in your mouth, teeth grind food

a. mechanical
b.chemical

Answers

Answer 1

this is an example of mechanical digestion

Answer 2

Answer:

A. mechanical

Explanation:

the food isn't being chemical grinded


Related Questions

Grade 8 2020-2021
Which form of energy is almost always produced during energy transformations?
O
A heat
B. electricity
C. light
D. sound

Answers

Answer:

A

Explanation:

Because I searched it up

Answer:

A

Explanation:

During transformations from one form to another, heat energy is almost always produced. Whenever a form of energy is converted to the other form, heat is almost always released during the reaction.

what is the role of the grana in chloroplast?

Answers

Answer:

Grana are the structures formed of coin like structures called thyllakoids that encloses chlorophyll for absorbtion of light essential for photosynthesis.And grana also give green colour to chloroplast.

Explanation:

what are the cells that divide to produce gametes ?

Answers

Answer:

cells needed for sexual reproduction

Explanation:

so that during fertilization,the total number of chromosomes will be 46..

What are the cells that divide to produce gametes? germ cells

What is a gamete?

It is the reproductive cell of an organism. They are haploid in nature. 

How many types of gametes are there?

There is a male gamete that is termed sperm (animals) or pollen grain (plants) and a female gamete that is termed ovum (animals) or egg (plants).

What kind of division occurs prior to gamete formation?

Meiosis, or reductional division, occurs prior to gamete formation.

What is its significance?

It ensures that after fertilization, the normal diploid number is maintained.

What kinds of cells undergo this division to produce gametes?

Germ cells are the cells that produce gametes. 

To learn more about gametes and meiosis here,

https://brainly.com/question/11622266

#SPJ2

and inheritance.
An organism's DNA guides growth, reproduction,
a.
Development
b
Photosynthesis
C.
Homeostasis
d
Organ function

Answers

Answer:

A. Development

Explanation:

This would be correct

What are the important considerations during the classification of nematodes? Describe how nematodes are classified and also different systems of nematode classification?

Answers

Answer:

The important considerations during the classification of nematodes and also different systems of nematode classification is discussed below in details.

Explanation:

Nematodes that generally parasitize humans incorporate ascarids (Ascaris), hookworms, filariasis, pinworms (Enterobius), and whipworms (Trichuris). The species Trichinella spiralis, generally recognized as the 'trichina worm', transpires in pigs, rats, humans, and bears, and is accountable for the disease trichinosis.

which of the following is not a constant?

a. plant height
b. types of beans
c. amount of fertilizer
d. hours of sun exposure

Answers

Answer:

a. plant height.

Explanation:

As you can see in the diagram the plant heights are varied.

How is energy cycled through a cell?

Answers

Answer:The cell needs glucose to have ATP and the cycle is cellular respiration. It turns glucose into energy by forming that ATP.

Explanation:

11
Sea otters move into the ocean bay. The eat all the sea urchins. This change will cause the
A. Kelp to have less food
B. crabs to have less food
C. Sea ducks to have more food
D.Arctic foxes to have more food

Answers

well sea urchins are primarily food for crabs, so by sea otters eating the sea urchins crabs will end up with no good

The presence of sea otters in an ocean bay will result in a reduction in the amount of food available to carbs because they feed on sea urchins. Therefore, option (B) is correct.

What is food chain?

The linear relationship between creatures that demonstrates how they obtain energy by feeding on one another is referred to as the food chain.

The information provided in this inquiry suggests that sea otters migrate into the ocean bay and consume all of the sea urchins there.

This leads one to believe that they cut down on the food supply of another eater of urchins, such as carbs. Because of this, the introduction of sea otters into the ocean bay will result in there being less food available for carbs.

Learn more about food chain, here:

https://brainly.com/question/16065961

#SPJ2

Similar patterns of embryological development in different but related organisms are most likely due to similarities in their
environment
analogous structures
ancestory
fossil forms

Answers

Answer:

fsaf

Explanation:

dsdadsda

Why do the walls of the stomach secrete hydrochloric acid? ​

Answers

Answer: sorry I’m to lazy to type

:)))

WHAT TYPE OF MUTATION IS THIS?

Answers

Answer:

Missense mutation. This type of mutation is a change in one DNA base pair that results in the substitution of one amino acid for another in the protein made by a gene. Nonsense mutation. A nonsense mutation is also a change in one DNA base pair

Explanation:

Select the part whose main job is to direct a plant cell's activities by sending instructions to
different parts of the cell.

vacuole

chloroplasts

mitochondria

nucleus

Please hurry I’m in a rush

Answers

I think it’s the nucleus

Nucleus part main job is to direct a plant cell's activities by sending instructions to different parts of the cell.

What is the short definition of a plant cell?

Plant cells are eukaryotic cells with a genuine nucleus and particular organelles to carry out particular tasks. Plant cells do, however, include several organelles that are unique from those seen in other eukaryotic cells.

Where can you find plant cells?

Roots, stems, leaves, flowers, and reproductive structures are only a few of the major classes of cells and tissues that are formed when plant cells differentiate from undifferentiated meristematic cells, which are similar to the stem cells of animals.

To know more about plant cells visit:

https://brainly.com/question/1493437

#SPJ2

How does the presence of suspense in a story affect readers?

It helps them predict the story’s outcome.
It gives them hints about the characters’ thoughts.
It makes them skip the boring parts.
It keeps them engaged in the story.

Answers

Answer:

Suspense ensures the reader will have enough interest to continue reading throughout the piece. If the author has done his job, suspense will continue to increase up until the climax, or the final confrontation and turning point.

Explanation:

Hope this works out my friend

It keeps them engaged in the story. So, the correct option is (D).

What is Suspense?

Suspense is defined as a state of mental uncertainty, worry, being undecided, or being doubtful. It is the anticipation of the outcome of a plot or the resolution of an uncertainty, riddle, or mystery, especially as it affects a character for whom there is sympathy.

Following are the types of suspense :

Narrative SuspenseShort-term SuspenseRomantic/Comedic SuspenseCliffhangersMysteryHorror

The smart use of suspense in a story that helps build suspense and keep the plot engaging as the reader progresses, and sets the stage for genuine surprise and shock when a major plot point or twist is revealed from an unexpected angle.

Thus, it keeps them engaged in the story. So, the correct option is (D).

Learn more about Suspense, here:

https://brainly.com/question/2517457

#SPJ2

At which type of boundary do rocks react to tectonic stress and pull away leading to the formation of new crust?

Answers

Answer:

Divergent boundary.

Explanation:

At divergent plate boundaries, plates react to tectonic stress and move away from each other. Magma from the mantle hardens on the edge of each plate, forming new crust. I hope this helps!

What event in 1927 was a main reason that the U.S. Army Corps of Engineers implemented many projects in the following years to better protect people and property in the Mississippi delta?
A. an unforeseen dramatic increase in the number of migrating birds passing through Louisiana
B. a major that affected the entire lower Mississippi River valley
C. major hurricane that destroyed most of the buildings in New Orleans and the surrounding areas
D. major oil spill in the Gulf of Mexico areas

Answers

Answer:

B

Explanation:

Answer:

b

Explanation:

If the original strand reads ATT-CCC-GCA what is the complementary strand?

Answers

Explanation:

Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG Gln

AAG Lys

GAG Glu

TCG Ser

TTG Leu

TGG Trp

TAA Stop

TAT Tyr

TAC Tyr

The complementary strand will read TAA-GGG-CGT since the A is complementary to T and C is to G nucleotide.

What are nucleotides?

A biological molecule known as a nucleotide has the basic building blocks of a nitrogenous base, pentose sugar, and phosphate. As polynucleotides, DNA and RNA are composed of a chain of monomers with various nitrogenous bases. The execution of metabolic and physiological processes requires nucleotides.

Building blocks of nucleic acids, energy storage, carriers of activated metabolites for biosynthesis, structural moieties of coenzymes, and metabolic regulators are all roles that nucleotides play in the physiology of animals.

Adenine and thymine and guanine and cytosine are the proper bases to couple with in DNA. Therefore, the complementary strand will read TAA-GGG-CGT since the A is complementary to T and C is to G nucleotide.

Learn more about nucleotides, here;

https://brainly.com/question/28178584

#SPJ2

Meiosis results in? ​

Answers

Meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells.

The process results in four daughter cells that are haploid, which means they contain half the number of chromosomes of the diploid parent cell.

Answer:

It results in the reduction of chromosomes by half and produces four gamete cells.  And those four cells are the result and known as the daughter cells.

Explanation:

In science fiction stories, plants that live on planets far from the sun are often described as having black foliage, while those that live on planets close to the sun are described as having shiny reflective foliage. If the plants on these planets do photosynthesis similar to terrestrial plants, discuss why these colors would be good adaptive features.

Answers

Answer:

See the answer below

Explanation:

The black foliage of the plants that live on planets far from the sun is an adaptive feature to maximize the heat from the sun for their metabolic activities. A certain level of temperature is usually required for optimal metabolic activities and the distance away from the sun means that heat could be a limiting factor. A black color, however, is able to absorb all the available heat in the surrounding. Hence, the black leaf color serves to maximize the heat from the sun for the benefits of the plant.

The shiny reflective foliage of the plants that live on the planets close to the sun can also be viewed as an adaptive feature to minimize the effects of the proximity of the sun. Too much sunlight will cause the tissues of the leaf to heat up beyond the optimal temperature requirement for metabolic activities. A shiny reflective color will reflect more of the rays of light from the sun than it absorbs. Thus, the foliage is prevented from overheating.

out of all these animals which is the biggest emu kangaroo kookaburra wombat

Answers

imma say an emu. emus are pretty scary too ngl

Answer:

kangaroo

Explanation:

Which of the traits below are completely influenced by the expression of genes? (Choose all that apply)
Group of answer choices

weight

hair texture

attached or unattached earlobes

eye color

Answers

Answer:

Hair texture, attached/unattached earlobes, eye colors.

Explanation:

Weight is gained through the individual themselves as they grow and develop. There is no determined weight with genes.

Answer:

I hope this helps.

Explanation:

Complete each statement with the correct term from the drop-down menu.

Answers

Explanation:

but where is statement to correct it ?

Answer:

1. Carbohydrate moves molecules

2. Lipids provide structure for plants

3. Carbohydrates determine what people look like

4. Cells are surrounded and protected by Carbohydrates

5. Proteins speeds up chemical reactions in the body

6. Hemoglobin is built by Nucleic Acids.

7. Human body is insulated by lipids

Explanation:

How do plant cells differ from animal cells

Answers

Answer: Plant cells have chlorophyll, chloroplasts, cell walls, a more blocky shape, and larger vacuoles. Animal cells have a more rounder shape, no cell wall but only a cell membrane, smaller vacuoles, and other organelles such has centrosomes, which plant cells don’t have.

Explanation:

Answer:

Plant and animal cells are  different in that plant cells have chloroplasts and rigid cell walls, while animal cells do not.

Why is it logical to see that “parasitic” genomes tend to be much smaller than similar free-living organisms?

Answers

It’s logical because their small size contributes to the efficiency of their inhabitation of another organism.

Music > color should be read as: a. music on color c. music to color b. music before color d. music then color Please select the best answer from the choices provided A B C D

Answers

Answer:

C

Explanation:

The answerrrr is C . (:

Mature age woman learners list ___ as the most common reason for not completing their degress

Answers

Answer:

Family is the answer

Explanation:

Mature woman have a lot of responsibilities on there shoulder, th house, the kids, the budget planning, job work etc. They just can't have a single minute to waste upon, they have to handle so many things, and they do that all with single hand. They make things perfect and that takes a lot of their time, after doing this all daily chores even Jesus wouldn't have energy to do anything, so how do you expect any human. Woman plays a very responsible role from beginning of the day to night.

HELP PLZZZ!!!......Which feature is created by wave erosion?

A)loess
B)delta
C)rill
D)stack

Answers

Answer:

the answer is d stack

Explanation:

A feature which is created by wave erosion is Stack. Thus, the correct option is D.

What is Wave erosion?

Wave erosion can be defined as the waves which are creating a variety of landforms along with a shoreline. Sea cliffs generally occur when the waves erode rock, resulting in the high slopes formation. Wave energy results into production of erosional formations such as cliffs, wave cut platforms, sea arches, and the sea stacks. These all are features of wave erosion.

Sea wave erosion is accomplished primarily by the hydraulic pressure, the impact of waves that are striking the seashore, and through the abrasion that is wearing, grinding, or rubbing away by the friction by sand and pebbles that are agitated incessantly by the water and wave-cut platform.

Therefore, the correct option is D.

Learn more about Wave erosion here:

https://brainly.com/question/12739135

#SPJ2

HELP PLSSSS
Question 24
2 pts
What is the difference between a question and a hypothesis?
A question is an assumption and the hypothesis is the answer to the assumption.
A question is developed from some observations and the hypothesis is a tentative explanation for that
question.
A question is what you end up with after the test and the hypothesis is a summary of the conclusions.
A question is the summary of data collected and the hypothesis is the interpretation of the data
Question 25
2 pts.

Answers

Answer:

A question is developed from some observations and the hypothesis is a tentative explanation for that

Explanation:

Many signaling pathways have multiple transducer proteins, for example in a multi-enzyme phosphorylation cascade - one of the purposes for this is: _________.
a. to prevent damage to the receptor protein
b. to amplify the signal
c. all choices are correct
d. to avoid gene duplication
e. to conserve ATP and/or GTP

Answers

Answer:

b. to amplify the signal

Explanation:

A multi-enzyme phosphorylation cascade is a series of signaling events where one enzyme phosphorylates to another, then this last enzyme acts to phosphorylate another protein and so successively, thereby triggering a chain reaction that leads to the phosphorylation of hundreds or even thousands of proteins. A multi-enzyme phosphorylation cascade is known to increase the number of activated (phosphorylated) proteins at each step of the signaling cascade. Phosphorylation is a posttranslational modification capable of activating proteins during long periods, thereby a phosphorylation cascade also enables the activation of multiple proteins before these proteins become inactive again.

One of the purposes of a multi-enzyme phosphorylation cascade is signal amplification, as shown in option B.

We can arrive at this answer because:

A multi-enzyme phosphorylation cascade allows the emission of a sequence of signals, which occur simultaneously.These signals are created from a series of enzymes, each of which emits a signal by phosphorylating a protein.This all promotes thousands of phosphorylations to be promoted at the same time, all giving off signals.This simultaneous emission of signals extends the range of these signals and allows the phosphorylated proteins to emit more signals, further expanding their reception.

In this case, we can state that the multi-enzyme phosphorylation cascade has the function of amplifying an emitted signal.

More information:

https://brainly.com/question/14275060?referrer=searchResults

1) Jupiter, mars, and_______ have wind
2) ______ means to wear away
3) at a wind farm they harvest_______ energy

Answers

Answer:

1)Earth

2)disappear

3)Solar energy

Explanation:

I am not sure but hope it helps let me know if its correct.

GOOD LUCK!

GORAN
NARGO MYSETS
OMSRANOG
LECL
SUSTIE
Unscramble these words

Answers

I just answered your other post with these questions. (:
Other Questions
Slope-intercept form: write an equation from a graph What is the solution of StartRoot x + 2 EndRoot minus 15 = negative 3?x = 142x = 232x = 322no solution $80 jacket: 15% off: 5.5% tax Five out of eight birds that visited the feeder ate the birdseed. If 60 birds ate the birdseed today, how many birds visited the feeder? Wow! You know so much about German! Your friend Jordan, however, knows nothing about it. Dawn is buying a pair of pants that cost $34.98. Tax is 8.2%. What is the total cost of the pants with tax included? Ally's tricycle has two different wheel sizes: one larger wheel and two smaller wheels. As Ally travels the distance between her house and her neighbor's house on the tricycle, the larger wheel revolves 10 times and each of the smaller wheels revolve 25 times. If half the circumference of the larger wheel is 5 inches more than the circumference of one of the smaller wheels, what is the distance, in inches, traveled by the tricycle between Ally's house and her neighbor's house? After 100 spins, Lincoln calculated the probability that he would spin a prime number to be 0.35. Using thespinner, what is the theoretical probability of spinning a prime number?An 15 Help me please! I'll mark brainliest The prologue of Romeo and Juliet is read by an actor at the end of the playTrue or False?!! HELP PLS HURRY LOL Whats the craziest WiFi password youve encountered? Tom has $60 dollars. He spends $7 for lunch each day. Which equationshows how much money c he has left after d days?D. None of theseA. c = 60 + 7dB. = 60 - 7dC. = 60 - 75 More water is evaporated by oceans than is returned to them by precipitation. What is the source of the balance of the water? Select the correct text in the passage.Which sentence in the passage best shows how the setting contributes to Mr. Andersen's problem?The Alarming Awakeningby Tirzah TylerMr. Andersen leaned his arm on the bench at the bus stop and rested his head in his hand. Taking a deep breath andclosing his eyes, he wondered how much longer he would have to wait for his bus to arrive.If I hadn't stayed up so late last night playing games on my new cell phone, I wouldn't be so sleepy this morning hethought I suppose worse things could happen, though. Instead of having to keep a doctor's appointment I could have to doyard work at my mother's house. That always makes my back hurtHe looked at his phone and noticed that the time was now 8:52 a.m. His bus was scheduled to arrive at 9.08 a.m. Theovercast sky and the rhythmic whizzing of the traffic at the bus stop made him drowsy. He closed his eyes and thought, I haveenough time for a power nap before my bus arrives. He set the alarm on his phone for 9:06 a.m. so that he would be awake intime. Then he crossed his arms, rested his head on his chest, and drifted off peacefully to sleep.A passing car honked and awakened Mr. Andersen from his slumber. He looked at his phone and saw that the time wasnow 9:19 a.m. Panicked, he turned off the alarm and discovered that the volume on his phone's alarm clock was turned downcompletely. Oh, no, the bus left without me! he thought. How will I keep my appointment now? Instinctively, he called hismother."What a pleasant surprise!" his mother exclaimed over the phone. "You never call me on a Saturday.""Hi, Mom," Mr. Andersen said. "Can you please drive me to my doctor's office? My appointment is at 10 a.m., and he will The oldest documented forms of art are the visual arts.1) True2) False The movement of energy in an ecosystem can be shown using a:spider webweb of lifefood chain Line t has a slope of -9/2 line u is parallel to t what is the slope of u Plz show how u got the answer The perimeter of a triangle is 173 - 5 units. One side is 3x + 5 units and another is 82 3 units. How many units long is the third side?A.6x-7B.6x-13C.12x-7D.22x-23 (1) On May 18, 1980, Mount St. Helens sent an explosion of ash, gas, and rock into the sky. This eruption led to the death of 57 people, in addition to permanently changing the surrounding landscape. It is still one of the most disastrous volcanic eruptions in recent history.(2) Mount St. Helens is located in the Cascade Mountain Range in Washington, United States. It is part of the Ring of Fire, an important geological area. This area is home to over 160 active volcanos. Volcanos are active if they have erupted at least once in the last 10,000 years. Mount St. Helens is a stratovolcano. This means it is a steep, evenly shaped cone made of many layers of volcanic rock and ash. These volcanos often have explosive eruptions.(3) Before the eruption of Mount St. Helens, a bulge of rock formed on the northern side of the mountain. Then, early on May 18th, an earthquake occurred that was caused by increasing pressure inside the mountain. This led to a landslide. The force of the landslide collapsed the entire northern side of the mountain, which led to a lateral blast. Lateral blasts occur when volcanos erupt sideways, rather than at the peak. This lateral blast sent rocks flying for miles at high speeds. These blasts destroy forests, buildings, and other structures in a short amount of time. The lateral blast at Mount St. Helens destroyed an area of about 150 square miles. It destroyed forests and left debris in three-inch layers, making the situation even more disastrous.(4) When Mount St. Helens erupted, clouds of deadly ash, volcanic rock, and pyroclastic flows flew outward from the volcano. Pyroclastic flows are more dangerous than lava flows. They are made of gas and volcanic matter. The temperature inside one can reach 1832 F. They move at a speed of more than 50 miles per hour. It is impossible for humans and animals to outrun them. These flows make the eruption of stratovolcanos deadly. As a result, the forests covering the mountain were ruined. Fortunately, there weren't any towns near enough to be destroyed.(5) By the time Mount St. Helens finished erupting, a crater had formed at its top. Forests had been destroyed for miles and rivers had been blocked by debris. Clouds had even blocked out the sun in the entire state. It took years for the environment to recover. evaluate the expression (718+45)32please help