Insert a rational number between 1/2 and 1/3 by mean method?​

Answers

Answer 1

Answer:

[tex]\frac{5}{12}[/tex]

Step-by-step explanation:

To find a rational number by the mean method.

Add the 2 fractions and divide the result by 2

[tex]\frac{1}{2}[/tex] + [tex]\frac{1}{3}[/tex]

To add the fractions we require them to have a common denominator.

The LCM of 2 and 3 is 6 ← required common denominator

Multiply numerator/denominator of first fraction by 3

Multiply numerator/denominator of second fraction by 2

= [tex]\frac{1(3)}{2(3)}[/tex] + [tex]\frac{1(2)}{3(2)}[/tex]

= [tex]\frac{3}{6}[/tex] + [tex]\frac{2}{6}[/tex] ( add numerators, leaving denominator )

= [tex]\frac{5}{6}[/tex]

Now divide by 2

[tex]\frac{5}{6}[/tex] ÷ 2 leave first, change division to multiplication, turn second upside down )

= [tex]\frac{5}{6}[/tex] × [tex]\frac{1}{2}[/tex]

= [tex]\frac{5}{12}[/tex]

This is the fraction midway between the 2 given fractions


Related Questions

Martha compra 2 kilos de tomate y 1 kilo de cebolla pagando S/ 8,40. Si la siguiente semana compra 1 kilo de tomate y 2 kilos de cebolla pagando S/ 7,80, ¿a cuánto está el kilo de cebolla?

Answers

Responder:

2,40

Explicación paso a paso:

Dado que:

Dejar :

Tomate = t

Cebolla = n

(2 kilo de t) + (1 kilo de n) = 8.40

(1 kilo de t) + (2 kilo de n) = 7.80

2t + n = 8,40 - - (1)

t + 2n = 7,80 - - (2)

De (2);

t = 7,80 - 2n

Ponga t = 7.80 - 2n en (1)

2 (7,80 - 2n) + n = 8,40

15,6 - 4n + n = 8,40

15,6 - 3n = 8,40

-3n = 8,40 - 15,6

-3n = - 7,2

n = 2,4

t = 7,80 - 2 (2,40)

t = 7,80 - 4,80

t = 3

Por lo tanto, el costo de 1 kilo de cebolla es 2,40

Kate stands 2 meters from a lamppost. She is 2.1 meters tall and casts a shadow 3 meters long in the light from the lamp. How tall is the lamppost? See diagram below.​

Answers

Answer:

3.5 meters.

Step-by-step explanation:

Please refer to the attachment.

Since the two triangles share two congruent angles, by AA Similarity, the two triangles are similar.

Therefore, we can write the following proportion:

[tex]\frac{3}{5}=\frac{2.1}{x}[/tex]

To find the height of the lamppost x, we will simply have to solve for x.

So, let’s cross-multiply:

[tex]10.5=3x[/tex]

Divide both sides by 3:

[tex]x=10.5/3=3.5[/tex]

Hence, the height of the lamppost is 3.5 meters.

pls help−4(3/2x−1/2)=−15

Answers

Answer:

17/6

Step-by-step explanation:

what you do first is open up the brackets..

so

-4 x 3/2x and -4 x -1/2

you then multiply these

-12/2x and 4/2

-6x and 2

(-6x+2) = -15

solve for x

-6x=-15 -2

-6x=-17

x=17/6

crossing out the negatives !

8. Could an angle be complementary to itself? If, so what would it’s measure be?

9. Could an angle be supplementary to itself? If so, what would its measure be?

Answers

Answer:

8) angle that is complement of itself is 45°

9) When an angle is its own supplement, that means that the angle, plus itself, will equal 180 degrees.

Step-by-step explanation:

At a winter concert, the ratio of the number of boys to the number of girls is 3:8. if there are 250 more girls than boys, how many
boys are at the concert?​

Answers

Answer:

150

Step-by-step explanation:

if 3:8 , that means the difference is 5. the difference is 250, so 250/5 =50.

then u multiply 3 by 50 and get 150. ur welcome man

2 1/2 + 3 5/8

Add the fractions

Answers

Answer:

This equals 6 1/8

Step-by-step explanation:

Hope it helps!

Answer:

6 1/8

2 1/2 becomes 5/2 then you multiply the numerator and denominator by 4

after that it becomes 20/8 than you make 3 5/8 into 29/8 and add them together which makes 49/8 but when you simplify it becomes 6 1/8

John is twice as old as Mary. The sum of their ages is 21. How old is Mary?
Let J = John's age and M = Mary's age. Select the system equations that represents the problem.
J - 2M = 0
J = M + 2
M - 2J = 0
J + M = 21

Answers

Answer:

Mary is 7

Step-by-step explanation:

If their ages combined equals 21 and john is twice Mary’s age then johns age takes up 2/3 of 21. that would b 14. 14 is 2 x 7. and Mary is 7. 14+7=21. Mary is 7 years old

Correct answers are:

J + M = 21

J - 2M = 0

hi pls help :))))))))

Answers

Answer:

The last one

Step-by-step explanation:

It’s d my dude and have a good day

20 POINTS!
(Also explain the reasoning you used to find the expression)
ILL MARK BRAINLIEST

Answers

9514 1404 393

Answer:

  8x +96 yd

Step-by-step explanation:

The perimeter is the sum of the side lengths. In this case, it will be twice the sum of the overall length and the overall height.

The overall length is the sum of the two horizontal segments at top:

  (x -2) +(3x) = 4x -2

The overall height is the sum of the right-side vertical segments:

  10 + 40 = 50

Then the perimeter is ...

  P = 2(L+W) = 2((4x -2) +50) = 2(4x +48) = 8x +96

The perimeter is 8x +96 yards.

4(c + 3) = t
solve for c

Answers

Answer:

c=1/4t-3

Step-by-step explanation:

2³ =
what does it equal?

Answers

Answer:

8

Step-by-step explanation:

2 x 2 = 4

4 x 2 = 8

Answer:

8

Step-by-step explanation:

2^3 is the same as 2x2x2 (x is times)

This is really confusing i need help if you get this right i will give you brainliest

Answers

Okie B or D

Maybe C

OK ok ok ok ok ignore that it's probably B? orC

okie nevermind there's lots of bullies and no one even know's I'm autistic people, okie baiiiii

Answer: I don't think the answer is B. -3/5+(-2/8)-4=-5 because B. -3/5+(-2/8)-4 A. (-40)+(-30)+28=-42, C. 130+70+(-37)=163, D. 40+(-58)+160=142. I think A. (-40)+(-30)+28=-42

Parker is in the business of manufacturing phones. He must pay a daily fixed cost to rent the building and equipment, and also pays a cost per phone produced for materials and labor. The equation C=175p+400 can be used to determine the total cost, in dollars, of producing pp phones in a given day. What is the y-intercept of the equation and what is its interpretation in the context of the problem?

Answers

9514 1404 393

Answer:

  400; building and equipment fixed cost

Step-by-step explanation:

The cost equation has two terms. The constant term (400) is the daily fixed cost of building and equipment. The variable term (175p) represents the cost of producing p phones.

The y-intercept is 400. It is the daily fixed cost of the building and equipment.

Answer:

The y-intercept of the function is 400 which represents the fixed cost for rent and equipment.

Step-by-step explanation:

Since Parker must pay $400 even to make 0 phones, that means $400 is the fixed cost that Parker must pay for rent and equipment regardless of the number of phones produced.

Have a good day :)

CAN SOMEONE GIVE ME THE STEPS I HAVE THE ANSWERS I JUST NEED THE STEPS

Answers

Problem 1:

1) 3/5x-1 x 3/4=9/10

3x/5-1 x 3/4=9/10

2) 3x/5-1 x 3/4=9/10

3x/5-3/4=9/10

3) 3x/5-3/4=9/10

+3/4 +3/4

4) 3x/5=33/20

5) 5 x 3x/5= 5 x (33/20)

6) 3x=33/4

7) 3x=33/4

/3 /3

8) x=11/4

Problem 2:

1) 6/7+2/5x=-4/5

6/7+2x/5=-4/5

2) 6/7+2x/5=-4/5

-6/7 -6/7

3) 2x/5= --58/35

4) 5 x 2x/5= 5 x (--58/35)

5) 2x= --58/7

6) 2x= --58/7

/2 /2

x= --29/7

(picture)
for each number on the left,place a check mark under the numbers it is divisible by.​

Answers

45- 3, 5, 9

369- 3, 9

7870- 2, 5, 10

1976- 2, 4,

6003- 3, 9

136- 2, 3, 4

1674- 2, 3, 6, 9

35496- 2, 3, 4, 6, 9

Marissa substracted a negative number from a positive number. Her result was negative. Is that reasonable? Explain.

Answers

Answer: It is not reasonable.

Step-by-step explanation: when subtracting a negative number from a positive number the answer is always going to be positive because two negatives make a plus. For example 3-(-5). The two negatives cancel each other out, so it’s 3+5=8

Trisha uses 3 cups of sugar for every 4 cups of flour to make a batch of cookies. Which equation could be used to solve x, the number of cups of flour needed for 9 cups of sugar.

Answers

Answer: The number of cups of flour needed for 9 cups of sugar = 12.

Step-by-step explanation:

Equation of direct proportion between two quantities x and y :

[tex]\dfrac{x_1}{y_1}=\dfrac{x_2}{y_2}[/tex]

Let x=  the number of cups of flour needed for 9 cups of sugar.

Put [tex]x_1=4,\ y_1=3,\ y_2=9, x_2=x[/tex]

[tex]\dfrac{4}{3}=\dfrac{x}{9}\\\\\Rightarrow\ x=\dfrac{9\times4}{3}\\\\\Rightarrow\ x=12[/tex]

Hence, the number of cups of flour needed for 9 cups of sugar = 12.

Anna is testing different weights of certain things. The bucket she is holding that is full of water weighs 5lbs. Anna weighs herself and she is 97 pounds. She then drinks all of the water out of the bucket and then weighs herself again. Now she weighs 104 pounds. If the bucket of water she held was only 5 pounds, how did Anna gain 7 pounds from drinking the water out of it?


__________________________________________________

Answers

Answer:

Anna drank the water and holding the bucket, which weights 2 pounds, so:

97 + 5 + 2 = 104 pounds

Answer:

104 lbs.

Step-by-step explanation:

Anna's self  weight     = 97

Anna drank the water = 5

bucket weights            = 2      

                        total     = 104 lbs.

what is the y-intercept of this table? i dont understand it please help thank you.

Answers

Answer:

-0.4

Step-by-step explanation:

you just take 2 of them to find it

04.01 mc y-2x=-1 and 2y-x=4 choose the correct graph of the given systems of equations

Answers

Answer:

1st one  m=0

y= 0.49875311x  / cm

No horizonal asymptotes

x= 1/2 + 2.005 mcy

2nd one is

slope 1/2

y intercept (0,2)

x      y

-4     0

0       2

Step-by-step explanation:

for 2

starting point ay y 2 make a point

then rise over run

go up 1 and to the right 2 and point , then up 1 and to the right 2 and point

there is your graph

CAN SOMEONE HELP THIS IS DUE

Hicham El Guerrouj of Morocco set a world record by running 1 mile in 3 minutes, 43.13 seconds on July 7, 1999. What was his time in miles per hour?

Answers

Answer:

His time in mph is 16.1 mph

I need help because I was debating if it’s is 5 or 6

Answers

Answer:

it should be 5.5

Step-by-step explanation:

cross multiply and solve as an equation

PLEASE HEEEEELLLPPPPP ILL GIIVE YOU BRAINLIEST

Answers

Answer:

your answer will be c

and distributive property for the second one

Step-by-step explanation:

the answer should be D for both, correct me if i'm wrong

Which scenario below represents 85%?

Answers

Show us the scenario

how do you find the value of √a⁴ ??
(ill give brainliest)

Answers

Answer:

[tex]a^{2}[/tex]

Step-by-step explanation:

√a^4 is the same as:

√a × √a × √a × √a

group them as 2 pairs of

(√a × √a) × (√a × √a)

which makes

a × a

which is the same as [tex]a^{2}[/tex]

round 8.923 to the nearest half

Answers

Answer:

The answer is 8.9

PLEASE MARK BRAINLIEST

Answer:

8.9

Step-by-step explanation:

PLSSSSSSS HELP PLSSSSSSSSSS HELPP

Answers

Answer:

I will solve each one and work from there:

A. 4(5-y) ≥80

     20-2y≥80

      -2y≥60

        y≥-30

B. 2(y-3) ≥ 8

    2y-6≥8

     2y≥14

     y≥7

c. 3y-4>1

   3y>5

     y>5/3

d.  -3/4 / 6y>1/4

      -3/4>1/4 x 6y

     

Notice how for each inequality it is y≥ or > abc

Although for d it is a number greater than 1/4 x 6y

Based off that i would assume that D is correct

Step-by-step explanation:

I need some help and fast
Solve this plz

Answers

Answer:

It could be or 70 or 78

Step-by-step explanation:

Answer:

there the same they are both 84

Step-by-step explanation:

In a full set of permanent teeth, 1/4 of the teeth are incisors, 1/4 are premolars, and 3/8 are molars. What fraction of all the teeth are incisors, premolars, and molars

Answers

Answer:

7/8

Step-by-step explanation:

In a full set of permanent teeth, 1/4 of the teeth are incisors, 1/4 are premolars, and 3/8 are molars. What fraction of all the teeth are incisors, premolars, and molars?

To solve the above, we add all the fractions together.

= Incisors + Premolars + Molars

= 3/8 + 1/4 + 1/4

Least Common Denominator = 8

= (3 × 1 + 2× 1 + 2 × 1)/8

= 3 + 2 + 2/8

= 7/8

Hence, the fraction of all the teeth are incisors, premolars, and molars is 7/8

Two bags of bird seed are used to fill these three bird feeders. How much bird seed does each feeder use? Represent the situation using the model. Then solve

Answers

Step-by-step explanation:

If two bags of bird seed are used to fill these three bird feeders, then we can say that;

2 bags of bird seed = 3 bird feeders

To know the amount of bird seed that each feeder use, we will say;

x bags of bird seed = 1 bird feeder

Equating both postulates and solving

2 bags of bird seed = 3 bird feeders

x bags of bird seed = 1 bird feeder

Cross multiply

3 * x = 2 * 1

3x = 2

subtract 2 from both sides

3x - 2 = 2-2

3x - 2 = 0

Hence model that represents the situation us 3x - 2 = 0 where x is the number of bird seed that each feeder use.

Next is to solve for x;

3x - 2 = 0

3x = 2

x = 2/3

Hence each feeder used 2/3 bird seed

Other Questions
Me gusta tocar ___________. can someone help meWhat is the missing numerator?blank over seven plus thirteen over fourteen equals one and three fourteenths (20 points) a11 b8 c5 d2 PLEASE HELP Ill give brainliest!!! What is the main idea in the woman in the snow? Someone pls help zoe has earned 650$ during the four weeks she worked at the rec center. the first 2 weeks she earned 220$ and 98$. the last 2 weeks she earned the same amount. how much money did zoe earn in the last 2 weeks What is the slope, m, and y-intercept for the line that is plotted on the grid? Triangles have a total of 180. Use the triangle below to determine the value of X. What are five ways companies target teens and vaping? What is the slope of the line that passes through the points (-8, 6) and (-5, -3) Find the product of 3 1/5 and 5/8. Express your answer in simplest form Which statement from The Number Devil best reveals that the author is using the number devil's character to promote a positive view of mathematics? "Most genuine mathematicians are bad at sums. Besides, they have no time to waste on them. That's what pocket plz help me plzzzzzzzzzzzzz Mother has purchased 75 yards of green fabric and 125 yards of white fabric to make green and white curtains. What is the largest number of curtains she can make if she wants all the curtains to be exactly the same length, and to have no fabric left over? How many yards of each kind of fabric would be used for each curtain? I believe it is AAS but am not sure whether ASA could be true as well What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA Which is a central idea of the text? Describe your closet figuratively The equation f equals 9/5 C + 32 relates temperature measured in degrees celsius C to degrees Fahrenheit f Determine whether there is a proportional relationship between C and F explain your reason According to the following reaction, how many grams of sulfur are formed when 37.4 g of water are formed? 2HS(g) + SO(g) 3S(s) + 2HO(l) Explain reasons for 13 colonies