if the sun is a source of EM radiation , how come only some of the EM strikes the surface of the earth

Answers

Answer 1

Answer:

Some EM radiation is absorbed by the atmosphere

Explanation:


Related Questions

Question # 1: Which shape is CLOSEST to the truth for the shape of planet 1 point
Earth?
1. Which object best represents a true scale model
of the shape of Earth? (1) a table tennis ball
(2) a football (3) an egg (4) a pear
Option 1
Option 2
Option 3
Option 4

Answers

Answer:

(1) a table tennis ball

Explanation:

The earth will most closely resemble any type of sphere or circular ball.

What molecule forms a double helix structure composed of two complimentary strands of nucleotides?

Answers

DNA! the question is a typical descrption of it


Starch is a polysaccharide used as a component of cell walls in plants.


True

False

Answers

Answer:

false

Explanation:

is type of carbohydrates

False. Starch is a polysaccharide used as an energy storage molecule in plants, but it is not a component of cell walls.

What are structural component of cell wall?

Cell walls are structural components found in the outermost layers of cells in plants, fungi, and some bacteria. They provide support and protection for the cell, and are composed of a variety of different biomolecules, including cellulose, pectin, and lignin.

Starch, on the other hand, is a complex carbohydrate that is synthesized and stored in the cells of plants, particularly in the seeds, roots, and tubers. It is made up of long chains of glucose molecules and is used by plants as an energy source, particularly during times when the plant does not have access to light for photosynthesis. Starch is not a component of cell walls.

Learn more about cell wall, here:

https://brainly.com/question/965751

#SPJ2

What could be inferred from suntans?

Group of answer choices

A tan might indicate sun damage to the skin.

Tanning produces healthier skin.

A tan strengthens the elastic in the skin.

Tanning makes skin look younger.

Answers

Answer:

A tan might indicate sun damage to the skin.

Explanation:

Tanning is the process by which the skin is exposed to the ultraviolet rays that comes from the sun with the purpose of producing a dark-brown coloration called a TAN.

A tan achieved by exposure to the sun can actually indicate that a person's skin is undergoing damage from the UV rays of the sun, hence, the skin responds by producing a protein called melanin, which protects the skin and later forms the dark coloration- tan. From this explanation, tan is got in response to a damaging signal received by the cell, hence, a tan might indicate sun damage to the skin.

What is the source of the carbon dioxide that is used in photosynthesis?

Answers

Answer:

Photosynthetic cells

Explanation:

photosynthetic cells are diverse and are found in green plants during the process of photosynthesis cells use carbon dioxide and energy from the sun to make sugar molecules and make oxygen

two types of global food webs show the feeding relationships of organsms. What distinguishes one type of global web from the other?
A whether the producers are located on land or in water
B whether or not the food web includes tertiary consumers
C whether the web includes animals that migrate during the year
D whether the ecosystem described by the web is localized or very broad

Answers

Answer:

A. wheter the producers are located on land or in the water.

Macroscopic urinalysis collects data on all EXCEPT which of the following?
A. turbidity
B. color
C. pH
D. odor

Answers

Answer:

The correct answer is - pH.

Explanation:

Macroscopic urinalysis is the evaluation of the physical appearance of the urine. It evaluates the amount, color, odor and clarity, and other physical appearances or characteristics.

It also checks if there are any clotting, or sediments are found in the sample. It does not include the pH of the urine in the microscopic urinalysis. It is recommended to check underlying medical conditions.

natural selection selects ___________ less fit individuals .
natural selection selects ____________ viable individuals .

Answers

Answer:

viable

Explanation:

Only the animals who are able to survive will live long enough to reproduce

Please help me with please

Answers

no so do it yourself and get smart

Why do potato plants no longer need to use glucose from starch in respiration once they have grown above ground?

Answers

They no longer need the respiration to grow

I’m 98% sure it’s c but it might be B could someone check pls

Answers

Answer:

I think C

Have a great day

[tex]#Liliflim✌[/tex]

Answer:

Explanation:

A

We don't know what the first life form was or how it came to be, but the process of reproduction with VARIATION over billions of years is responsible for the diversity of life on Earth today.
A. True

B. False

Answers

A. True

variation of reproduction produces diverse life forms and allows organisms to evolve complex characteristics over billions of years.

Answer:

A. True

Explanation:

Yeah, we don't know what the first life form was or how it came to be, but the process of reproduction with VARIATION over billions of years is responsible for the diversity of life on Earth today.

Describe the processes involved in photosynthesis

Answers

Explanation:

During the process of photosynthesis, cells use carbon dioxide and energy from the Sun to make sugar molecules and oxygen. ... Then, via respiration processes, cells use oxygen and glucose to synthesize energy-rich carrier molecules, such as ATP, and carbon dioxide is produced as a waste product.

Answer:

During the process of photosynthesis, cells use carbon dioxide and energy from the Sun to make sugar molecules and oxygen. Then, via respiration processes, cells use oxygen and glucose to synthesize energy-rich carrier molecules, such as ATP, and carbon dioxide is produced as a waste product.

Wich behavior is a response to an external stimulus

Answers

Answer:

An external stimulus is a stimulus that comes from outside an organism and causes a reaction. ... Learned behavior is a response to a stimulus that an animal was taught. Being able to read and write are examples of learned behavior, because it is not something you are born able to do.

Explanation:


Which correctly describes the projected growth of the world's population in
the future?
A. The rate of growth will remain the same.
B. It will not grow much higher than it is now.
C. The population will eventually begin declining.
D. The rate of growth will slow down by 2100.

Answers

Answer:

D the rate of growth will slow down by 2100

Explanation:

Sorry if it’s wrong

World's population growth rate will slow down by 2100 in future.

What is world's  population growth ?The rise in the number of people in a population or dispersed group is known as population growth. Global population growth is roughly 83 million people per year, or 1.1 percent per year. From 1 billion in 1800 to 7.9 billion in 2020, the world's population has increased dramatically.

What will be the world's population growth rate in future?The world's population is expected to reach 10.9 billion by 2100 in future, with yearly growth of less than 0.1 percent – a significant decrease from present rates. Between 1950 and today, the world's population increased by 1% to 2% per year, going from 2.5 billion to more than 7.7 billion people.

Hence, the correct option is D.

To know more about population growth here,

https://brainly.com/question/17487289

#SPJ2

Because conservation means using fewer natural resources and reducing wastes, it helps
a.
slow overpopulation and grow food.
b.
prevent habitat destruction and reduce pollution.
c.
prevent biodiversity and destroy species.
d.
stop exotic species and create habitats.


Please select the best answer from the choices provided

A
B
C
D

Answers

Answer:

a

Explanation:

just did it

Answer:

the answer should be "B"

the tRNA for GUCAUCGAUCGAUCGGAUGCC

Answers

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

hiii! ill give brainliest if u answer this :))

Why are enzymes important?

1. They contain the genetic material.

2. They speed up chemical reactions.

3. They bring water into the cell.

4. They help the cell maintain its shape.

Answers

They speed up chemical reactions

SCIENCE
Which of the following is an example of a glacial formation?
(Don’t put a random answer or spam things or I will report you and you will lose the points)
A. Photosynthesis
B. Methane degradation
C. Photolysis
D. Weathering of rocks

Answers

Answer:

The correct answers is letter D.

Explanation:

Base on my research Weathering of rocks or Weathering loosen of rocks are examples of a glacial formation

What two taxon make up the scientific name? Pick all that apply.
Kingdom
Phylum
Class
Order
Genus
Family
Species

Answers

Answer:

genus and species are combined to form a scientific name

Answer:

GenusSpecies

Explanation:

The word is genus and species. These two taxon make up the scientific name.

which two molecule do green plants use to make glucose

Answers

Answer:

Carbon Dioxide and Water

The growth of two plant saplings A and B, were observed for a period of 6 months. The graph shows the linear growth of the saplings, in centimeters.

After how many months will the heights of the two samplings be the same?

Answers

5 is the correct answer I hope



What is the
Magnification
of a plant cell?

Answers

Answer:

400x

Explanation:


Which of the substances below are PRODUCTS of the overall chemical reaction of
photosynthesis?
A. ammonia
B. Unitrogen
C. carbon dioxide
D. water
oxygen
sugars

Answers

Answer:

essentially glucose and oxygen are the products of photosynthesis

Explanation:

species I
species II
species III
species IV

Answers

Answer: It’s species II because it matches the unknown

Choose the combination of factors that creates snow.

Answers

Answer:

Relative Humidity- Low

Air tempurature-cold

Air Pressure-low

Explanation:

High pressure, warm temperatures, and high humidity are  factors that creates snow.

What are the factors that create snow?

Snow and/or ice formation requires temperatures below freezing, both in the atmosphere and close to the ground.

Something that will induce the moist air to rise, forming clouds and precipitation, moisture, produces precipitation and clouds.

Water that has frozen solidly is snow, and the atmosphere (layer of gases around Earth) contains water in the form of vapor (gas). When there is a lot of vapor present, clouds develop, fill up with water droplets, and eventually begin to rain.

Therefore, when a very cold water droplet freezes onto a pollen or dust particle in the atmosphere, a snowflake starts to form.

Learn more about snow, here:

https://brainly.com/question/29372094

#SPJ2

mango tree and Vanda ecological interaction​

Answers

Answer:

The relation between a mango tree and an orchid is commensalism. An orchid growing on the branch of a mango tree is an epiphyte. Epiphytes are plants growing on other plants which, however, do not derive nutrition from them.

hope it helps

There are 20 different types of amino acids, which can result in a wide variety of protein shapes. Which of the following is not a function associated with proteins?
A. providing structure
B. speeding up chemical reactions as enzymes
C. information storage
D. all of these are functions of proteins​

Answers

Answer:

c information storage

Explanation:

information is stored in dna which provides the instructions required to make proteins . proteins do not store information

PLEASE HELP WILL MARK BRANLIEST!
Fungi and bacteria are examples of _____:

A. decomposers, B. producers, C. consumers, D. demagorgans

Answers

Answer:

a. decomposers

Explanation:

Bacteria and fungi are best classified as decomposers. They decompose the bodies of dead plants and animals.

Many functions in the body are controlled by
special compounds. Which statements about
these compounds do you think are true? Check
all that apply.
The body can make all of the compounds it
needs.
.
The body gets energy from some
compounds.
um
Some compounds determine physical
characteristics.

Answers

Answer:

Its either a or b

Explanation:

A say the body can make all of the compound its need

my suggestion compound are made up of water ,mineral protein carbs and fat

our body produce little nutrients so we need to eat to get the nutrients we need

im am going with b

B is the answer

Other Questions
In a non-price rationing system, consumers receive goods and services first-come, first served. Give me an example of a time when a consumer may experience this. A bag contains red and blue marbles, such that the probability of drawing a blue marble is 1/8 An experiment consists of drawing a marble, replacing it, and drawing another marble. The two draws are independent. A random variable assigns the number of blue marbles to each outcome. help please i will be very great full! Help! My cat has done this 3 times. She falls over, starts kicking her leg, and biting it or biting her tail. She usually doesnt do this! Whats wrong with her??? Qu'est que Vasco de Gama ramne de son expdition en Inde ?Bonjour, Dj merci de prendre le temps de lire ma question!Lundi donc demain j'ai un carnet de voyage fait en groupe rendre, et pour cela je doit faire un paragraphe de ce que Vasco de Gama a ramener de son expdition en Inde, et je n'ai toujours pas trouver de rponses a cette question. Si vous pouviez m'aider en me donnant un lien sur le quelle j'aurais des rponses a ma questions ou autre. Merci d'avance!PS: je suis en 5me Identify the type of adverb in the following sentence:Thereafter, he avoided that street corner.O A. Compound adverbB. Coordinate adjectiveC. Simple adverbO D. Phrasal adverbSUBMIT Which of the following statements describes the idea of Manifest Destiny?A. The United States was meant to extend from the Atlantic Ocean tothe Pacific Ocean.O B. The United States will not allow European countries to interfere inevents in the Americas.O C. The United States should develop the most powerful navy in theworld.O D. The United States will be the first nation to explore air travel. If anyone can please help Fill in the blanks with collective nouns 1) A _______ of grapes 2) A ________ of lions 3) A _________ of rice An investment bank has a distributed batch processing application which is hosted in an Auto Scaling group of Spot EC2 instances with an SQS queue. You configured your components to use client-side buffering so that the calls made from the client will be buffered first and then sent as a batch request to SQS. What is a period of time during which the SQS queue prevents other consuming components from receiving and processing a message A motorist travels due North at 90 km/h for 2 hours. She changes direction and travels West at 60 km/for 1 hour.a) Calculate the average speed of the motorist [4]b) Calculate the average velocity of the motorist. In the year 2000 the population of a certain town was 30000. In the year 2001 the population was 35000. What was the increase? Help please i forgot the options on the last one sorry Create an example of a situation where there is a negative cash flow.? were Early Christians were treated well in the Roman Empire. False or True determine the equation of the circle graphed below ( help please ) The United States is a(n)RepublicConstitutional monarchyParliamentary governmentAuthoritarian system Which of the following number patterns uses the rule below Each number in the pattern is four times the previous numberA.6,24,48,72B.7,21,63,189C.5,20,80,320D.4,20,100,500DO NOT ANSWER IF YOUR NOT AT ACE LEVEL Select the correct answer from each drop-down menu.An equivalent expression for 16x 8 is . The Property is used to generate this expression. Two points from the line of best fit can be used to find the slope of the line, which can be used to find the equation of the line. True or false?