maria pays 15.20 for 5.3 pounds of candy what is the price per pound of candy

Answers

Answer 1

Answer:

$2.90 per pound

Step-by-step explanation:

You must divide the total from the amount bought.

15.20/5.3 = 2.8679245283

Next, you round the number by the first 2 decimals.

2.86 = 2.90 - The answer

Check if you need to make sure the answer is correct


Related Questions

I
A 10 kg box is pulled across the floor at a constant speed. If the force of pull was 70 N at
a 30° angle:
a. What was the force of friction
b. What was the coefficient of friction

Answers

Answer:

Acceleration equals zero because of constant velocity

[tex]f - fr = ma \\ 70 \cos(30) - fr = 0 \\ 70 \cos(30) = fr \\ fr \: = 60.62[/tex]

coefficient

Fr = coefficient × r

60.62= ce ×100

0.60 = coefficient


At a bookstore, you buy a calendar for $5 and some books for $3 each. You spend a total of $26. How many
books do you buy? Use the following equation to find the number of books b bought; 3b+5=26

Answers

You buy 7 books

3b+5=26
*subtract 5 to the 26 side*
3b=21
Now divide 21 by 3
B=7
So there are 7 books bought. ^^

Graph the solution to this inequality 4x+5y<20

Answers

Answer:

Everything in red works

Step-by-step explanation:

I need helpppp, I need to turn this in before class is over

Answers

Answer:

.

Step-by-step explanation:

Answer:

she spends 50% of her budget on her car

Step-by-step explanation:

300 is half of 600. I hope this helps :)

I walk each day to school. By what percentage would I need to increase my usual average speed in order for the journey to take 20% less time than usual? C:

Answers

Answer:

25%

Step-by-step explanation:

Let v, t be the current average speed and the time taken to reach the school respectively.

As distance = speed x time, so,

distance, d=vt...(i)

Let V be the new average speed in order to to take 20% less time than t.

So, time taken with speed V = t-20% of t = t- 0.2t= 0.8t

As distance is constant, so

d= V(0.8t)= 0.8Vt

hBy using equation (i), we have

0.8Vt = vt

0.8 V = v

V= v/0.8=1.25v

Therefore, the percentage increase in the average speed = [tex]\frac{V-v}{v}\times 100[/tex]

[tex]=\frac{1.25v-v}{v}\times 100[/tex]

=25%

Hence, the percentage increase in the average speed is 25%.

Find the value of x using the pythagorean theorem.

Answers

Answer:

2√13

Step-by-step explanation:

make it braintliest please

Step-by-step explanation:

[tex]\huge\bold\purple{ 7.21 }[/tex]

Find the mean median range and mode for 3, 3, 4, 8, 9, 10, and 12

Answers

Answer:

Mean: 7

Median: 8

Range: 9

Mode: 3

Step-by-step explanation:

First, to find the mean of a set of numbers you need to add up all of the numbers and divide that by the total amount of numbers. In this case that makes this equation, [tex]\frac{3+3+4+8+9+10+12}{7}[/tex], which is [tex]\frac{49}{7}[/tex], which is 7.

To find a median you need to find the middle number. A handy trick I use for this is to place my fingers on the first and last number, and then move them towards the middle, at the same time by one number until there is just one number left in the middle. If there are no numbers left after doing this, meaning there are an even amount of numbers given, the median is the mean of the last two numbers that were covered. In this case, this is not necessary, so the median is 8.

The range is the difference between the maximum and minimum of a data set. In this case that would give you the equation Range=12-3, which means the range is 9.

Finally, the mode is the number that occurs the most in a given data set. In this case the number that occurs the most is 3, which occurs twice compared to every other number which only occurs once.

Hey there!

‘‘Find the mean median range and mode for 3, 3, 4, 8, 9, 10, and 12’’

• Mean is known as your AVERAGE number. You have to ADD all of your NUMBERS the DIVIDE it by the TOTAL numbers in your given set

• We have the total of SEVEN numbers in your set

“3 + 3 + 4 + 8 + 9 + 10 + 12 / 7”

6 + 4 + 8 + 9 + 10 + 12/7

10 + 8 + 9 + 10 + 12/7

18 + 9 + 10 + 12/7

27 + 10 + 12/

37 + 12/7

49/7 = 7

Answer: Mean = 7 ✔️

• Median is the number you see in the center (the middle) of the problem. You can solve for this by putting your numbers from least to greatest

• If you have an ODD number in your given set then your middle number will be the single number)

• If you have an EVEN number then you have to average your TWO middle number

“ 3, 3, 4, 8, 9, 10, 12”

• you still have 3 on both sides of your 8 (3 is an ODD number, so we have to let it be be a single number)

Answer: mean = 8 ✔️

• Mode is your number than you see repeated OR more than once

• We “3” repeated so it is your Mode

Answer: Mode = 3 ✔️

Answers ⬇️

• Mean: 7 ☑️

• Median: 8 ☑️

• Mode: 3 ☑️

Good luck on your assignment and enjoy your day!

~LoveYourselfFirst:)

A line with a slope of 1/3 passes through (-5,r) and (4,1).
To make this work correctly, the value of r=

Answers

Answer:

r=-2

Step-by-step explanation:

your welcome :D also if there's another answer could you give me brainliest pls

what are the missing numbers pls do it in order!!! :)

Answers

Answer:

12 30 and 50

Step-by-step explanation:

The person that answered is correct

Which of the following is the largest Customary Unit of time?

seconds

weeks

minutes

years

Answers

years because it’s longer than any of those

Answer:

it’s years

Step-by-step explanation:

p=1/2 q=-1/4 r=1/6 evaluate this: 48pqr(p+q+r)/(p+q)(p+r)​

Answers

Answer:

-2

Step-by-step explanation:

48pqr x (p + q + r) / (p + q) x (p + r)

48(1/2)(-1/4)(1/6) x (1/2 + (-1/4) + 1/6) / (1/2 + (-1/4)) x (1/2 + 1/6) dear lord..

48(1/2)(-1/4)(1/6) x (0.4) / (0.25) x (0.7)

-1 x (0.4) / (0.25) x (0.7)

-0.4 / 0.2

= -2

i really hope this is right because my brain hurts

Which of the lines below is parallel to a line with a slope of 3 and a y-intercept at (0, 3)?

line AB
line CD
line FG
line HJ

Answers

Answer:

[tex]\displaystyle line\:HJ[/tex]

Step-by-step explanation:

[tex]\displaystyle y = 3x + 3[/tex]

The descryption gives you the above Slope-Intercept Equation. Parallel equations have SIMILAR RATE OF CHANGES [SLOPES], therefore [tex]\displaystyle 3[/tex] remains as is, and perfourming [tex]\displaystyle \frac{rise}{run},[/tex] will give you that answer.

I am joyous to assist you at any time.

Answer:

D: line HJ

Step-by-step explanation:

Which isa zero of the quadratic function f(x) = 4x + 24x + 11?
Ox=9.25
Ox=-5.5
Ox=0.5
Ox=3.25

Answers

Answer:

b

Step-by-step explanation:

just took the test edg 22

Option B is correct, -5.5 is the zero of the quadratic function f(x) = 4x + 24x + 11

What is quadratic equation?

A quadratic equation is a second-order polynomial equation in a single variable x , ax²+bx+c=0. with a ≠ 0 .

The given quadratic function is f(x) = 4x²+24x+11

We have to find the zero of the function.

Let us use the quadratic formula to find the zero.

a=4, b=24 and c=11

Let us plug in these values in quadratic formula

x=- 24±√24²-4(4)(11)/8

=-24±√576-176/8

=-24±√400/8

=-24±20/8

=4(-6±5)/8

=(-6+5)/2  or -6-5/2

=-1/2 or -11/2

=-0.5  or -5.5

Hence, Option B is correct, -5.5 is the zero of the quadratic function f(x) = 4x + 24x + 11

To learn more on Quadratic equation click:

https://brainly.com/question/17177510

#SPJ7

I've asked this question twice and gotten 2 different answers. this is sooo urgent and I don't know what the right answer is. A long-distance phone company charges $4.95 month plus an additional $.10 per minute. a. Define a variable and write a formula to find the total cost per month for long-distance service. b. Use this formula to find the long-distance charges for 120 minutes of calls in one month.​

Answers

Answer:

C=4.95 +0.10x, where x=minutes

C=4.95 + 120(0.10)

C=4.95 +12.00=$16.95

Hope this helps!!

-17=x-15 x=-2 How do I show this work tho?

Answers

-17 = x - 15

-17 = -2 - 15

Move the 15 over to the -17, the negative becomes a positive.

15-17 = -2

17 - 15 = 2 but since 17 is greater than 15, it's -2

-2 = -2

please actually help me. ill give brainliest if you explain your answer.

Answers

Answer:

subtract 11 from both sides

Step-by-step explanation:

-3x+11=44

-3x=33

x=-11

Answer:

Subtract 11 from both sides

Step-by-step explanation:

[tex]-3x+11=44\\\\Subtract 11 from both sides\\-3x+11-11=44-11\\\\simplify\\\\-3x=33\\\\Divide both sides by -3\\\frac{-3x}{-3} =\frac{33}{-3} \\x=-11[/tex]

Tell which number is greater.

60%, 5/8

Answers

Answer:

5/8 is greater

Step-by-step explanation:

hope that helps

Evaluate d−7 when d=10.

d−7=
plsss i need an answer

Answers

Answer:

Its 3

Step-by-step explanation:

If we know that d is 10 we can substitute d for 10 thus giving us 10 - 7 which is 3

Answer :

We are given,

d - 7 .....[eqⁿ (i)]

and we are also given the value of d :

d = 10

Now, just put the value of d = 10 in eqⁿ (i) we get :

10 - 73

Hence your final answer is 3.

Please hurry. I will give brainliest. :)

Answers

Answer: Am thinking it is B because am only 11 and I don't know if this is right. Hope this helps, or not...

Step-by-step explanation:

Indicate whether the expression above is equivalent or not equivalent to the values or expressions in the last column.

Please help !!!!

Answers

Answer:

3. equivalent

4. not equivalent

Step-by-step explanation:

Answer:

what are you doing step bro!!??

Step-by-step explanation:

PLEASE HELP! PLEASEE
Match the following equation to the correct situation.

s − s(21%) = s(79%)
A.
the price for a shirt that originally cost s after a 21% discount

B.
the amount that Anis owes on his car was 21% of s

C.
the amount that Katie paid for a pair of jeans with 21% tax on s

D.
the amount Doug gave to the local heart association was 21% of s

Answers

Gdbensudmdmjeh chbdvyshh in cahgyzbwhh by h in uubb hv gibuduyhe d

Denise has $4.25 and needs to buy school supplies. She has a package of pencils that costs $1.75, a notebook that costs $1 and some erasers (x) that costs $0.25 each. At most, how many erasers can denise buy?

Answers

Answer:

6 erasers

Step-by-step explanation:

The pencils and the notebook together cost $2.75, from there you can calculate how many erasers.

1 eraser would bring the total to $3, therefore Denise can buy $1.25 more of erasers which is 5. 3 + 1.25 is $4.25. therefore Denise can buy 6 erasers

Answer:

he can buy 6 erasers

Step-by-step explanation:

because if you add 1.75 plus one and add 0.25 ....6 times it will equal 4.25 i hope this was helpful

If you deposit 4,300 into an account with an semi annual interest rate of 11% how much will you have after 1year

Answers

Answer:

FV= $4,786.01

Step-by-step explanation:

Giving the following information:

Initial deposit (FV)= $4,300

Number of periods (n)= 2 semesters

First, we need to calculate the semi-annual interest rate:

Semi-annual interest rate= 0.11/2= 0.055

Now, to determine the future value, we need to use the following formula:

FV= PV*(1+i)^n

FV= 4,300*(1.055^2)

FV= $4,786.01

(GIVING BRAINLIEST!!)
A teacher buys 5 pizzas. Each slice is 1/8 of a pizza. How many slices are there in total?

A) 1/40 slice
B) 4 slices
C) 20 slices
D) 40 slices

Answers

Answer:

D) 40

Step-by-step explanation:

5 pizzas and as saying above 1/8 that means the pizza is being cut into 8 slices and their is 5 pizzas so the answer will be provided by multipling 8 by 5

Answer:

There are 8 slices in =1 box

8*5

=40 slices in all 5 boxes

y = 5/4 x + 3.000000000

Answers

Answer:

151

Step-by-step explanation:

the temperature is 50 degrees Fahrenheit the temperature will decrease 4 degrees each hour let H be the number of hours when will it be 32 degrees
write a inequality ​

Answers

Answer:

LGFJDbvoRUWSVBIeLas

Step-by-step explanation:

>) Find the slope of the line that passes through (1, 11) and (9, 2). )) Simplify your answer and write it as a proper fraction, improper fraction, or integer. ​

Answers

Answer:

The slope is [tex] - \frac{9}{8} [/tex].

Step-by-step explanation:

[tex]m = slope[/tex]

Remember: [tex]m = \frac{y_2 - y_1 }{x_2 - x_1} [/tex]

☆All you have to do is plug in.

[tex]m = \frac{2 - 11}{9 - 1} = \frac{ - 9}{ \: \: 8} = - \frac{9}{8} [/tex]

Question is in picture below ​

Answers

Answer:

[tex] \frac{y - 18}{x - 1} = \frac{23 - 18}{1.5 - 1} = \frac{5}{0.5} = 10 \\ y - 18 = 10(x - 1) = 10x - 10 \\ y = 10x + 18 - 10 = 10x + 8 \\ \boxed{f(x) = 10x + 8}[/tex]

A. is the right answer.

hope this helps.

A sandbox is located at (-8, -3). How many UNITS apart on the coordinate plane are the locations of the swing set and the sandbox?

Answers

where is the swing set

find the value of y for the given value of x y = 5x +9 ; x=2​

Answers

Answer:

y = 19

Step-by-step explanation:

the value of Y is 19

Other Questions
please answer this question urgently Use f(x) = 2x + 7 find f(2) The ancient Indians can boast of few significant achievements.Please select the best answer from the choices providedTF What is the area of `STR`?A. 30 square feetB. 34.5 square feetC. 57.5 square feetD. 60 square feetHere another one T^T plzzzzzzzzz help me with this question. The question is The Incas used quipus to what ????? Which of the following is one of the greatest effects of the agricultural revolution 2 2/5 multiplied by 2 multiplied by 3 1/5 pls someone plsss help meeeee There once was a ship that put to seaThe name of the ship was the Billy of TeaThe winds blew up, her bow dipped downO blow, my bully boys, blowSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goShe had not been two weeks from shoreWhen down on her a right whale boreThe captain called all hands and sworeHe'd take that whale in towSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goBefore the boat had hit the waterThe whale's tail came up and caught herAll hands to the side, harpooned and fought herWhen she dived down lowSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goNo line was cut, no whale was freedThe Captain's mind was not of greedAnd he belonged to the whaleman's creedShe took that ship in towSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goFor forty days, or even moreThe line went slack, then tight once moreAll boats were lost, there were only fourBut still that whale did goSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goAs far as I've heard, the fight's still onThe line's not cut and the whale's not goneThe Wellerman makes his regular callTo encourage the Captain, crew, and allSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and go Please help Im stuck!!!! PLEASE HELP I NEED THE ANSWER QUICK!!! What is the Length/ value of N is 63 / 168 equivalent to 312 / 832 Which Pope wanted to liberate Jerusalem from Muslim control? A 14.0 tank contains 250 g of methane (CH4) gas at 27 atm at 298 K. Accidentally, 190 g of CO2 was added to the tank. What will be the resulting pressure of the mixture in the tank? Assume that no CH4 leaked out as the CO2 gas waa being added. Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) PLEASE HELP!! I'LL GIVE BRAINLEST!!Use the formula P = 2l + 2w. Find the perimeter of a rectangle with a length of 12.9 ft and a width of 19.3 ft. Show all of your work. (4) NH3+02- NO+H2Obalance the equation Find the slope intercept equation of the line Ryan buys a baseball bat. The original price is $20. Ryan has a coupon for a 20% discount. What is the sale price?