Milgram's study provides evidence that obedience to authority may be more common than most of us would like to believe. True False

Answers

Answer 1
False ok



Have a great day today

Related Questions

Officers Bennett and Stuggs come to arrest Daryl at his house for a recent burglary. The burglaries have all been in Daryl's neighborhood while the homeowners have been away on vacation. After a few of the burglaries neighbors got wise and installed surveillance cameras which one caught Daryl picking the back slider to gain entry. They have an arrest warrant but no search warrant. After arresting Daryl and putting him in the cruiser, the officers go back into Daryl's house and go to the kitchen (the room where they arrested Daryl) and look for evidence of the burglary. Not finding anything in the kitchen they then decide to do a search of the rooms of the first floor, while looking in a closet they find items stolen from a neighbors house. Daryl moves to suppress the evidence of the stolen goods the officers found in the closet. The evidence of stolen goods should be:_____.

Answers

Answer:

He returned it since it was evidence that was stolen

Explanation:

By _____, 77 percent of all married women with school-aged children and 63 percent of married women with pre-school-aged children were working outside the home.

Answers

Since 2000s, about 77% of all married women and 63%  of married women with pre-school-aged children were working outside the home.

What are these people called?

These people are called labor and forms part of the labor force of their country.

In conclusion, since the 2000s, about 77% of all married women and 63%  of married women with pre-school-aged children were working outside the home.

Read more about labor force

brainly.com/question/24939447

How did East Bengal become a Province of Pakistan.

Answers

Answer:

The Hindu-majority West Bengal became a state of India, and the Muslim-majority East Bengal (now Bangladesh) became a province of Pakistan. ... On 6 July 1947, the Sylhet referendum decided to sever Sylhet from Assam and merge it into East Bengal.

When someone is jogging on the left side of the sidewalk and you, running faster, overtake that person on his or her right, this runs counter to a __________ in the United States.

Answers

Overtaking a  person on his or her right, this runs counter to a Folkways in the United States.

What is Folkways?

Folkways  can be regarded as the category of norm which is roughly translated to a 'social or cultural custom'.

It is seen in the example of when  jogging on the left side of the sidewalk and you, running faster

Learn more about Folkways at:

https://brainly.com/question/4132126

Explain how a commitment to a decision could assist a school leaver to adapt to the change of entrepreneurship.

Answers

Entrepreneurship corresponds to the initiative to start a new business that meets the needs of individuals or groups in an innovative and creative way, and this decision can be a solution for individuals who need to start a new career.

Characteristics of an effective entrepreneur

The individual who starts a new business must be aware of the inherent risks of the business, so it is essential to develop skills such as:

CommunicationAdaptationEyesightInitiativePersistenceCommitment

Therefore, entrepreneurship is an area of ​​personal and social transformation, with success being the consequence of the entrepreneur's effort, creativity and vision.

Find out more information about entrepreneurship here:

https://brainly.com/question/13628349

Andre claims that he can make a broken watch begin to run again simply by entering a state of intense mental concentration. Andre is claiming to possess the power of

Answers

psychokinesis is the answer.
Have a great day :)

Explain why adapting your perspective towards stressful situation is important in order to minimise its negative effects?​

Answers

Answer:

Exercise regularly. Physical activity plays a key role in reducing and preventing the effects of stress. ...

Eat a healthy diet. Well-nourished bodies are better prepared to cope with stress, so be mindful of what you eat. ...

Reduce caffeine and sugar. ...

Avoid alcohol, cigarettes, and drugs. ...

Get enough sleep.

Explanation:

Adapting your perspective towards stressful situation is important in order to minimise its negative effects because it helps to regain your sense of control.

What is Stress?

This is defined as the feeling of emotional or physical tension which is characterized by anger, frustration etc.

Adapting to this type of perspective helps to change expectations and attitude. thereby minimizing its negative effects.

Read more about Stress here https://brainly.com/question/11819849

Conflict avoidance Definition

Answers

Answer:

The act of avoiding conflict (trouble)

Explanation:

Bill grew up in a safe neighborhood, and his family made enough money for him to be comfortably fed and clothed. Bill worked hard in school, and he has decided to apply for admission to the University of Michigan. He puts a lot of effort into his application. Five months later, Bill is elated when he receives a letter of acceptance. Explain how each of the following psychological theories might consider Bill's experiences. - Maslow's hierarchy of needs - James-Lange theory - Cannon-Bard theory - Schachter-Singer two-factor theory

Answers

The following psychological theories concludes Bill's experiences:

Maslow's hierarchy of needs.James-Lange theory.Cannon-Bard theory.Schachter-Singer two-factor theory.

What are psychological theories?

They are systems of  ideas that can explain certain aspects of human thoughts, behaviors and emotions.

Bill's ability to pursue a college education can be put into perspective through the lens of Mas-low's hierarchy of needs.

His basic needs of food, shelter and water were met, allowing him to pursue higher needs like the need for belonging, esteem and self-actualization which might be met by attending college.

When bill got his acceptance letter, his heart began to race and according to James-Lange's theory of emotions, this sign of psychological arousal causes (is identical to) Bill's feeling of excitement or nervousness.

The Cannon-Bard theory of emotions shows that Bill feels physiological arousal at the same time that he experiences emotions of excitement or nervousness, thought the two emotions are independent of  each other.  

The Schachter-Singer two factor theory combines Bill's reaction into two-step process:

First, he feels physiological arousal ( heart racing and increased breathing).Second, he interprets that arousal is as a result of excitement or nervousness.

In this model, arousal and cognition combine to produce emotion.

Read more about needs here:

https://brainly.com/question/14314710

100 POINTS AND BRAINLIEST TO WHOEVER ANSWERS THIS CORRECTLY WITH A GOOD EXPLANATION

Answers

Answer:

I can't really see but I think it's D.) Double check!!

Explanation:

Answer:

Timbuktu

Explanation:

Timbuktu is a historically famous city in Egypt, Africa that is home to many historic mediums such as ancient religious texts and articles that are sacred to medieval African history. This is the best place for someone to learn more about their faith by studying various resources that are kept there. Hope that helps :)

Where did federal authorities first join the freedom ride to provide the riders with protection?.

Answers

The federal authorities initially joined the freedom ride to provide the riders with protection through the first freedom ride that happened in Washington, D.C. on May 4, 1961.

What is a freedom ride?

A freedom ride refers to number of political protests against the existence of segregation of Blacks in riding of buses together through the American South.

In conclusion, the federal authority joined through first freedom ride that happened in Washington, D.C. on May 4, 1961.

Read more about freedom ride

brainly.com/question/530864

Which effect did the bubonic plague have on european life during the middle
ages

Answers

Answer:

The effects of the Black Death were many and varied. Trade suffered for a time, and wars were temporarily abandoned. Many labourers died, which devastated families through lost means of survival and caused personal suffering; landowners who used labourers as tenant farmers were also affected.

Date: 1347 - 1351

Explanation:

this is as detailed as I can make it.

In 2013 the supreme court struck down which part of the 1965 voting rights act?.

Answers

Answer:

coverage formula used by the government to determine which states are required to get federal permission before they make any changes to voting laws is unconstitutional. The ruling effectively puts the issue back in the hands of lawmakers to revise the law. And until then, the ruling effectively renders section five of the Voting Rights Act inoperable.

Explanation:

GIVING HIGH POINTS!!!

Which two of the following sentences from the article state CENTRAL ideas?


The young United States was almost entirely a Christian nation and its followers split into various groups with different beliefs.

At the heart of the Second Great Awakening was a desire to spread Christianity to everyone, a practice called evangelism.

Many of these workers were from Ireland and followed the religion of Catholicism, which was widely disliked by many American Protestant Christians.

In 1830, Finney preached every day for six months and held group prayer meetings within family homes to bring people into Christianity.


A 1 and 2

B 2 and 3

C 3 and 4

D 1 and 4

Answers

Answer:

B 2and 4

Explanation:

Many thanks for your email is not available for remote playback

True or false was the Justinian plague had little effect on the Roman empire society due to the size of the empire

Answers

It’s false



The plague weakened the Byzantine Empire at a critical point, when Justinian's armies had nearly retaken all of Italy and the western Mediterranean coast; the evolving conquest would have reunited the core of the Western Roman Empire with the Eastern Roman Empire

What is the International Mother Language Day?

Answers

International Mother Language Day is a worldwide annual observance held on 21 February to promote awareness of linguistic and cultural diversity and to promote multilingualism.

In the soviet union, joseph stalin governed by means of secret police, censorship, and purges. This type of government is called.

Answers

Answer:

totalitarianism

Explanation:

Which of the following limiting factors would be directly affected by a drought? a. Birth/death rate b. Immigration c. Available niche d. Resource supply Please select the best answer from the choices provided A B C D.

Answers

Drought is a natural disaster that happens to the lack of water resources on the earth which has a serious impact on agriculture economy health energy and the environment. So the correct option is D

what is the cause of drought?

When rainfall is much less over the time frame like 12 months because of water degree begins off evolved to lower from the consuming and agricultural supply like lakes, river tubewells etc.

Drought has a severe impact on the economy such as reduced forest, cropland productivity water level cloud cover, and income of the people.

Therefore the correct option is D

Learn more about Drought here:

brainly.com/question/993401

Answer:

Resource Supply

Explanation:

Water will be in small quantities and the plant that needs water to live will die then the animal that eats those plants will die then the animals that eat the other animals will die

During the last week of July 2017, members of the Federal Communications Commission testified before Congress about net neutrality rules. In the same week, the House Homeland Security Committee heard testimony about the role of technology in policing the border. These hearings are an example of:______.

Answers

The situation whereby the members of the Federal Communications Commission testified before Congress about net neutrality rules is an example of House hearing.

What is a House hearing?

In legislature, a house hearing refers to a session in the Senate or House open to the public in order to obtain information on proposed legislation or in evaluating the activities of a government department.

In conclusion, the situation whereby the members of the Federal Communications Commission testified before Congress about net neutrality rules is an example of House hearing.

Read more about House hearing

brainly.com/question/1615449

Viewed from the __________ sociological perspective, child care costs are an especially serious burden for lower-class families.

Answers

conflict perspective is the answer

________ is a discipline that studies the correspondence between signs and symbols and their meaning. Interpretation Semiotics Indexing Symbolism

Answers

Answer:

Semiotics

Explanation:

By definition, semiotics is the study of signs and symbols and their use and interpretation. This sounds very close to the definition that you gave. Hope that helps :)

Who was the first black justice on the supreme court?.

Answers

Answer:

Justice Thurgood Marshall

Explanation:

hope it will help you .........

Answer:

Thurgood Marshall was the First black justice on the supreme court

In which year the ancient olympic games were stopped.

Answers

Answer:

394 AD

The ancient Olympic Games officially came to an end around 394 AD, when Roman emperor Theodosius I outlawed pagan celebrations. The first modern Olympic Games took place 1503 years later, at Athens in 1896.

desertification would MOST impact which climate area fist?

Answers

Answer:

North eastern Brazil, South western Argentina

Which argument did states fighting the preclearance requirement of section 5 of the voting rights act make to the supreme court?.

Answers

It should be noted that the argument that the states engaged when fighting the preclearance requirement of section 5 of the voting rights act make to the supreme court is ;

Voter discrimination was no longer an issue in the states under preclearance.

What is Voting Rights Act?

The Voting Rights Act can be regarded as an act of 1965, which was signed inorder to overcome legal barriers that doesn't allow African Americans from exercising their right to Vote.

Learn more about Voting Rights Act at;

https://brainly.com/question/6838058

When we make self-serving attributions, we tend to attribute our successes to __________ factors and our failures to __________ factors. internal; external uncontrollable; controllable unstable; stable inconsistent; consistent

Answers

When we make self-serving attributions, we tend to attribute our successes to internal factors and our failures to external factors.

What are Self-serving Attributions?

This type of attribution is characterized by the fact that the person who suffers from it tends to attribute all the successes achieved to himself, even if he is in a well-structured work team.

On the other hand, when such a person fails in some way, he does not usually blame himself, but rather blames other people or factors that were not under his control.

If you want to learn more about Psychology, you can visit the following link: https://brainly.com/question/1844852

2. Which of the following is true of Manifest Destiny in the 1800s?

a. It was based on pervasive belief in white supremacy and European-American
cultural superiority
b. Native Americans were perceived as inferior and the westward movement of
Americans into traditionally indigenous lands was considered an absolute right of
white people
c. Many of the first westward settlers were missionaries seeking to Christianize
indigenous groups.
O d. All of the above statements are true of Manifest Destiny.

Answers

Answer:

D all of the above statements are true of manifest destiny

_________ is an attack in which the perpetrator uses social skills to trick or manipulate legitimate employees into providing confidential company information such as passwords. Espionage Profiling Malware Social engineering

Answers

The answer is social engineering

What do you think this picture is about?

Answers

Answer:

this picture is about 1994 south African general election.

Explanation:

I hope it helps you

The equator rotates ____________ the poles as it has more distance to travel in one day

Question 1 options:

unlike


faster than


the same speed as


slower than

Answers

Answer:

faster than

Explanation:

the further away from the center, the more distance needed to travel in the same time

Other Questions
A field is a rectangle with a perimeter of 960 feet. The length is 400 feet more than the width. Find the width and length of the rectangular field. CSI Miami: Using DNA to Solve a RobberyThe year is 2023. You are a detective for the Miami Dade Police Department. Youre on the scene of a crime where a man single-handedly just robbed a bank. Luckily, being the ingenious detective that you are, you were able to find a little spot of the mans blood where he cut his arm as he made his escape through a broken window. You take the blood to the lab so tests can be run. Unfortunately, no one was able to see the face of the man, so there are no suspects yet. Thanks to a study done in 2022, scientists have now figured which genes in DNA code for which characteristics in a person. On the next page is a strand of the sample of DNA extracted from the blood at the crime scene. Follow the steps below to help you come up with a sketch of the man who perpetrated this crime.methionine-leucine-proline = Protein that causes DARK SKINmethionine-leucine-leucine = Protein that causes LIGHT SKINvaline-proline-proline-lysine = Protein that causes GREEN EYESproline-leucine-valine-proline = Protein that causes BLUE EYESproline-lysine-proline-proline = Protein that causes BROWN EYESlysine-arginine-threonine-valine-serine-serine = BLOND HAIRlysine-arginine-threonine-valine-serine-cystine = BLACK HAIRlysine-arginine-threonine-valine-serine-valine = BROWN HAIRasparagine-isoleucine-arginine = CURLY HAIRasparagine-asparagine-isoleucine = STRAIGHT HAIRleucine-arginine-glutamic acid-arginine = BIG NOSEleucine-asparagine-arginine-glutamic acid = SMALL NOSEleucine-asparagine-asparagine-glutamic acid = MEDIUM NOSEproline-tyrosine-tyrosine-(stop) = SMALL EARSproline-proline-tyrosine-(stop) = MEDIUM EARS proline-tyrosine-phenylalanine-(stop) = BIG EARS Step 1: Decode the DNA into mRNAStep 2: Decode the mRNA into the corresponding amino acids from pg. 211 of your book. Write the amino acids in the order of the codons from the mRNA.Step 3: On a separate sheet of paper, draw a sketch of what this person might look like based on the traits you came up with. DNA: TACGATGAAGGCAATCAAGGGTTCTCCTGTCAAAGTACATTATAGGCAGACTTAGCGGTTGGAATGAAAATC | | |AUGmRNA:Protein Sequence: 1. Methionine 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. Step 4: Change the underlined nucleotide to a G. Refigure out your mRNA sequence and resulting amino acids. How would this mutation affect your picture? What kind of mutation did you just create?Step 5: Answer the following wrap-up questions:1) When you performed step 1, what enzyme were you imitating?2) In step 2, what molecule would have brought the amino acids that the codons asked for?3) In step 2, what molecule would have helped the amino acids line up and attach to one another?4) In step 2, what connected the amino acids together? What does In Truth's day-star mean in Edgar Allan Poe poem A Dream Which quotation from "Harrison Bergeron" by Kurt Vonnegut Jr. Best develops the theme that attempting to make people "equal every which way" is a dangerous and harmful goal? Question 3 options: "All this equality was due to the 211th, 212th, and 213th Amendments to the constitution, and the unceasing vigilance of agents of the United States. " "Then other people'd get away with it and pretty soon we'd be right back to the dark ages again, with everybody competing against everybody else. " The musicians scrambled back into their chairs, and Harrison stripped them of their handicaps, too. " "Every twenty seconds or so, the transmitter would send out some sharp noise to keep people like George from taking unfair advantages of their brains. ". PLSSS HELP IF YOU TURLY KNOW THISS You sell triangular flags made from felt. How much felt do you need to make 60 flags? Bill's chocolate bar is 69% cocoa. If the weight of the chocolate bar is 83 grams, how many grams of cocoa does it contain? Round your answer to the nearest tenth. Le dimanche 27 aot, Katy Perry (1)(donner) un concert au stade de France. a/C' (2)(tre) son premier concert parisien-Il y en a trois autres au programme, et il n'y (3)(avoir plus une seule place de libre l'intrieur, le public (4)(attendre) la star avec impatience quand tout coup, Katy Perry (5)(faire) son apparition. Elle(6)(sortir) d'une boule disco et elle (7)(commencer) sonspectacle. Les fans (8)(adorer)!Verbs in pass compose or imparfait. President Woodrow Wilson a. promoted racial equality. b. promised to respect Latin Americas independence. c. stopped U.S. investment in Latin America and the Caribbean. d. aligned with Dollar Diplomacy. e. designed a program to instill American values in Latin American schools. List three reasons why a study may be considered invalid. A neutral atom of Fluorine has seven valence electrons. How many valence electrons are present in the ion F-1? Conflict avoidance in relationship can someone explain the answer plz Which of the following is formed when minerals and extreme heat and pressure are combined? PLS I WILL GIVE YOU 23 POINTS IF YOU ANSWER ME CORRECTLYThe diagram shows 3/4 of a fraction strip shaded. Mary erases some of the shadings to show 5/8. Explain the steps she took to shade 5/8 of the fraction strip. Sean is filling his truck with gasoline. He knows the total cost, C, will be proportional to thenumber of gallons of gasoline, g, that he puts into the gas tank. After putting 8.5 gallons in.the tank, the cost is $23.63.(a) Find the ratio of the cost to the gallons as(b) What is the real world meaning of youra unit rate. Show the division as a fraction answer in (a)?and then state the answer with appropriateunits.(c) If c is the cost and g is the number ofgallons bought, write a proportioninvolving c and g and then solve it for c.(d) If Sean puts 17 gallons of gasoline intohis truck, what is his cost? Justify. 57 women make up an all female choir in a church.Two women are chosen to sing together for a duet.How many possible pairs could be chosen for the duet? Why is physical activity so important in preventing heart disease? Svetlana and her mother are very similar. Both have blonde hair, a love of scrapbooking, blue eyes, and a thin nose. Which statement most likely describes Svetlanas traits? Svetlana inherited her love of scrapbooking from her mother, but her blue eyes come from her environment. Svetlana inherited her blue eyes from her mother, but her love of scrapbooking comes from her environment. Svetlana inherited her thin nose from her mother, but her blonde hair comes from her environment. Svetlana inherited her blonde hair from her mother, but her thin nose comes from her environment. German troops could have entered France by going through Switzerland. Use what you know about both political and physical geography to explain why it made more sense for them to go through Belgium