yd, and 19 yd, form a triangle?

Answers

Answer:

1. yes

2. yes

3. no

4. no

5. yes

Step-by-step explanation:

The questions you're asking relate to the Triangle Inequality Theorem, which states that the two smallest sides (ex. 6 and 13) have to be of greater value than the largest side (ex. 18)

1. 6+13>18

2. 34+27>58

3. 29+9=38 (since the value of the two smallest sides are equal, it does not apply to the Triangle Inequality Theorem, and therefore won't be a triangle)

4. 12+12<25

5. 19+14>31

Happy to help <3

i’m becoming a yubo who re again xx what y’all think

Answers

Answer:

first things first nice picture, second i don't know what a yubu is, and third what is " re again xx"?

Step-by-step explanation:

Jacob makes a scale drawing for a crate with a scale factor of 1:20 the dimitions of his scale drawing is 3 in long and 2 in wide the bulder creates a scale drawing of the crate with the scale factor of 1:10. What are the dimitions of the builders drawing?

Answers

Answer:

6 in long ; 4 in wide

Step-by-step explanation:

With a scale of 1:20

Scaled drawing is 3 in long ; 2 in wide

Actual dimension :

Length = 20 * 3 = 60 in

Width = 20 * 2 = 40 in

Hence, to make a scaled drawing using 1 :10

Dimension :

Length = (1/10) * 60 = 6 inches

Width = (1/10) * 40 = 4 inches

find the value of x.

Answers

Answer:

2

Step-by-step explanation:

Since they are similar triangles then the ratio will be the same on all sides.

You know the one side 5 is the same ratio to 5x   so you multiply x to all sides of the little triangle to get the value of the equivalent side in the big one.

so the missing side x times x will equal the big size of the bigger triangle which is 4

x times x = 4   can only be 2

20 points The supply and demand curves for a new style of silver earrings are shown. Where is the equilibrium point?​

Answers

Answer:

It's the dot that's right in the middle of the rest, where the two lines meet.

Step-by-step explanation:

That's the equilibrium point.

The equilibrium point of the given graph is at (35, 90)

What are supply and demand curves?

The demand curve shows the quantities of a particular good or service that buyers will be willing and able to purchase at each price during a specified period. The supply curve shows the quantities that sellers will offer for sale at each price during that same period.

Given that, the supply and demand curves for a new style of silver earrings are shown.

We need to find the equilibrium point,

We know that, On a demand and supply graph, the equilibrium point can be found where the demand and supply curves intersect. Price is on the axis on both the demand and supply curves, and quantity demanded is on the axis.

In our graph, the curves are intersecting at (35, 90)

Hence, the equilibrium point of the given graph is at (35, 90)

Learn more about supply and demand curves, click;

https://brainly.com/question/1915798

#SPJ5

Please help me thanks please

Answers

Answer:

6

Step-by-step explanation:

Step-by-step explanation:

make it braintliest please

Please help lol. 15 point!

Answers

I think 20 I am not sure sorry if I get it wrong

Answer:

52

Step-by-step explanation:

Please help me!! I really need some help ASAP please

Answers

Answer:  put a dot at the place you  think 7 over 2 would be then put  one at -2 on the x axis then drawn a line

Step-by-step explanation:

Three brothers, Andy, Bob, and Curly, take a taxi together home from the
airport.
Their homes lie along the same route;
• Andy’s is 21 km from the airport,
• Bob’s is 42 km, and
• Curly’s is 63 km.
If the taxi fare is $2.00 per km, try to find at least two possible fair ways for each
of the three travellers to pay the driver (not including the tip)?
I really need help on this cab someone answer this please

Answers

Answer:

See explanation

Step-by-step explanation:

not sure what class this is for but I\ll try. Each traveller has a 21 km drive so their fare should be equal.

method 1) each traveller can pay for 21 km worth when they get out

method 2) Curly can pay the full fare and Andy and Bob can pay him back later (they're brothers so this should be easy to manage)

Enter the number in standard form.
4.78 · 10-1

Answers

The answer is 46.8
Plz mark me Brainly
the answer is 46,8
:)

Belvedere climbs a 25-meter tower to ride a straight water slide. After
landing in the splash pool, he walks 14 meters back to the base of the
tower. What is the length of the slide (nearest tenth)?

Answers

Answer:

28.7

Step-by-step explanation:

a^2 + b^2 = c^2

25^2 + 14^2 = 821

Square root of 821 is 28.7.

You are taking a karate class that costs \$12 a month. In addition, you needed to purchase a uniform. You paid a total of $88 after 4 months. Please answer I even cash app u money just leave it below with the answer :((

Answers

Answer:

40 dollars for the uniform

it costed 48 dollars for 4 months

Step-by-step explanation:

12*4=48

88-48=40

ask in comments for any other questions

no money, just brainilst please:)

HOPE THIS HELPS!  :D

Rachel is planning to run an average of 6.4 miles over three consecutive days. On the first
day, she ran 6.6 miles, and on the second day, she ran 6.5 miles. What is the maximum
number of miles Rachel can run on the third day without going over the planned average of
6.4 miles per day?

Answers

6.6+6.4= 13.1

6.4 x 3 = 19.2

19.2- 13.1 = 6.1 miles

The maximum  number of miles Rachel can run on the third day without going over the planned average of  6.4 miles per day is 6.1 miles.

Maximum  number of miles:

Let x represent the maximum  number of miles

Formulate

6.6+6.5+x÷3=6.4

Hence:

6.6+6.5=6.4×3

13.1+x=19.2

x=19.2-13.1

x=6.1 miles

Inconclusion the maximum  number of miles Rachel can run on the third day without going over the planned average of  6.4 miles per day is 6.1 miles.

Learn more about distance here:https://brainly.com/question/4931057

Work out
20% of 16 000

Answers

Answer:

Percentage Calculator: What is 20 percent of 16000.? = 3200.

Answer:

answer 3200 your welcome thats the answer

The cost of 5 gallons of gasoline is $20. Write an equation to show the relationship between the cost, c, and the gallons of gasoline, g.

Answers

Answer:

the gas 4$

Step-by-step explanation:

5x=20

divide 5/5 to cancel the 5 then 20/5 and there you have it 4

help PLEASE!!!?!!!!!!

Answers

Answer:

yes

Step-by-step explanation:

Answer:

the answer is b

Step-by-step explanation:

the sum of all digits of some number is 210. That number is always divisible by ?

Answers

Answer:

if the sum of digits is divisible by 3 ,the number is also divisible by 3. Since 210 is divisible by 3, the given number is also divisible by 3.

Which number is equivalent to?

Answers

So, we have 2^3/3^3
= 2^3/3^3 = 2 times 2 times 2/3 times 3 times 3
= 8/27
So, in conclusion, the final answer is 8/27 so, you should go with D 100%!

8.(01.02)
Given that f(x) = x2 – 3x + 3 and g(x) =
x-1
4
solve for f(g(x)) when x = 5. (1 point
1
-3
1
9
13

Answers

Answer:

Step-by-step explanation:

so the g(x) = x-1 gets plugged into every  x in the f(x) function

=[tex](x-1)^{2}[/tex] - 3(x-1) + 3

=[tex]x^{2}[/tex]-2x+1 -3x +3 + 3

=[tex]x^{2}[/tex] -5x +7

now plug in x = 5

=[tex]5^{2}[/tex] -5(5) +7

= 7

On a coordinate plane, a line goes through points (negative 4, 0) and (0, 2).
What Is the slope of the line on the graph?

Answers

Answer:

the slope is 1/2

Step-by-step explanation:

find the change in y over the change in x

2-0/0+4

you get 2/4 then simply that to 1/2

Answer:

0.5

Step-by-step explanation:

on edg

hiii please help asap ill give brainliest if you give a correct answer tyyyyy

Answers

Answer:

25 miles per hour

Step-by-step explanation:

Answer:

25

Step-by-step explanation:

the answer is right there lol

Write a simplified expression for the area of the rectangle

Answers

Answer:

Area = 40x + 15 squared units.

Step-by-step explanation:

Area of a rectangle = Length × width

I might be going crazy but I dont think any of these work? Please help

Answers

Answer:

That's strange. (-1/2, 5) would work for both if only the top equation had a less than or equal to sign. If all else fails, just puts c as your answer lol

Step-by-step explanation:

P = (12, 4) and M = (-8, 8)

Answers

You can look on the app Socratic to help you.

PLZ HELP ILL GIVE BRAINLIEST

Answers

Answer:

-1 -9i, where a = -1 and b = -9

Step-by-step explanation:

1st step is to open up the brackets. Since there's a (-) in front of the second bracket, we have to multiply every term by -1, so positive becomes negative, negative becomes positive etc.

4-i-5-8i

Then we collect like terms.

-1 -9i

This is the answer. It looks wrong since the variables are 'positive' in a +bi, but you have to remember that a variable can be represented as a, but its actual value could be negative, in this case -1. This is the same with b, as b could be the same as -9.

This is an expression, so we can't multiply everything by -1 to make it 'look right'. You can only multiply by -1 or 'alter' the terms when the expression equates to something.

s + 2.5s + 2.5s - 3.3 =

Answers

Answer: 6s-3.3

Step-by-step explanation:

Answer:

[tex]s=0.55[/tex]

Step-by-step explanation:

[tex]6s=3.3\\s=\frac{3.3}{6}\\s=0.55[/tex]

Kate started with a piece of bubblegum that was 5/8 in wide. She later blew a bubble that was 2 7/8 in wide. How much wider was Kates bubble than the original price

Answers

Answer:

9/4 or 2 1/4

Step-by-step explanation:

2 7 /8 -5/8 which gives you 9/4

Other Questions
BackgroundLayout-ThemeTestos2Freda bought 6 gallons of gasoline for $19.14What was the unit price of this gasoline? Read the quotation below from a high school science student.We used a formal method of study to figure out which kindof grocery bag had the least effect on the environment.What is the student describing?O A. Using scientific toolsB. Making random discoveriesC. Using the scientific methodD. Making a conclusion 3(5 + 6)=....................... A businessman wants to buy a truck. The dealer offers to sell the truck for either $120,000 now, or six yearly payments of $25,000.What is the interest rate being offered by the dealer in percentage (rounded to the closest integer number) 30 POINTS HELP Which idea was supported by Aristarchus, Copernicus, and Galileo?The planets have epicycles.The planets revolve around the Sun. The stars rotate around the Sun.The center of the solar system is Earth. The belief that Europeans are the superior class in society is called? Question 1 of 11What are two ways space exploration can improve international relations?DA By urging countries to compete to achieve goalsDB. By helping countries' economies grow weakerDC. By encouraging countries to share scientific dataDD. By inspiring countries to work together to solve problems explain the ides behind majority rule and minority rights 3. Study the changes in population graph, what % lived in cities by the 1930's?By the 1970's? What led the people of France to agree to an imperial dictatorship instead of a true democratic republic like the one selected in the American colonies? why human are not responsible for global warming? Which of the following cells can generate ATP through glycolysis? A. Eukaryotic Cells (Plants and Animals) B. Prokaryotic Cells (Bacteria) C. None of the above D. All of the above What is the length of EF in the right triangle below? Choose one of the three themes (social oppression, greed, or good vs. Evil) and explain something you know about it in the real world OR explain where else you have seen the theme (a book, movie, show, etc.) Please help quick What is f(2) if f(x) = 2x-5 and f(4) if f(x) = -3x + 15step by step please! Solve.Okay here is 20 letters brainy Please which one is the right answer Please help with this What is public participation? Why is itnecessary for environmental conservation AUUUAACUGUUCUGUCUAGAG1. Construct an Explanation Based only on the information provided, why could themRNA section be translated into three different sets of amino acids, instead of just oneset?2. Use Models Use the genetic code to translate the sequence into each of the threepossible sets of amino acids.3. Draw Conclusions Which of the three sets of amino acids is the most likely to beincluded in the polypeptide? Explain your reasoning.