Increasing the number of coils in a solenoid or an electromagnet results in a ___
magnetic field.

Answers

Answer 1

Answer: Stronger Magnetic Field

Explanation:

The magnetic field in a solenoid is given by

[tex]B=\mu nI[/tex]

where B=magnetic field

[tex]\mu=[/tex]Permeability

n=no of turns per unit length

I=Current through solenoid

When No of turns increases, it increases the strength of the magnetic field.  

Answer 2

Answer:

Hey I saw that you had the Geometry end of year review escape room I was wondering if you maybe had the answers and work for the rest of the pages?

Explanation:

Thank u


Related Questions

“Fish and other wildlife become unhealthy and die without __________.”

Oxygen
Carbon Dioxide
Eutrophication

(This is 7th grade science)

Answers

Answer:

Oxygen

Explanation:

Andwer is oxygen if not then eutrophication

the final phase of mitosis characterized by the separated chromosomes reaching the poles
of the cell. The nuclear membrane and nucleolus begins to reappear around each set of
chromosomes

Answers

Answer:

Telophase

Explanation:

WILL MARK BRAINLIEST!!!!Which of the following processes express the information encoded by DNA
and RNA?
A. Transcription and translation
O B. Asexual and sexual reproduction
C. Photosynthesis and respiration
D. Mitosis and meiosis

Answers

Answer:

C

Explanation:

Thats the tea

Hope this helps ;)

The process that expresses the information encoded by DNA and RNA is Transcription and translation, so option A is correct. Transcription is the process by which the genetic information stored in DNA is transcribed into RNA.

Transcription is the process by which the genetic information stored in DNA is transcribed into RNA. It involves the synthesis of an RNA molecule using one strand of DNA as a template. The resulting RNA molecule, known as messenger RNA (mRNA), carries the genetic information from the DNA to the site of protein synthesis. Translation, on the other hand, is the process by which the information encoded in mRNA is used to synthesize a specific protein. It takes place in ribosomes, where transfer RNA (tRNA) molecules interpret the genetic code on the mRNA and bring the corresponding amino acids to assemble the protein chain.

Learn more about transcription and translation here.

https://brainly.com/question/29979094

#SPJ2

which layer of the earth is made out of melted metal?

Answers

The outer core. A molten nickle- iron alloy.

when you breathe in air you bring oxygen into your lungs and blow out. A.Carbon dioxide B.oxygen C.carbon monoxide D.hydrogen​

Answers

Answer:

Carbon dioxide

Answer:

Carbon Dioxide

Explanation:

A dead organism takes matter out of the ecosystem cycle and that matter
can never be used again. *
O True
False

Answers

Answer:

Decomposers break down dead organisms into nutrients and gases so that they can be used by other organisms. Nutrients can enter or exit an ecosystem at any point and can cycle around the planet.

Answer:

False

Explanation:

How does evolution result in reproductive success?

Answers

Answer:

Often when species evolve, they receive a trait that may make them live longer or make it where their survival chances are significantly increased. Which in turn can make their offspring stronger and able to live longer, therefore increasing their population.

PLEASE HURRY I AM TIMED!!!
Are aliens real? Explain your answer.

Answers

Answer:

No, not according to any sciences (unless you mean aliens as in immigrants)

Explanation:

There is no way that we are the only living thing in the entire world. There has to be another species out there.  They might be wondering if there is another living thing out in space too.

20 points and brainliest! Explain how you got the answer!

Answers

Answer:

No of groups studied

As All other factors will effect the result ofvthe experiment.

But no matter how many groups you take to study they will show the same result

HOPE YOU GOT IT!

MARK ME AS BRAINIEST

all you need is in the photo ​

Answers

Answer:

Aerobic means 'with air' and refers to the body producing energy with the use of oxygen. This typically involves any exercise that lasts longer than two minutes in duration. ... Anaerobic means 'without air' and refers to the body producing energy without oxygen.

Explanation:

hope this helps if not i'll try to figure out the answer for you

HELP ASAP
A scientist was studying the stars and their influence on the personalities of 100 people over a Four year time period. Through his investigation, he determined that people that were born during August were more strong-willed and driven than individuals born in October. People born in October were more relaxed and could better handle stress. Is the scientist’s research considered science?
Yes, because the scientist conducted his research for an extended period of time.
Yes, because the scientist followed the scientific method.
No, because the scientist conducted his research with 100 people
No, because the scientist followed personalities which is pseudoscience.

Answers

Answer:

No, because the scientist followed personalities which is pseudoscience.

Explanation:

A scientist was studying the stars and their influence on the personalities of 100 people over a Four year time period

Through his investigation, he determined that people that were born during August were more strong-willed and driven than individuals born in October.

People born in October were more relaxed and could better handle stress

Is the scientist’s research considered science?

No, this are beliefs not necesarily true.

submit this form. Not you? Switch account
* Required
3. How do the biotic factors in an ecosystem depend on the abiotic factors

Answers

Answer:

biotic factors depend on abiotic factors for survival

Explanation:

Answer 15 and 16 correctly and I will mark as brainliest

Answers

Answer:

I think its A and G

Answer:

15. B.

16. H

Explanation:

What is the difference between a detritivore and a decomposer?
A.While detritivores consume animals, decomposers only consume plants.
B. While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
C. While detritivores consume both plants and animals, decomposers only consume dead animals.
D. While detritivores are heterotrophic, decomposers are autotrophic.

Answers

What are detrivores?

Detritivores are organisms that feed on the organic waste of dead plants and animals

What are decomposers?

Decomposers are organisms that break down dead or decaying organisms; they carry out decomposition, a process possible by only certain kingdoms, such as fungi. Decomposers are the organisms that decompose dead plants and animals.

Difference between detrivores and decomposers

Option C is the the correct answer

While detritivores consume both plants and animals, decomposers only consume dead animals.

Read more about organisms

https://brainly.com/question/25832580

Answer:

While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.

Explanation:

The answer explains itself. It is accurate information. :) Have a good day!

Answer this please I promise 30 points + mark as brainliest ( only relevant answers )

Answers

Answer:

A) Group X = Rose ,mango tree,marigold,palm tree

B) This is the answer of group X =Rose ,mango

This is the answer of group Y =Fern ,pine trees

Explanation:

Answer:

jen, from my heart im saying i lu.v u for real

its been almost 5 months weren't having the same old c.hat we used to have.

ik that ur scared to c.hat with  me since the day ur mom caught u

but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u

and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could

i'll be waiting for that moment and i hope u would be too...

still lu.v u :(  .......


Which of the following characteristics of carbon is responsible for the variety of carbon-based molecules on Earth?

Answers

Answer:

It can form bonds.

Explanation:

(I'm in ap bio  so I know a lot, lol, hope that helps)

Two offspring from same parents can have different phenotypes. How is this possible?​

Answers

Answer:

Genes come in different varieties, called alleles. Somatic cells contain two alleles for every gene, with one allele provided by each parent of an organism. However, an allele that is hidden, or not expressed by an organism, can still be passed on to that organism's offspring and expressed in a later generation.

Explanation:

Overdominance, in instance, happens when a heterozygote exhibits a more extreme phenotype than either of its parents.

What is heterozygote?

Heterozygote is defined as a person, animal, or other thing possessing a pair of different alleles of a specific gene, one of which is dominant and the other recessive. One normal allele and one mutated allele, or two distinct mutated alleles, can make up a heterozygous genotype.

The explanation is connected to the fact that each parent has two different gene pools. Furthermore, only 50 percent of each parent's DNA is transferred to their offspring. and that the portion that is passed down is random. Every child has a unique set of genes thanks to the interaction of all these influences.

Thus, overdominance, in instance, happens when a heterozygote exhibits a more extreme phenotype than either of its parents.

To learn more about heterozygote, refer to the link below:

https://brainly.com/question/12891396

#SPJ2

Researchers have found that mitochondria and chloroplasts in eukaryotic cells have their own DNA. This DNA is different from the DNA in a eukaryotic cell's nucleus. Chloroplasts and mitochondria use their own DNA and ribosomes to make some organelle-specific proteins.

What statement is best supported by this information?

A.
Modern cells could exist without mitochondria and chloroplasts.
B.
Early prokaryotic cells engulfed eukaryotic cells, which later became mitochondria and chloroplasts.
C.
Early eukaryotic cells engulfed prokaryotic cells, which later became mitochondria and chloroplasts.
D.
Mitochondria and chloroplasts could exist outside of modern cells.

Answers

Answer:

B.

Explanation:

Answer: Early eukaryotic cells engulfed prokaryotic cells, which later became mitochondria and chloroplasts.

Explanation: just did the test its right.

How is evaporation related to precipitation?

Answers

Since Precipitation is rain evaporation is water which is turning in to gas and goes to the air or atmosphere

1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:

Answers

Answer:
mRNA: UAUGCUUUAGCGCUAGCGCCGCUAAGCC

CODONS: AUG-GAA-AUG

AMINO ACIDS: METHIONINE-LEUCINE


Explanation: hope this helps
i am so confused is this an actual question or is it just random letters?-

please help with this question

Answers

Answer:

C

Explanation:

the answer is C bc I read this and u can site it in the text

How are chromosomes affected by aging

Answers

Answer:

delaying cell senescence, apoptosis, and death

Explanation:

Answer:

the enzyme telomerase adds specific DNA sequence repeats to the chromosome ends that are lost through cell division, thus restoring telomere length and delaying cell senescence, apoptosis, and death

Explanation:

Arrange these energy sources from highest to lowest percentage of worldwide use. 1, Nuclear 1. Coal * Hydroelectric​

Answers

Explanation:

hydro coal nuclear i think it would like thst

The arrangement of the energy according to the highest to the lowest percentage of worldwide use is coal, hydroelectric and nuclear. The arrangement is 2, 3, and 1.

What is energy?

Energy is a quantitative property that is used in doing any work. The energy is always transferred from one form to another form. It is present in the conserved form.

The energy which is used majorly is coal, then hydroelectricity, which is made by water then the nuclear power plant.

Thus, the arrangement is 2. Coal, 3, hydroelectric, 1. Nuclear energy.

Learn more about energy, here:

https://brainly.com/question/12396199

#SPJ2

Why do you think that some definitions of forest have a certain percentage of the land that must be covered in trees?

Answers

Answer:

30 percent tree cover - 2000 - 2009JPEG ... of forest cover vary widely—as much as 6 percent of Earth's land area, or the equivalent area of China.

Explanation:

What are the 3 main types of star "corpses"? plz hurry

Answers

Answer: white dwarfs, neutron stars, and black holes

Explanation:

please help meeeeeeeeeee

Answers

Answer:

D

Explanation:

D like the person above

1. Would you consider a Zonkey (baby created from a donkey raised with a zebra) alive? Keep in mind that a Zonkey is sterile and cannot produce its own offspring.


2. Would you consider a virus alive? It requires a host completely to live.


Answers

Answer to 1:Yes the Zonkey is alive,not all organisms can reproduce. Some people are born with rare genetics were they can't give birth,so even if the Zonkey is sterile and can't produces it own offspring it is alive.

Answer to 2:Yes a virus is alive,it attacks the host and contains/kill other cells in your body. They also can multiple. If they can multiply and even attack and kill other cells they are alive.

Which other food items were digested by lactase, the enzyme that breaks down milk?

Answers

Answer:

im not sure what you mean by this question but ill answer the best way i can!

Explanation:

Bread and baked goodsMilk chocolate and some candiesSalad dressings and saucesBreakfast cereals and cereal barsInstant potatoes, soups, rice and noodle mixesLunch meats (other than kosher)Cheese flavored crackers and other snacks

these are foods containing lactose in them, which lactase breaks down.

hope this helps!

i need some help on this i dont know can someone plz help me

Answers

Answer:

D is your answer I believe

The folded plasma membrane inside the cell is the ______.
A: endoplasmic reticulum
B: mitochondria
C: vacuole
D: vesicle

Answers

A is the answer because this the only thing that folds
Other Questions
The admission tickets to an exhibition at $5 for an adult and $2 for a child. A family of 3 adults and 4 children visited the exhibition. What would be the charge if $50 note was used to buy the tickets? What is the area of a circle with a radius of 5 cm? Find the area of a parallelogram ABCD with AB =7 m. AD = 20 m and BAD = 62. Why milk sours is chemical change ? Use the diagram showing m || n, as well as the relationships between interior and exterior angles of ABC, to answer the questions. 4. Describe the turnover of power in Hawaii from King Kalakaua to his sister Queen Liliuokalani toSanford B. Dole. a. tan2 -sin= sin2 tane The feet of a poem can easily be compared to _______.a heartbeatfootstepsa musical beata drum beat 1. Who does the person on the left represent (look at what hes holding)?2. Who does the person on the right represent (holding)?3. What is the main idea of the cartoon?4. What do you believe was the general perception of the Populist Party at the time? The narrators felicity comes to an end the moment his cat disappears. Which human activity negatively affects the stability of the environment? Write a method that takes a RegularPolygon as a parameter, sets its number of sides to a random integer between 10 and 20 inclusive, and sets its side length to a random decimal number greater than or equal to 5 and less than 12. Use Math.random() to generate random numbers.This method must be called randomize() and it must take an RegularPolygon parameter. Could someone help me out here thanks! C: What are the 3 types of hazards in the kitchen? There are 12 boxes of books to put on shelves can you spell it has 31 bucks each shelf holds 18 books Kevin estimates he will need 20 shells for all the books In which of the following culture areas would movement of trade goods be made easier by river and lake connections A all of the above B southwest indiansC great plains indiansD great basin indiansLook at the mapAs soon as possible I need help if you can that would be great thank you What was the attitude of the white men who came to Umuofia regarding the languageand culture of the people?25STUDY GUIDE (things fall apart) Give three differences between parenchyma and selerenchyma? 14. Quadrilateral ABCD is located at A(2,0), B(3,-4), and C(7,-5). What are thecoordinate of point D that makes the quadrilateral a rhombus?PLEASE HELPPP 1. This is the process of figuring out the meaning of an artwork.-principles of design-critique-elements of art-interpretation2. This term describes the standards that are used to judge something.-criteria-animation-abstract-perspective3. These ideas connect you to different cultures.-first impressions-elements of art-cultural associations-shared interests4. This term describes the act of protecting something and making sure it stays in its best condition.-portrait-preserve-present-gallery5.This term can describe a person's beliefs, music, food, artwork, clothing style, and language.assumptionscultureassociationsimages6.What term describes the glass effect Tiffany was using in his factory to make vases with golden flecks and black areas. -tornado glass effect-honey bee glass effect-sunshine glass effect-volcanic glass effect7.When comparing interpretations with another person, what should you use to explain your thoughts?evidence from your lifewhat you heard another person saythe artist statementresearch from the Internet8. When people share _____, it helps to create culture.gendershoe sizeexperienceshair color9. Where would you see examples of the art nouveau movement? Select all that apply.household itemspaintingsillustrationslight art installations10. Which structure would be considered a part of the art nouveau movement?-Grand french colonial art nouveau style door-Multi-story adobe buildings from Taos Pueblo in New Mexico where Indigenous people are still living after over a thousand years-Supreme Court Washington DC USA-Downtown Chicago buildings in morning time.11. What is one of Tiffany's biggest contributions to the decorative arts movement in America?creating a new type of milky glasscreating blown-glass, abstract sculpturesmaking photographs of animals. incorporating people's faces into lamps12. Where should you place a horizon line to create the most visual interest in a landscape artwork?-in the center-at the very bottom-at the very top-on one of the thirds13. This term refers to the connections you make.-culture-assumptions-associations-images14. This term refers to the building blocks of art. -critique-elements of art-principles of design-interpretation15.What is a general interpretation of the castle at Disney World?-the place where you first met Mickey Mouse-a place that reminds you of a family vacation-a symbol of a fairy-tale place-a place that makes you feel excited16.In the rule of thirds, where should an artist place their subject?-in the bottom corner-where the lines cross each other-in the top corner-directly in the middle17. The term favrile means _____.-glass that is handmade and unique-glass that is only made in Italy-a factory where glass is made-slight or discreet18.The women in illustrations during the art nouveau movement looked as if they were in _____.-a magazine-business clothes-a fairy tale-a sports game19. What led Picasso to working in the cubist style?-Mexican animal sculptures-African masks-Russian nesting dolls-American landscape paintings