Knowing that birds are endothermic and crocodiles are ectothermic, can you use phylogenetic bracketing to predict whether dinosaurs other than birds are ectothermic or endothermic Match the words in the left column to the appropriate blanks in the sentences on the right. Terms can be used once, more than once, or not at all
- can - endothermic - birds - crocodiles
- ectothermic - cannot
We ___ use phylogenetic bracketing to predict whether dinosaurs other than birds were ____. We only ____ conclude that the dinosaur that gave rise to ____ was ____ as are all living ____.

Answers

Answer 1

Phylogenetic bracketing cannot be used to predict whether dinosaurs other than birds were endothermic or ectothermic.

The only conclusion that can be drawn is that the dinosaur that gave rise to birds was endothermic, based on the fact that birds are endothermic.

Phylogenetic bracketing involves making inferences about the characteristics of extinct organisms based on the characteristics of their living relatives. In this case, we know that birds are endothermic (warm-blooded) and crocodiles are ectothermic (cold-blooded). However, the presence of endothermy in birds does not necessarily imply that all dinosaurs, including non-avian dinosaurs, were endothermic.

Phylogenetic bracketing can only be used to infer characteristics in extinct organisms if those characteristics are found in all living descendants of a common ancestor. Since birds are the only living descendants of dinosaurs, we can only conclude that the dinosaur that gave rise to birds was endothermic. The characteristics of non-avian dinosaurs, whether they were endothermic or ectothermic, cannot be determined through phylogenetic bracketing alone.

learn more about birds click here;

brainly.com/question/32506389

#SPJ11


Related Questions

Which of the following would be considered adaptations for a predator? Select ALL that apply.
A. Thorns on a plant
B. Sharp Claws
C. Aposematism (Warning Coloration)
D. Strong sense of smell
E. Ability to run quickly

Answers

The adaptations of a predator from the given options would be sharp claws, aposematism (warning coloration), a strong sense of smell, and the ability to run quickly. Here options B, C, D, and E are the correct answer.

B. Sharp Claws: Sharp claws enable a predator to grasp and immobilize prey, providing an advantage in capturing and subduing prey efficiently.

C. Aposematism (Warning Coloration): Aposematism refers to the display of vibrant, contrasting colors or patterns that warn potential prey of the predator's toxicity or dangerous nature. This adaptation deters potential prey from approaching or attacking the predator, allowing it to avoid unnecessary conflict and conserve energy.

D. Strong sense of smell: A predator with a keen sense of smell can detect the scent trails left by prey, increasing its ability to locate and track potential targets. This adaptation provides an advantage in locating prey and improving hunting success.

E. Ability to run quickly: The ability to run swiftly is advantageous for predators as it enables them to chase down prey, close the distance, and launch an attack. This adaptation improves their chances of capturing fleeing prey.

To learn more about predators

https://brainly.com/question/28871161

#SPJ4

How many chambers does a dog's heart
have?

Answers

Answer:

There are four chambers in the dog's heart: two top chambers (the atria) and two bottom chambers (the ventricles).

Explanation:

Answer:

It has 4 chambers

Explanation:

sorry if im wrong

The article named Apes' Simple Nests Are Feats of Engineering. Where the author talks about how apes make their nest and how they use it. Apes make their nest in which they sleep during the night. Roland Ennos of the University of Manchester says that their nests look man -made and it was thought that apes do know how to use wood to make their nests.They also talk about the length and width of the nest. It takes 10 min for an ape to make their nest. From a new study they observe that some apes have a nest similar to bent nests attached between trees and some have oval-shaped nests on the tree branches where they sleep . On the other hand chimps also make similar nests like aps but according to an article it states that chimps sometimes sleep on the ground while aps doesn’t. Chimpanzee nests give a new way to research more on how they make their nest on ground by using some wood, plants and grass to make it comfy rather than on trees that maybe there were less quantities of trees or maybe they have different behavior than others.

Answers

The Apes' Simple Nests Are Feats of Engineering article is about how apes build their nests and how they use them. Chimps, like apes, build comparable nests, but they also occasionally sleep on the ground, whereas apes do not.

According to the article, it was believed that apes were unable to make nests using wood; however, Roland Ennos of the University of Manchester stated that the nests look man-made. The article also mentions the size of the nest, which is usually large enough for the apes to sleep in at night. It takes only ten minutes for an ape to create its nest. In a recent study, researchers observed that some apes construct nests that resemble bent nests linked between trees, while others construct oval-shaped nests on tree branches where they sleep.
Chimps, like apes, build comparable nests, but they also occasionally sleep on the ground, whereas apes do not. Chimps' nests provide a new avenue for exploring how they build nests on the ground using wood, plants, and grass to make them more comfortable, which may be due to a lack of trees or different behavior.

To know more about Engineering article visit:

https://brainly.com/question/31525727

#SPJ11

what factor may contribute to the higher food insecurity on the african continent,in the middle east,and in asia?

Answers

Answer:

The most common causes of food insecurity in Africa,middle east and asia: population growth, drought, extreme weather events and other agricultural problems.

Explanation:

Can someone plz help me out. I don’t really understand this.

Answers

7. b and 8. c i attached the photo for u to see how i did it

How does erosion and deposition shape the landscape?

Answers

Answer:

The material moved by erosion is sediment. Deposition occurs when the agents (wind or water) of erosion lay down sediment. Deposition changes the shape of the land. Water's movements (both on land and underground) cause weathering and erosion, which change the land's surface features and create underground formations.

Explanation:

have a good day/night

may i please have a branlliest

What is the function of stabilizing proteins?​

Answers

Answer:

Stabilization of a protein translates into preservation of the protein structure during storage, in thermodynamic equilibrium with its surrounding

Explanation:

mark me brainlest

Describe why food needs to be digested from large to small molecules.

Answers

Answer:

Food must be broken down into nutrients for the body to use for energy, development, and cell repair. Before the blood absorbs and transports nutrients to cells in the body, food and drink must be broken down into smaller nutrient molecules.

Some scientists claim recent evidence suggests birds should be reclassified to share more taxonomic groups with dinosaurs. What type of evidence would provide the best support for this claim?
A.evidence showing birds shared similar habitats with dinosaurs
B.evidence showing birds shared similar nutritional requirements as dinosaurs
C.evidence showing birds shared similar behaviors with dinosaurs
D. evidence showing birds shared a common genetic history with dinosaurs

Answers

Answer: D.

Explanation: I don’t really know how to explain it, I just know it’s right

Some scientists claim recent evidence suggests birds should be reclassified to share more taxonomic groups with dinosaurs. The liable options seems evidence showing birds shared a common genetic history with dinosaurs. The correct answer is option D.

What is the class of birds ?

It is the class aves that belong to the kingdom Animalia.

The birds and the dinosaurs have the same genetic history that is the phylogenetic relationship of both the species is almost same and they both show a similar set of characteristics.

They had multiple set of characteristics that were similar to both and they shared the common characteristics. The points are written as following :

1.Egg Laying

2.Scales

3.Feathers

4.Beaks

5.Diets

6.Reptilian Relations

7.Three-Toed Limbs

8.Claws.

These were the common characters that were present in both the categories.

Learn more about birds at :

https://brainly.com/question/25120645

#SPJ2

Which kingdom contains the first eukaryotes?

Answers

Fungi hope this helps

This plant is used to treat liver ailments during the medieval times
Liverworts
Hornworts
Mosses
Ferns

Answers

Answer:

liverworts

Explanation:

Answer:

liverworts

Explanation:

that's were it got its name because of it healing properties

Describe: How does a virus destroy the host cell’s DNA?

Answers

Answer:

it eats away at the host from the inside

Explanation:

Graded for correctness: In humans, the ability to digest lactose beyond childhood is determined by a single gene on chromosome 1. L denotes the allele that gives the ability to digest lactose and l denotes the inability to digest lactose. On chromosome 3 is the gene for widows peak. A denotes the allele for no widows peak and a denotes a widows peak. A woman volunteers to be a participant in a genetic research study. Her genotype is LlAa. A doctor harvests a single egg from her body. The genotype of her egg is LA. How did her chromosomes line up at the metaphase plate during meiosis

Answers

Answer:

Metaphase I:    

Homologous chromosomes are placed in the equatorial planeChromosomes carrying the dominant alleles, L and A, face one of the polesThe homologous chromosomes, carrying the recessive alleles, l and a, face the opposite pole.

Metaphase II:  

Chromosomes carrying the dominant alleles, L and A, are placed in the equatorial planeOne of the chromatid sisters of each chromosome faces one of the polesThe other chromatid sisters of each chromosome face the opposite pole.

You will find the image in the attached files.

Explanation:

During metaphase I, homologous pairs migrate to the equatorial plane. They randomly aline with their kinetochores facing opposite poles. The random arrangement of tetrads is different in every cell going through the meiosis process. There is no equal alinement between two cells. When tetrads aline in the equatorial plane, there is no predetermined order for each of the homologous chromosomes of each tetrad to face one of the poles and then migrate to it while separating. Each of the chromosomes has two possibilities for orientation at the plane. When the new haploid cells are formed, the number of variations in each cell is also different and depends on the chromosomes that form that cell. This random order in the equatorial plane is what introduces variation into the gametes. It is almost impossible that two gametes resulting from meiosis will get the same genetic charge.

During metaphase II, fibers of the spindle apparatus take chromosomes toward the equatorial cell plane, where they line up. Sister chromatids are holden together until they reach the Anaphase, during which specialized enzymes break the bonds between chromatids and separate them. Each chromatid migrates to one of the poles. In telophase, the new chromosomes are already in the corresponding poles, and the nuclear membrane forms again. Finally, cytokinesis occurs.

In this example, we will assume no crossing-over in the prophase. I will propose the two metaphase stages.

Metaphase I:                                   Pole 1

        Chromosome 1   ---------L----                -----------A---------    Chromosome 3

                                    ----------L----               -----------A---------

Equatorial plane.....................................................................................................  

        Chromosome 1   ---------l----                  -----------a---------    Chromosome 3

                                     ---------l----                  -----------a---------                      

                                                           Pole 2

In this scheme of Metaphase I, homologous chromosomes are already aligned in the equatorial plane. Each homologous chromosome is facing a pole. So, in the superior part of the scheme, we have chromosomes 1 and 2 carrying the dominant alleles L and A. Both chromosomes are facing pole 1. Then, we can recognize the equatorial plane, and on the other side, we find the homologous chromosomes 1 and 2, facing pole 2, and carrying the recessive alleles, l and a.

During anaphase I, homologous chromosomes will separate and migrate to different poles. In this example, we are interested in chromosomes carrying the dominant alleles that migrate to pole 1. LL and AA.

Metaphase II:                                 Pole 1

        Chromatid 1   ---------L----                    -----------A--------  Chromatid 3

Equatorial plane.....................................................................................................  

        Chromatid 1   ----------L----                   -----------A---------  Chromatid 3

                                                         Pole 2

During metaphase II, each chromatid sister carrying the dominant alleles faces a different pole. During anaphase II they separate and migrate again.

The total result of meiosis in this particular cell is the formation of 4 haploid cells -gametes-: LA, LA, la, la

In the photo of the house; What is happening to the foundation of
the house?

Answers

Answer:

errosion is causing it to crumble and become unstable

What percent of energy is transferred between the levels indicated by the blue arrows?

A. 50

B. 90

C. 100

D. 10

Answers

The answer to the given question is that more than 100 percent of energy is transferred between the levels indicated by the blue arrows.

This is because the blue arrows show the flow of energy between trophic levels in an ecosystem and there is always a loss of energy in each transfer due to metabolic processes like respiration and incomplete digestion.The transfer of energy between trophic levels of an ecosystem is known as the energy pyramid. In general, only 10% of the energy at one level is available to the next level. For example, if the primary producers contain 10,000 units of energy, then only 1,000 units of energy will be transferred to the primary consumers.

However, some energy can be lost due to factors such as heat loss from the body of organisms, incomplete digestion, and inefficiencies in energy transfer mechanisms. Therefore, it is possible for more than 100% of energy to be transferred between the levels indicated by the blue arrows. Therefore, the correct answer is not given in the option, it is more than 100 percent.

To know more about percent visit:

https://brainly.com/question/14809038

#SPJ11

Which claim about reproduction in dogs can best be supported using a valid argument?
A. Offspring produced by sexual reproduction are genetically identical.
B. Gametes from both dogs are needed to maintain the correct number of chromosomes in the offspring
C. Phenotypic variation will occur in the offspring as a result of mitosis in the gametes.
D. Binary fission is required for sexual and asexual reproduction in dogs.

Answers

Answer:

b

Explanation:

Match the following world's countries with the plate boundary they are located Ethiopia, Kenya, Tanzania region Continent-Continent Div [选择] Ocean-Ocean Convegent Japan ✓ Ocean-Continent Convergent Continent-Continent Transform Ocean-Ocean Divergent Continent-Continent Divergent Iceland Continent-Continent Convergent Ecuador/Western South America Continent-Continent Co USA/Southern California Ocean-Continent Conve v Nepal/Tibet/China region Continent-Continent Co

Answers

Here is the matching of the countries with the corresponding plate boundary:

Ethiopia, Kenya, Tanzania region: Continent-Continent Divergent

Japan: Ocean-Ocean Convergent

Iceland: Continent-Continent Divergent

Ecuador/Western South America: Continent-Continent Convergent

USA/Southern California: Ocean-Continent Convergent

Nepal/Tibet/China region: Continent-Continent Convergent

Let's explain the reasoning behind each match:

Ethiopia, Kenya, Tanzania region:

This region is located along the East African Rift System, which is a classic example of a continent-continent divergent boundary.

It is where the African Plate and the Somali Plate are moving away from each other, causing the formation of a rift valley.

Japan: Japan is situated along the Pacific Ring of Fire, which is characterized by subduction zones where oceanic plates converge with continental plates.

Therefore, Japan is located at an ocean-ocean convergent boundary.

Iceland: Iceland is located on the Mid-Atlantic Ridge, which is a divergent boundary between the Eurasian Plate and the North American Plate.

As the plates move apart, magma rises to the surface, creating new crust and causing volcanic activity.

Thus, Iceland is at a continent-continent divergent boundary.

Ecuador/Western South America:

This region lies along the boundary between the Nazca Plate and the South American Plate.

The Nazca Plate is subducting beneath the South American Plate, resulting in the formation of the Andes Mountains.

Hence, Ecuador and Western South America are located at a continent-continent convergent boundary.

USA/Southern California: Southern California is located along the boundary between the Pacific Plate and the North American Plate.

The Pacific Plate is moving northwestward relative to the North American Plate, resulting in a transform boundary.

Therefore, the plate boundary in this region is a continent-continent transform boundary.

Nepal/Tibet/China region:

This region is part of the Himalayan mountain range, formed by the collision of the Indian Plate with the Eurasian Plate.

It is a classic example of a continent-continent convergent boundary.

It's important to note that plate boundaries can be complex and may have variations within a particular region.

The matches provided here represent simplified classifications for each country's general plate boundary.

For similar question on Eurasian Plate.

https://brainly.com/question/16939139

#SPJ8

what does it mean to be purebread ?

Answers

Answer:

If you meant purebred, it means that the species had not been bred with any other species than it`s own.

Ex: a purebred dog bred with another purebred dog produced a purebred offspring

a purebred dog bred with either another species of dog, or a crossbred dog will produce a crossbred offspring

Explanation:

A simple guideline to follow for deloading is to train at less than intensity and less than volume of what is used during a standard training session. A. 40%, 40% B. 50%, 50% C. 70%, 70% D. 80%, 80%

Answers

The guideline recommends using 50% of the intensity and 50% of the volume of what is typically used during a standard training session. Therefore, option B is correct.

When deloading, it is recommended to train at a lower intensity and lower volume compared to a standard training session. The recommendation is to employ 50% of the volume and 50% of the intensity that is generally used during a typical training session.

This technique enables to provide a period of reduced stress on the body. It allows for recovery and adaptation to occur.

Learn more about intensity, here:

https://brainly.com/question/17583145

#SPJ4

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC

ECOTOXICOLOGY
6. Discuss the differences between dysfunction and destruction of target molecules as commonly used in ecotoxicology 7. Suggest detailed reasons why dysregulation can lead adverse effects

Answers

Ecotoxicology is a branch of environmental toxicology that investigates the effect of toxicants on organisms in the ecosystem. The differences between dysfunction and destruction of target molecules as commonly used in ecotoxicology.

6. The differences between dysfunction and destruction of target molecules as commonly used in ecotoxicology.

Dysfunction in ecotoxicology is a type of effect that results from the change in the normal physiological activity of a cell, tissue, or organ. It occurs when the toxicant alters the normal functioning of the target molecule. For example, when a pesticide such as DDT is ingested by an organism, it binds to the sodium ion channels in the nervous system, resulting in the impairment of the nervous system.The destruction of target molecules, on the other hand, is a type of effect that results from the direct alteration of a molecule's structure. It occurs when the toxicant physically alters the chemical structure of the molecule. For example, lead adversely affects organisms by binding to proteins and altering their structure.

7. Reasons why dysregulation can lead to adverse effects

Dysregulation can lead to adverse effects in several ways, including: It affects the normal functioning of the organism and can lead to death.It can result in the accumulation of toxic substances, causing long-term damage to the organism's health.It can lead to the overproduction of certain substances that cause harm to the organism.It can disrupt normal physiological processes, leading to disease and other health problems. Therefore, dysregulation has the potential to lead to serious adverse effects on an organism's health. In conclusion, the understanding of the difference between the destruction and dysfunction of target molecules in ecotoxicology and the knowledge of how dysregulation can lead to adverse effects are crucial for understanding the impact of toxic substances on organisms.

To know more about ecotoxicology visit:

https://brainly.com/question/32533210

#SPJ11

I need help not sure

Answers

Answer:

The answer is 2

Explanation:

D,H,J are closely related because they are sharing traits, and it is the most relevant answer

what is membrane potential of a cardiac intrinsic conduction system cell?

Answers

A gradient of electrochemical potential exists across cellular membranes, allowing cardiac cells to exclusively propagate action potentials. An average cardiac cell's resting membrane potential is 90 mV.

The Goldman-Hodgkin-Katz equation, which considers permeability (P) as well as the concentration of ions both within and outside of cells ([X]), can be used to characterise this resting potential. The network of intracardiac ganglia and connecting neurons makes up the intrinsic cardiac neural system (ICNS), sometimes known as the heart's own nervous system. As a local hub that combines the inputs from the ICNS and extrinsic innervation, the cardiac ganglia function as a contributor to the tight control of cardiac electrophysiology.

To know more about electrochemical, click here:

https://brainly.com/question/31606417

#SPJ4

HELP ME

Explain how physical variation is expressed in human beings and how it relates to cultural groups and ethnicity?!??

Answers

Be careful with those links there hackers

wykonaj tabele w której porównasz funkcje wszystkich rodzajów elementów morfotycznych krwi

Answers

Is this a question or just a prank?

Which kingdoms contain organisms that have cell walls?

Answers

The plantae,Protista, eubacteria kingdom. I think it’s just the 3.

The function of cell wall is to provide protection. The kingdoms which have cell walls are  fungi and plantae.

What is the function of cell wall ?

The cell wall provides the protection against the  mechanical stress and the pressure that a cell membrane can not handle.

Cell wall is majorly present for the purpose of protection to the species and these species tend to be delicate and tend to be in more danger.

Cell wall of fungi is made up of chitin and it is polysaccharide having the amino glycosidic linkages.

Cell wall of plants is made up of polysaccharides as well where the cellulose is present in chains.

Cellulose provides the tensile strength and this amino  glycosidic linkages tend to provide strong skeletal structures in order to provide protection to the specimen.

Therefore only plantae and fungi have the cell walls.

https://brainly.com/question/965751

#SPJ6

why is correct measurement important​

Answers

Explanation:

help in giving accurate information

in addition to providing structural support and mediating transport, membrane proteins are important for allowing bacteria to sense and respond to changes in their environment. for example, the toxr protein is found in the plasma membrane of vibrio cholerae cells. it responds to ph and temperatures characteristic of the human gut environment by choose one: a. serving as a channel for export of the cholera toxin. b. releasing antimicrobial agents to kill members of the normal microbiota. c. transmitting signals to communicate with other v. cholerae. d. binding to the promoters of genes involved in virulence. e. injecting effectors directly into the cells of the intestinal epithelium.

Answers

In addition to providing structural support and mediating transport, membrane proteins are important for allowing bacteria to sense and respond to changes in their environment. for example, the toxr protein is found in the plasma membrane of vibrio cholerae cells. it responds to ph and temperatures characteristic of the human gut environment by c. transmitting signals to communicate with other v. cholerae

Membrane proteins not only provide structural support and mediate transport but are also important for allowing bacteria to sense and respond to changes in their environment. The toxR protein is found in the plasma membrane of Vibrio cholerae cells. It responds to pH and temperatures characteristic of the human gut environment by transmitting signals to communicate with other V. cholerae. The ToxR protein is a transmembrane protein that is vital for the pathogenesis of Vibrio cholerae, the causative agent of cholera.

It functions as a transcription factor and regulates the expression of many virulence genes. ToxR, ToxS, and TcpP are three regulatory proteins that are essential for the transcription of virulence genes in Vibrio cholerae. They function as a complex to activate or repress transcription of genes that are important for the virulence of this bacterium. Therefore, option C, transmitting signals to communicate with other V. cholerae is the correct answer.

Learn more about transcription at

https://brainly.com/question/13673064

#SPJ11

the step of translation in which release factors bind to a stop codon is

Answers

The step of translation in which release factors bind to a stop codon is termination. During this step, the ribosome recognizes the stop codon and triggers the release of the newly synthesized polypeptide chain along with the dissociation of the mRNA and ribosome.

Translation is the process of converting genetic information stored in mRNA into a sequence of amino acids that make up a protein. It is divided into three stages: initiation, elongation, and termination. During termination, the ribosome recognizes the stop codon (UAA, UAG, or UGA) in the mRNA, and a protein called a release factor binds to the A site of the ribosome. This causes the polypeptide chain to be released from the ribosome and folded into its final shape. Finally, the mRNA and the ribosome dissociate from each other. The newly synthesized protein can then undergo further modifications before being transported to its final destination in the cell.

Know more about stop codon, here:

https://brainly.com/question/30104870

#SPJ11

Which of the following describes a mechanism by which microtubules are known to be statſilized? a) Shortening of the GTP cap. b) Increasing the proportion of alpha-tubulin subunits relative to beta-tubulin subunits. c) Binding of microtubule binding proteins, such as Tau. d) Conformational changes undertaken by beta-tubulin as it bhydrolyzes GTP.

Answers

Microtubule stabilisation is known to occur through the interaction of microtubule-binding proteins like Tau. Hence (c) is the correct opton.

Cell division, ciliogenesis, and intracellular trafficking are three crucial eukaryotic processes that are mediated by microtubules, which are cytoskeletal elements. They come together from -tubulin heterodimers and separate through a process known as dynamic instability that is triggered by GTP hydrolysis. They have a role in a number of cell motions, including as some types of cell motility, the intracellular movement of organelles, and the division of the chromosomes during mitosis, in addition to determining the shape of the cell. These findings imply that GTP functions in microtubule assembly by first giving tubulin a conformation that is conducive to polymerization, and then by hydrolyzing GTP bound to tubulin to irreversibly change the balance in favour of polymerization.

To know more about Microtubule, click here:

https://brainly.com/question/31670866

#SPJ4

Other Questions
A drug store chain provides an app to its customers to track their shopping habits. One statistic the apptracks is the amount of money the customer saves by purchasing sale items. The company's salesteam pulls data from the previous year for a random sample of 50 customers. They find that themean amount of money saved by these customers in the previous year is $154 with a standarddeviation of $26.(a) Construct a 99% confidence interval for the true mean amount of money saved by all customersin the previous year by purchasing sale items.(b) The sales team would like to repeat this study with the goal of obtaining a smaller margin oferror. Propose two changes that would decrease the margin of error. What are potentialdrawbacks if those changes are implemented? The following data is provided for Garcon Company and Pepper Company for the year ended December 31.Garcon CompanyPepper CompanyFinished goods inventory, beginning$ 12,000$ 16,450Work in process inventory, beginning14,50019,950Raw materials inventory, beginning7,2509,000Rental cost on factory equipment27,00022,750Direct labor19,00035,000Finished goods inventory, ending17,65013,300Work in process inventory, ending22,00016,000Raw materials inventory, ending5,3007,200Factory utilities9,00012,000General and administrative expenses21,00043,000Indirect labor9,45010,860RepairsFactory equipment4,7801,500Raw materials purchases33,00052,000Selling expenses50,00046,000Sales195,030290,010Cash20,00015,700Accounts receivable, net13,20019,4501. Prepare income statements for both Garcon Company and Pepper Company.2. Prepare the current assets section of the balance sheet for each company. A polynomial of the 5thdegree with a leading coefficient of 7 a and a constant term of 6 please help me ill give brainliest If you are the producer, what is your profit maximizing decision, given your isocost and isoquant?a. Will produce at the point where the slope of the isoquant is equal to the slope of the isocostb. Will produce at the point where the isoquant is equal to the isocostc. Will produce at the highest isoquant, with the least cost d. Will produce at the point where the total cost at the minimum You start at (8, 0). You move left 8 units. Where do you end? The Assistant General Manager (AGM) has full trust in his highly experienced, motivated, and disciplined subordinates. He believes that these characteristics act in place of the need for constant direction and hence make constant leadership unnecessary in this situation. Specify the leadership theory that the AGM is following in this case. [Explanation is not required) Use the editor to format your answer In January 2016, Lufthansa, a German airline, purchased twenty 737 jets from the American company, Boeing for a total cost of USD 500 million to be paid on the delivery of the jets in January 2017. The chairman of Lufthansa believed that the dollar had run out and would shortly run down. The following options are available to him. [10 Marks) CO 2 & 3 a. Be conservative. Cover the whole payable forward. b. Trust his instincts. Buy the dollar forward in January 2017. c. Buy USD now and hold them in a deposit for a year to settle the payable in January 2017 d. Based on the information given below, which option would have minimized Lufthansa's cashflows at the end of the year:- Spot rate EUR/USD : 1.0861 Fwd rate EUR/USD: 1.0901 Spot rate after a year : : 1.0870 1 year interest rate on dollars = 3.5% 1 year interest rate on Euro = 2.8%. If the Table Analyzer finds unrelated data in a table, what does it suggest a user do?O split the table into queriesO break the table into multiple tablesO move all the data to a new reportO move some data to a different database A bag of candy costs $3.75. If sales tax is 4% of the cost, HOW MUCH WOULD YOU BE CHARGED IN TAXES? Which of the Following Lines Is An Example of An Assertion Read the excerpt from act 4, scene 1, of The Tragedy of Julius Caesar. [ANTONY.] And now, Octavius, Listen great thingsBrutus and Cassius Are levying powers. We must straight make head. Therefore let our alliance be combined, Our best friends made, our means stretched, And let us presently go sit in council, How covert matters may be best disclosed, And open perils surest answerd. OCTAVIUS. Let us do so: for we are at the stake, And bayed about with many enemies; And some that smile have in their hearts, I fear, Millions of mischiefs. Which correctly reflects a conflict of character vs character? A) The weather has been filled with lightning and wind making travel difficult. B) Antony and Octavius must join forces to win in battle against the combined forces of Brutus and Cassius. C) Ocatvius is doubting his own abilities to be equal to Antony in his leadership. D) Cassius and Octavius have both worked to turn society against the cause of the other. Evaluate the function requested. Write your answer as a fracticBf5220A48Find tan A. 34:58What is the source of energy that drives photosynthesis?O sunlighthydrogen ionso electronsO oxygen"pe here to searchODesktop During a basketball game, jeremy scored triple the number of points as donovan. Kolby scored double the number of points as donovan. If the three boys scored 36 points, how many points did each boy score. Summarize the accomplishments of Lyndon B. Johnsons Great Society legislation. please help me :)))( There are 6 cartons of orange juice in each package shown above. Kelsi paid $10.50 for 6 cartons of orange juice. What is the unit price per carton of orange juice? A) $1.25 per carton B) $1.60 per carton $1.75 per carton D) $1.80 per carton Find the volume of a right circular cone that has a height of 9.7 ft and a base with aradius of 7.6 ft. Round your answer to the nearest tenth of a cubic foot. Generate a variable for the log of pricesEstimate the logistic regression for smoke on lpcigs when hi_ed=0. Then, calculate the predicted values for Y. The command to do this is "predict yhat_0." Repeat for when hi_ed=1, and also create a predicted value variable yhat_1.Compare the coefficients for the two models. In words, explain what the model is saying about the impact of lpcigs for the two different education groups.Coeff for hi_ed= 0 = .2527531Coeff for low_ed = 0 = .4337571The demand for cigarettes is more likely to change when the price level if cigarettes changes for highly educated people whereas for lower educated individuals are willing to pay for it. Cigarettes are an inferior good as well.Create a graph of the predicted values for the two versions. Use the following syntax: twoway (line yhat_0 lpcigs, sort) (line yhat_1 lpcigs, sort), legend(label(1 "low ed") label(2 "hi ed"))For a low education person, if the price of cigarettes doubles, the by approximately how much this change the odds of smoking? (Remember the interpretation of a log variable. A doubling is a change of 100%.)A 100% change in price will change odds of smoking for low educated person will change odds of smoking by log(.2527531) = -.5973Part 3)Run a logit regression (stata command logit) for smoke on all the independent variables: age, educ, pcigs, income. Report the coefficients and p-values. This Model 1. Remember, for logit, (rather than logistic), the coefficients have not been exponentiated.If the price of cigarettes increases by $1 (all else equal), then what will be the change in the odds of smoking?If the price of cigarettes increases by $5 (all else equal), then what will be the change in the odds of smoking? (Heres a hint: If you think this will be 5x as large as in part b, you are wrong. Close, but wrong.)Create an interaction variable of educ and income. Run another logit regression, adding this interaction to Model 1. Report the coefficients and p-values. This is Model 2.What differences strike you about Model 1 and Model 2? In particular, note how the significance levels of the variables of educ and income have changed now that the interaction is included. In a clearly articulated paragraph (or two) give a thoughtful answer as to what you think must be going on. (This is not easy. Take your time and think hard about it. Your answer should contain two parts. First, talk about what the coefficients of the Model 2 regression are implying. Second, try and come up with an intuitive/economic hypothesis for why we are observing these results.)In model 2, the interaction variable (educ_income) accounts for interaction b/w education and income, it is more clear how smoking rates are affected by income and education. Without interaction variable results influenced b/w the two variables, showing higher education level the higher the income.One would think that people who are more educated and have higher levels of income ewould smoke less, but this is not always true. People who have higher incomes generally are more stressed out, which could increase their probability of smoking. They could use smoking as a way to relax, because they have more disposable income.