Individual freedom
Compromise
Majority rule and minority rights
Equality before the law
Fundamental dignity and worth of the individual
Private property rights
Due process of law
Voting

What is one example of the type of government with the characteristics listed above?

A-Dictatorship
B-Oligarchy
C-Absolute monarchy
D-Republic

Answers

Answer 1

Answer:

D

Explanation:

Monarchy doesn’t have voting, Dictatorship doesn’t appreciate equality, Oligarchy is a small number of people, so I would assume the answer is D, republic. Hope this helped!


Related Questions

what was life like for German American during ww2

Answers

Very bad they were killed and they were dying by the numbers

How did railroad expansion affect the prices of goods during the Gilded Age?

(A) Shipping products by railroad was much cheaper, and the cost of goods decreased.
(B) Shipping products by railroad was much slower, and the cost of goods decreased.
(C)Shipping products by railroad was more time consuming, and the cost of goods increased.
(D) Shipping products by railroad was more expensive, and the cost of goods increased.

Answers

The answer would be A since it allowed people to produce more products and ship them by railroad which was cheap.

Answer:

The answer is AAAAAA

Explanation:

Why did North Korea invade South Korea?

Answers

Answer:

This conflict began on June 25, 1950, when North Korea, a communist nation, invaded South Korea. ... By invading South Korea, North Korea hoped to reunite the two nations as a single country under communism. With North Korea's invasion of South Korea, the United States feared the spread of communism.

Explanation:

hope this helps

Answer: This conflict began on June 25, 1950, when North Korea, a communist nation, invaded South Korea. By invading South Korea, North Korea hoped to reunite the two nations as a single country under communism. With North Korea's invasion of South Korea, the United States feared the spread of communism.

PLS HELP With this Question!!!

Answers

Answer:

I'm pretty sure it's D

(sorry if I get it wrong)

how did World War I contribute to the African-American great migration

Answers

Answer:Created jobs in the north

Explanation:

Which statement best completes the timeline?
The Mississippians
build large earth
mounds.
The Iroquois form
a large league of
American tribes.
The Lakotas
become skilled
riders and hunter:
?
A. The United States wins its independence.
B. The first African slaves are brought to North America.
C. British colonists arrive in North America.
D. Ancestral Puebloans develop advanced pottery.
PLS ANSWER QUICKLY

Answers

Answer:

the answer is B the Mississippi by build large earth mounds.

Explanation:

:))

2. Why is making fruit popsicles a physical
change? (You can make fruit popsicles by mashing
and freezing fruit.)

Answers

Answer and Explanation:

a usually reversible change in the physical properties of a substance, as size or shape:

Freezing a liquid is a physical change.

How did banking change in Europe from the 1700s to the 1800s? The number of private banks sharply increased. The number of private banks sharply decreased. The number of government banks sharply increased. The number of government banks sharply decreased.

Answers

Anwser:

Perhaps the most spectacular changes in the 16th-century economy were in the fields of international banking and finance. To be sure, medieval bankers such as the Florentine Bardi and Peruzzi in the 14th century and the Medici in the 15th had operated on an international scale, but the full development of an international money market with supporting institutions awaited the 16th century. Its earliest architects were South German banking houses, from Augsburg and Nürnberg in particular, who were well situated to serve as financial intermediaries between such southern capitals as Rome (or commercial centres such as Venice) and the northern financial centre at Antwerp.

Answer:

The number of private banks sharply increased.

Explanation:

Just took the quiz :)

By the 1820s, the state of New York's education system had established
A
the first public university in the United States.
B
public elementary schools in almost every town in the state.
С
vocational schools to help untrained young adults gain needed job skills.
D
property requirements that made it so only the wealthy could access public schools.

Answers

Answer:

B. public elementary schools in almost every town in the state.

Explanation:

It was documented that in the early 19th century, the New York State had established a system of public schools that are located across the state, by the common school law of 1812. This system was controlled under the leadership of Gideon Hawley who serves as the first Superintendent of Common Schools.

Hence, by the 1820s, the state of New York's education system had established "public elementary schools in almost every town in the state."

The Cold War was a time best characterized by which word?

Answers

Answer:

tension

Explanation:

Answer:Tension

Explanation:

Birth of the Earth Video Questions
Why has it been difficult for scientists to determine the age of the Earth? (3 items)

Answers

It has been difficult for scientists to determine the age of the Earth because there is no direct evidence. All the old rocks that could have proved how old Earth is were destroyed and recycled into new rocks from natural causes.

Answer:

Because we are not actually exactly certian when the Earth actually began. For all we know, it could have been millions or trillions of years before the Caveman and Dinosaurs were even alive.

Explanation:

Anyone know the answer to these I’m stuck

Answers

the questions are too small i don’t think anyone can see it please make it bigger

does a spiritual person believe in god?

Answers

Answer:

yes because the meaning of spiritual is believing in spirituality and God...

I wouldn’t necessarily say they believe in God (although some do). Maybe they believe in different Gods or perhaps just one. But not all do. When someone is spiritual it just means that they have a broad concept with room for many perspectives.

Which of the following would have the greatest impact on an individual’s political socialization?

Answers

Answer:

Political socialization is the "process by which individuals learn and frequently internalize a political lens framing their perceptions of how power is arranged and how the world around them is (and should be) organized; those perceptions, in turn, shape and define individuals' definitions of who they are and how they should behave in the political and economic institutions in which they live." Political socialization also encompasses the way in which people acquire values and opinions that shape their political stance and ideology: it is a "study of the developmental processes by which people of all ages and adolescents acquire political cognition, attitudes, and behaviors." It refers to a learning process by which norms and behaviors acceptable to a well running political system are transmitted from one generation to another. It is through the performance of this function that individuals are inducted into the political culture and their orientations towards political objects are formed. Schools, media, and the state have a major influence in this process.

Explanation:

if you need anything else I'm here to help

The French and the British_____ A) tried unsuccessfully to work together in the fur trade B) were both uninterested in expanding their empires C) allied themselves with different Indian tribes​

Answers

Answer:

C

Explanation:

Both the British and the French wanted to expand their empires so B is incorrect. They did, however ally themselves with different Indian Tribes.

What task did the second continental congess give the five me?

Answers

Rip king von‼️ to send respect mark me brainiest

Was war the only option for Europe in ww1 Could there have been another solution?

Answers

Answer: No the war  could have been avoided

Explanation: This came from a online proffeser

I think it is quite possible that the First World War needn’t have happened, and sometimes great catastrophes happen because of accidents. I think the decision by the Archduke to go to Sarajevo was one of those fateful decisions. His decision to stay in Sarajevo after the first assassination attempt and then go to the hospital to see the man who had been wounded in the first assassination attempt, his chauffeur taking the wrong turning and his car getting stalled, those were accidents.

I think if the Archduke had not been killed, things might have turned out very differently. Ironically, he was one of the key voices in Austria who had always opposed war on Serbia up until this point. So, with his death, that restraining voice was removed and the Austrian hawks had the excuse which they’d been looking for to try and destroy Serbia.

So, yes, I think it’s an interesting question. I don’t think the First World War was inevitable. I think it is always possible to avoid war, and we should always think in that way. If we think things are inevitable, then we just throw our hands up and don’t do anything. So, yes, I think accident played a very large part in the outbreak of the First World War in 1914.

2.What are the causes of economic disparities in core,semi periphery,and periphery countries?​

Answers

(iii) Growth in technology widens income gap. Growth in technology arguably renders joblessness at all skill levels [3]. ...
(iv) Gender does matter. In many countries, there is a gender income gap in the labor market [3]. ...
(v) Personal factors. ...
(ii) Globalization.

Which requires the smallest percentage of signatures?

recall
referendum
initiative
amendment

Answers

The one that requires the smallest percentage of signatures is initiative. Option C. This is further explained below.

What are Initiative, referendum, and recall?

Generally, By petition, citizens may use initiative, referendum, and recall to propose or repeal laws and remove officials from office.

In conclusion, the Initiative needs the fewest number of supporters to succeed.

Read more about referendum

https://brainly.com/question/8517640

#SPJ1

What was the impact of the John Peter Zener trial? Any help would be greatly appreciated. ​

Answers

John Peter Zenger was a German printer and journalist in New York City. Zenger printed The New York Weekly Journal. He was accused of libel in 1734 with the aid of William Cosby, the royal governor of New York, however the jury acquitted Zenger, who grew to become a image for freedom of the press.

Allen finds himself addicted to an illegal drug. Though he considers his crime harmless, his offense is considered a crime against ____________.

Answers

Answer:

B. Society

Explanation:

If you're doing edginuity, this is the answer

Proof:

• Describe the living conditions in early urban centers in America.

• Explain why millions of Europeans and Asians left their home countries in the late 1800’s for the

United States​

Answers

Answer:

Fleeing crop failure, land and job shortages, rising taxes, and famine, many came to the U. S. because it was perceived as the land of economic opportunity.

What is the name of the fee paid for an insurance policy?

Answers

Answer:

An insurance premium is the amount of money an individual or business pays for an insurance policy. Insurance premiums are paid for policies that cover healthcare, auto, home, and life insurance. Once earned, the premium is income for the insurance company...i dont know if this will help but yh peaceeeeeee

Explanation:

Answer:

“Be strong and courageous. Do not fear or be in dread of them, for it is the LORD your God who goes with you. He will not leave you or forsake you.” [Deuteronomy 31:6]

Explanation:

What caused the United States to enter WWI?

A. Mexico attacked the US

B. President Wilson wanted to help Serbia

C. Unrestricted Submarine Warfare

D. Britain paid us a good sum of money to join

Answers

Answer:

A. Mexico attacked the

Explanation:

U.S. Entry into World War I, 1917. ... Wilson cited Germany's violation of its pledge to suspend unrestricted submarine warfare in the North Atlantic and the Mediterranean, as well as its attempts to entice Mexico into an alliance against the United States, as his reasons for declaring war.

Choose the number line that correctly compares 24 and 4.256

V24 4.256

++ toot

4.0 4.1 4.2 4.3 4.4 4.5 4.6 4.7 4.8 4.9 5.0

V24

4.256

tot + +tot

4.0 4.1 4.2 4.3 4.4 4.5 4.6 4.7 4.8 4.9 5.0

O

4.256

V24

+ tot

4.0 4.1 4.2 4.3 4.4 4.5 4.6 4.7 4.8 4.9 5.0

US

4.256

V24

++++++

to

4.0 4.1 4.2 4.3 4.4 4.5 4.6 4.7 4.8 4.9 5.0

Review progress

Question 1

ofs

Back

Next →

Answers

Answer:

Explanation:

4.0 4.1 4.2 4.3 4.4 4.5 4.6 4.7 4.8 4.9 5.0

I'm not sure i think it is

who was the 5th President of the U S​

Answers

Answer: James Monroe

Explanation:

What effect does the Free Homes Act of 1900 have on you?
A. All of your land debt is absolved, except for your filing fee.
B. All of your land becomes a government-owned cooperative,
C. All of your land will be cared for by American Indians.
D. All of your land will stop being taxed, freeing resources for irrigation,

Answers

Answer:

D

Explanation:

The Free Homes Act saved settlers in Oklahoma an estimated $15 million. Those who stayed on their claims for five years saved on average four hundred to five hundred dollars, money they used to improve houses and outbuildings, purchase livestock and equipment, and prove up their homesteads.

Answer:

d i think

Explanation:

What is a prorupted state

Answers

Answer: A compact state that has a portion of it’s boundary extending outward exceedingly more than the other portions of the boundary.

An example of a prorupted state is Thailand

Why did Americans need to use the Mississippi River and New Orleans?

Answers

Answer: Because New Orleans was a very important trading port. ... The New Orleans was very important for importing and exporting goods;Mississippi River was a major transportation for settlers and good to ship items east.

Explanation:

Answer:

Why did Americans depend on the Mississippi River and access to New Orleans? New Orleans was a port that was very busy with settlers and traders with expensive furs and very important.


When Buddhism spread into China in the 1st Century CE, it came from its home country of
O India.
O Vietnam
O Japan
O Korea,
< Previous

Answers

Answer:

India

Explanation:

Buddhism came from India. Prince Siddhartha Gautama

Answer:

all of them are correct

india

Vietnam

japan

Korean

Other Questions
Find the length of side b in the right triangle below. Round to the nearest tenth if necessary A. 8B. 16 C. 32 D. 64 Which thesis is stronger? Explain your answer using complete sentences.A) Globalization has created many new jobs in India. B) Globalization has had a positive effect on India because it offers new solutions to poverty. What is your best memory? In the story behind Barz vets with PTSD basin new Warzone with little support how did David Carlson time at war change him A scientist walking through a forest recorded as integers the heights of 5 trees standing in a row. She observed that each tree was either twice as tall or half as tall as the one to its right. Unfortunately some of her data was lost when rain fell on her notebook. Her notes are shown below, with blanks indicating the missing numbers. Based on her observations, the scientist was able to reconstruct the lost data. What was the average height of the trees, in meters? why did washington did not want political parties??why did jefferson did want political parties?? Which ion has smaller size and why?Mg++ or Na+. Which statement about Monsoons in South Asia is true?Question 1 options:They are seasonal winds that bring rain. They occur all year. Another term for them in Hurricane. They only occur in India Explain why the slope of the line drawn in part C must be negative. what is the value of the product 2/3 * 9/5 Several important physical needs that organisms receive from the environment are:water, minerals, carbon dioxide, and oxygenthe balance of nature, minerals, carbon dioxide, and oxygenwind, minerals, carbon dioxide, and oxygen anyone good with english i need help What is the value of x? 1. 1422. 713. 1524. 76 what is the equation of aline that passes through the point (4,-8) and has a slope of -1/2? 7x+5y=40 2x+4y=-4Solve the system of equations What is the value of X in this DiagramI will give a brainlist for the correct answer what happened to elizabeth proctor by the end of the story Function A is represented by the equation y = 4x + 6.Function B is a linear function that goes through the points shown in thetable.x 13 4icy 3 9 12 18Which statement correctly compares the rates of change of the twofunctions?A. The rate of change of function A is 6.The rate of change of function B is 3.B. The rate of change of function A is 4.The rate of change of function B is 6.OC. The rate of change of function A is 6.The rate of change of function B is 6.D. The rate of change of function A is 4.The rate of change of function B is 3 GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were How many grams are in a sample of 0.55 mol of K?