Mention the function of oveary ,ovduct and utterus in the female reproductive system. how essential materials are supplied for the development of foetus​?

Answers

Answer 1

Answer:

- The ovary is the female organ that produces the female gametes

- The oviducts are tubes that extend from the ovaries to the uterus  

- The uterus is an organ that acts to nourish and house a fertilized egg until the fetus is delivered  

- Materials are supplied by the mother's placenta  

Explanation:

The ovaries are the female gonads that function to produce and release female gametes (i.e., oocytes) into the reproductive tract. These organs are also in charge of producing female hormones (e.g. progesterone). The oviducts, also known as fallopian tubes, are a pair of tubes that extend from each ovary to the top of the uterus. The uterus is a thick muscular organ of the female reproductive system that nourishes and houses the embryo and fetus. Finally, materials such as oxygen and nutrients pass from the mother's bloodstream through the placenta which is connected to the fetus by the umbilical cord.


Related Questions

All natural resources are also either renewable or non-renewable. *
True
False

Answers

the answer would be true

WILL GIVE BRAINLIEST IF CORRECT
The two mice pictured below are genetically identical. How were they produced?

Answers

Answer:

Both of the mice had the same allels by the parents (EE)

Explanation:

Which event came first? The age of reptiles Amphibians leave the water Trilobites are one of the dominant species on Earth Early humans arise on Earth​

Answers

Answer:

Trilobites are one of the dominant species on Earth

We know it's not D, the age of reptiles was just a "wee" bit before humans, and amphibians came after trilobites.

Answer

F1 development of the ozone layer

S2 sharks and trilobites abundant in oceans

T3 plants and animals colonize land

F4 dominance of reptiles >> dominance of mammals

Can anyone help me with my homework

Answers

Answer:

1) True

2) True

3) False

4) True

5)True

True or false: Invasive species are harmful in every single environment/ecosystem in the world.

Answers

Answer: the answer is yes

Explanation: in Florida we have multiple different invasive species which are destroying the environment.

True
Because the animal can be harmful to many other species in that ecosystem

WILL GIVE BRAINLIEST!!!!

Use the drop-down menus below to identify the organ(s) that is/are responsible for each function of the excretory system.

produces feces

excretes sweat

converts poisonous substances to less toxic forms

excretes carbon dioxide and water

produces urine


Answers:
large intestine, skin, liver, lungs, kidney

Answers

Explanation:

large intestine, skin, liver, lungs, kidney

hope it is helpful to you

Answer:

1. Large intestine

2. Skin

3. Liver

4. Lungs

5. Kidney

Explanation:

Bc I said so

For this assignment, you will ask questions about the factors that have caused a rise in global
temperatures over the past century. Then, you will conduct research to answer your questions. You will
also graph provided information, analyze the graphs, and make conclusions based on the graphs. Finally,
you will write a paper describing the conclusions of your research and graphs.
Background Information
Global temperature change is a gradual increase in the overall temperature of the Earth's atmosphere.
Both human activity and natural processes have contributed to this temperature increase. Examples of
human activities include the burning of fossil fuels, cement production, and agricultural activity. Examples
of natural processes include changes in incoming solar radiation and volcanic activity.
Scientists present evidence for the rise in global temperature in the form of tables, graphs, maps, and
models. For example, scientists build climate models (computer simulations of climate systems) to
explore the causes and effects of global temperature change and to predict future trends. These models
predict that the Earth’s average surface temperature will rise as greenhouse gas concentrations continue
to rise. Based on these models, scientists predict that average surface temperatures could rise by
between 2°C and 6°C by the end of the 21st century.

All I need is the graph

Answers

My project is in the file attached, lots of thanks to Maxineishere for helping me with the essay. You may need adobe reader for this as the files are PDF files, I hope you are satisfied! :)

DATE ANSWERED: 5/8/2021

The graph represents changes to two jackrabbit populations in two different areas over 15 years.
a. Which of these populations experienced the faster growth rate over the first five years? Explain your answer.
b. Which of these populations probably experienced more births than deaths over the first five years?
c. What is the approximate carrying capacity for each population, as indicated by the graph?
d. At carrying capacity, how would the growth rate of the population in area A compare with the growth rate of the population in area B?
e. Although the two populations started out at the same size, one population grew larger than the other. What are two environmental factors that could have limited the growth of one of these populations?
f. For the population in area A, which part of the chart shows exponential growth and which shows logistic growth?
g. What are two possible changes to environmental factors that could cause the population in area B to experience positive population growth that would allow it to reach the same carrying capacity as the population in area A?

Answers

Answer:

B: blue experienced more death than red

. Aşağıdaki şekilde hazırlanan tampon çözeltilerin pH'larını hesaplayınız? a) 8 mmol NaCH3COO+ 200 mL 0.1 M CH3COOH b) 100 mL 0.05 M NaOH+ 100 mL 0.175 CH3COOH c) 40.0 mL 0.12 M HCl +160 mL 0.0420 M NaCH3CO

Answers

Answer:

can u write this in english

Explanation:

Condensation is when water changes from a
A. gas to a liquid.

B. liquid to a gas.

Answers

the answer is A. Condensation is when a gas becomes a liquid. It happens when a gas, like water vapor, cools down. ... In condensation, matter changes from a gas to a liquid. All matter is made of tiny moving particles called molecules.

Answer:

ima say its A but if its wrong im srry

Explanation:

Which statement is not true about chicken-pox?

Answers

Answer:

where is your statements

Match each graph with its correlation coefficient.
+1.0
+0.85
+0.15
-0.50
-1.0

Answers

Answer:

-0.50

Explanation:

For the graph displayed, the most probable value of the correlation Coefficient is - 0.50 ; the line of best fit has a negative skoe and hence will have a negative relationship as the correlation Coefficient is a statistical value which measures the degree of relationship between two variables. Also, the distribution of data in the plot does not give a perfect fit, hence a correlation Coefficient of - 1.0 isn't possible for the distribution shown.

Answer:

fist graph: -0.50

second graph: +0.85

third graph: +0.15

fourth graph: +1.0

fifth graph: -1.0

Explanation:

im pretty sure this is the correct answers

what is the difference beween respiration and breathing​

Answers

Answer:

Breathing: is the physical process of exchanging gases

respiration: is a chemical process that takes place at a cellular level and produces energy.

Imma give u brainliest

If anyone answer these questions

Answers

Answer:

it is to do with something called angular moment. Gravity is the central force in the Universe, because it is the only one which has a significant pull over large distances.

5:Orbits are the result of a perfect balance between the forward motion of a body in space, such as a planet or moon, and the pull of gravity on it from another body in space, such as a large planet or star. ... These forces of inertia and gravity have to be perfectly balanced for an orbit to happen.

6;Gravity is the force that keeps planets in orbit around the Sun.

7.gravity

The dynamics of a rotating body is of course controlled by forces like gravity. Kepler's laws are a direct consequence of gravity

8.Rather, the term is derived from the concept of the tide "springing forth." Spring tides occur twice each lunar month all year long, without regard to the season. Seven days after a spring tide, the sun and moon are at right angles to each other

9.Neap tides occur halfway between each new and full moon – at the first quarter and last quarter moon phase – when the sun and moon are at right angles as seen from Earth.

Scientists sink concrete blocks in oceans to create artificial coral reefs. Which successive event most likely occurs first on this type of coral reef

Answers

Answer:P

Explanation:got it right

Coral polyps attach themselves to the surface to grow is the event most likely occurs first on this type of coral reef.

What is Coral reef?

Coral reefs are significant ocean habitats that make a strong argument for the dangers of climate change. Reefs are a significant contributor to the biodiversity of the planet; they have been referred to as "the rain forests of the seas." One of the most diverse environments on earth, coral reefs are home to 25 percent of all marine species, according to scientists.

According to Paulo Maurin, coordinator of education and fellowships for NOAA's Coral Reef Conservation Program, the reefs are essential to the biodiversity of our world.

Many fish species use them as fruitful nurseries, giving the young fish a place to live and an opportunity to develop, according to him. "The diversity of coral reefs is so great that we don't have a firm count of all the species that live there,"

Therefore, Coral polyps attach themselves to the surface to grow is the event most likely occurs first on this type of coral reef.

To learn more about Coral reef, refer to the link:

https://brainly.com/question/15794949

#SPJ2

What will most likely occur if population density increases in a population that is density dependent?

Birthrate will decrease.
Carrying capacity will increase.
Death rate will decrease.
Immigration will increase.

Answers

Answer:

D

Explanation:

Population density is the number of individuals in a unit square area. As if population density increases in a population that is density-dependent, will increase immigration, i.e., option D.

What is immigration?

Immigration is a process by which individuals become residents of another country permanently.

The process of immigration is of great importance for social, economic, and culture of states.

As population density increases in a population that is density-dependent immigration will also increase.

Thus, the correct option is D.

For more details regarding immigration, visit:

https://brainly.com/question/13688875

#SPJ2

AAAAAUGACCAAAGUGGAGUAAUGGUAACCC please type first 3 letters of each amino acid separated by a dash.

Answers

Answer:

what?

Explanation:

Name 5 invasive species in Florida

Answers

Answer:

5 INVASIVE SPECIES:

-Burmese Python

-Iguanas

-Cane toads

-Lionfish

-Feral Hogs

Hope this Helps!

1. What is the atmosphere? *

1. It is another name for outer space
2. The first layer of the Earth's crust
3. A layer of gases that surround the Earth
4. The inner materials that make up the planet

2. Which of the following best describes the Earth's atmosphere? *

1. An empty space
2. A big blanket absorbing the Sun's heat
3. A thin towel that does very little to protect the Earth
4. A large cloud that generates the Earth's electromagnetic field

3. What is the ozone layer? *
( this was answered by a very helpful person but i included it to not add confusion )
1. The layer of the Earth below the crust
2. The layer of the atmosphere that we breathe
3. A portion of the Earth's atmosphere that protects the Earth from radiation
4. All of the above

4. In what layer of the Earth's atmosphere do planes usually fly? *

1. Thermosphere
2. Mesosphere
3. Stratosphere
4. Troposphere

5. What layer of the Earth's atmosphere is heated by the Sun hitting the ozone layer? *

Thermosphere
Mesosphere
Stratosphere
Troposphere

6. What layer of the Earth's atmosphere is the layer next to the Earth? *

1. Exosphere
2. Thermosphere
3. Mesosphere
4. Stratosphere
5. Troposphere

7. What layer of the Earth's atmosphere is the outermost layer and where the atmosphere is the thinnest? *

1. Exosphere
2. Thermosphere
3. Mesosphere
4. Stratosphere

8. What layer of the Earth's atmosphere can become very hot during the day and thought of as the start of outer space? *

1. Mesosphere
2. Troposphere
3. Thermosphere
4. Stratosphere

9. What layer of the Earth's atmosphere is where most meteors burn up upon entry? *

1. Exosphere
2. Troposphere
3. Stratosphere
4. Mesosphere

10. Why is it difficult to breathe at high altitudes? *

1. Because you are closer to the sun the higher you go.
2. Because atmospheric gases become thinner the higher you go.
3. Because there is more carbon dioxide the higher you go.
4. Because there is no oxygen in the troposphere.

Answers

Answer:

I HOPE THE ANSWERS ARE CORRECT JUST RECHECK

Explanation:

1-3

2-2

3-3

4-3

5-3

6-2

7-OUTERMOST=1

8-2

9-4

10-2 (ONLY NOT SURE ABOUT THIS)

(3) A layer of gases that surround the Earth.(2) A big blanket absorbing the Sun's heat.(3) A portion of the Earth's atmosphere that protects the Earth from radiation.(4) Troposphere(3) Stratosphere(5) Troposphere(1) Exosphere(3) Thermosphere(4) Mesosphere(2) Because atmospheric gases become thinner the higher you go.

Why are viruses not considered living organisms by most people?

Answers

Answer:

Viruses are not considered living organisms because they require a host cell to replicate, unlike living organisms which can replicate on their own.

You are exposed to the same pathogen twice in your lifetime. Which of the following
is true?

A.) Your body will fight the second exposure much slower because it has already
used up all its antibodies against that antigen.

B.) The reaction times will be almost equal.

C.) You cannot be exposed to the same pathogen twice in your life because you
already destroyed those pathogens with your Killer T cells.

D.) Your body will fight the second exposure much quicker because it has stored
memory cells against that specific antigen.

Answers

Answer:

the answer would be D

Explanation:

Answer:

d

Explanation:

An increase in heart rate (your heart pumps faster) results in...

A. No changes to cardiac output or pressure
B. Increase cardiac output and high pressure
C. Increased cardiac output but lower pressure

Answers

Answer:

B

Explanation:

I believe that the answer is B

I do not know how to answer this question please help asap

Answers

Answer:

It would be Africa

Explanation:

It has the a lot of the color for water scarcity

Hope it helped!

A cladogram is shown below. What is a derived characteristic that distinguishes the salamander from the perch? lungs claws or nails fur jaws

Answers

About the question:

You will a cladogram in the attached files.

Answer:

lungs

Explanation:

A Cladogram is a tree-type graph based on cladistic analysis. It represents the common ancestral relationships among the involved groups.  

• The tree-type graph is a ramified diagram that represents the relationship between the involved taxa.  

• The cladistic analysis follows the maximum parsimony criterium. Explains the character state from the point of view of the fewest changes through history. Explains evolution with the minimal amount of evolutive changes. It recognizes the monophyletic groups as natural groups. These groups are the clades, and their classification -sequencing- represents their phylogeny.  

• The sequencing term refers to lists of groups according to their relation. One group is the brother-group of the following one.  

So the cladogram represents the relationship between groups according to a derived character.  

The derived character is any trait that a group passes to the descendants. Through evolution, the characters change, and new changes are added. When referring to a derivate character, we mean that all the subsequent species in the cladogram carry the trait.

A cladogram provides an image of how new species keep characters that were inherited from older species.

In the attached cladogram, you can see that the lungs are the derived character that distinguishes the salamander from the perch.

Claws or nails separate salamander from lizards.

Fur separates birds and reptiles from mammals.

Jaws separate hagfish from perch.

Mutations occurred in evolution producing new traits, and these traits also appear in posterior groups. So, after the hagfishes emerged the jaws, and all the animals that followed the hagfishes have jaws.

Lungs appeared after the perch and before salamander, so salamander, and all the posterior animals, have lungs. And so on.

The above graph shows vertebrate diversity in terms of total
number of species. Which of the vertebrate classes listed in
the graph would have the BEST chance of at least some of
the species surviving a major environmental change?

A:bony fish
B:birds
C:sharks, rays
D: mammals

Answers

Answer: a

Explanation:

Answer:

a

Explanation:

Question 2
Which of the following terms best describes the idea of managing and carefully using Earth's resources?
A
recycling
B
reducing
С
conservation
D
conclusion

Answers

A would be good because recycling is good for the earth and I had this question.

(Discussion topic)

Some people worry that the increasing number of cell phones will cause cancer
because of the energy of the radio waves they emit. Cell phones are a new technology
that only recently became widely used. And because cancer takes years to develop, the
amount of risk is not yet known.
K
Research this issue, and summarize what's known so far. In your summary, include
information about the energy of radio waves. Be sure to only use credible sources.
Based on what you learned from your research, do you think people should limit their cell phone use? Why or why not?

Answers

Answer:

No.

Explanation:

No, the increasing number of cell phones will not the cause of cancer because it emits low intensity of radio waves. Radiations such as x-rays, gamma rays, alpha particles, beta particles, and neutrons are responsible for causing damage to the cell and the main cause of cancer. High intensity of radio waves heats up the cells not causing cancer disease so we can conclude that the increasing number of cell phones will not cause cancer disease in humans.

Answer:

No, the increasing number of cell phones will not the cause of cancer because it emits low intensity of radio waves. Radiations such as x-rays, gamma rays, alpha particles, beta particles, and neutrons are responsible for causing damage to the cell and the main cause of cancer. High intensity of radio waves heats up the cells not causing cancer disease so we can conclude that the increasing number of cell phones will not cause cancer disease in humans.

can exoskeletons break?

Answers

If a large animal such as a human being had a thin light exoskeleton, there would be several problems. Since the exoskeleton would not be able to hold its shape, it would be difficult to keep the vital organs protected and the organism would be subject to damaging levels of stress just by moving around. They are not strong enough to hold organs or hold its shape.

What are the consequences of humans adding gases and other substances to earth's atmosphere?

Answers

Answer:

depends which kinds. some can eat the atmosphere like the hole in the atmosphere like the gases from aerosols like hair spray, some trap heat from the sun like greenhouse gases, silver oxide can collect moisture in the air to make rain, air pollution from dense factory and vehicle usage can cause smog and acid rain, fertilizer and pesticide from farms can run off into rivers and other bodies of water

Answer:

1.

2.

Explanation:

. . . .



Help!

For the global population growth rate to reach zero, the number of births would have to be

Answers

Answer:

same as the number of death

... is what you fill in.

Explanation:

If the death and birth number are equal, there are no changes in numbers made.

For the global population growth rate to reach zero, the number of births would have to be same as the number of death.

What do you mean by population growth rate?

Population growth is the increase in the number of people in a population or dispersed group. Actual global human population growth amounts to around 83 million annually, or 1.1% per year. The global population has grown from 1 billion in 1800 to 7.9 billion in 2020.

Population in the world is, as of 2022, growing at a rate of around 0.84% per year (down from 1.05% in 2020, 1.08% in 2019, 1.10% in 2018, and 1.12% in 2017). The current population increase is estimated at 67 million people per year.

The world's population is expected to increase by nearly 2 billion persons in the next 30 years, from the current 8 billion to 9.7 billion in 2050 and could peak at nearly 10.4 billion in the mid-2080s.

Learn more about population growth rate:

https://brainly.com/question/14122627

#SPJ6

Other Questions
Brian is a manager who made triple chocolate chip cookies for his team.When he decides whether those on his team who worked hardest should get more cookies, or just splitthem up equally, which of the three basic economic questions does he answer? A sprinter accelerates at 8mps, he weights 850 grams. Whatforce is he exerting? HELP ASAP I NEED TO PASS THIS is x = 10 part of the solution 2x + 5 > 23? why or why not? URGENT!!! Help pls. U could literally just give me the equations Sicilian Defence, a division of Queen's Gambit Corp., has a net operating income of $60,000 and average operating assets of $300,000. The minimum required rate of return for the company is 15%. If the manager of the Sicilian Defence division is evaluated based on residual income, will she want to make an investment of $100,000 that would generate additional net operating income of $18,000 per year? The pressure on 200 milliliters of a gas at constanttemperature is changed from 380 torr to 760 torr. The newvolume of the gas is Why did women experience greater equality in the West than in the East? A triangle is formed with side lengths of 7 inches, 24 inches, and 25 inches. Is the triangle a right triangle?AThe triangle is a right triangle because 2(7)+2(24)=2(25) .BThe triangle is a right triangle because 7^2+24^2=25^2 .CThe triangle is not a right triangle because 25^224^2=7^2 .DThe triangle is not a right triangle because 7^2+^25^2=24^2 . Jaquan was told to go inside one afternoon while he was at summer camp. He heard thunder and saw flashes of lightning. Suddenly, small balls and chunks of ice were falling on the field. Jaquan checked the thermometer, because he never saw ice fall in South Florida, and noticed that it was 77F (or 25C). How was ice able to fall even though the temperature was much warmer than freezing? a) Jaquan read the thermometer wrong b) He must have observed hail falling from thunder clouds c) It was cold enough to allow solid precipitation to fall d) Children were most likely throwing ice Reasoning (explain your answer using science facts) _________________________________________ _______________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________ A triangle has sides with lengths of 33 meters, 56 meters, and 65 meters. Is it a right triangle? Is Biotechnology ethical ? Why is it or why is it not ? Why did the author include the section "Key Dates in Forensic Toxicology"?Ato show that poison was much more common in the pastBto show that poison can be made from any plantCto show that poison takes a long time to workDto show that poison has been around for a long time why did the queen of hawaii yield her authority to the united states why is the same of cell membrane is equal in both plant cell and animal cell Calculate the pH of the solution:[OH-] = 1x10^-11Ma.11.0b.12.0c.2.7d.3.0 what will happen when the rates of evaporation and condensation are equal Directions: I have attached a copy of some fun facts about each planet. This week we have been discussing facts about each planet as well through bell ringers. Please research and present during class time (MONDAY & WEDNESDAY) and ZOOM (TUESDAY & THURSDAY). You are to write a poem or song about the planets and the information you submit have to be true about each planet. HYBRID students will present and submit a copy on WEDNESDAY, VIRTUAL students will present and submit a copy via CANVAS. HAPPY WRITING!!!!!! Please help! Due today MACBETH. all our yesterdays have lighted foolsThe way to dusty death. Out, out, brief candle!Lifes but a walking shadow, a poor playerThat struts and frets his hour upon the stageAnd then is heard no more. It is a taleTold by an idiot, full of sound and furySignifying nothing.What is the main idea of this famous speech from Act V of The Tragedy of Macbeth by William Shakespeare?Macbeth is refusing to accept the idea of his wifes death.Macbeth is realizing that all of his striving for power has been for nothing.Macbeth is gathering his strength for the battle that is to come.Macbeth is expressing concern about the upcoming battle.