Mitosis occurs in living things when a cell divides to produce two cells. Compared to the original cell, how many chromosomes are in each of the resulting cells?
A.The same number
B.Twice as many
C.Half as many
D.An unpredictable number

Answers

Answer 1

A

Explanation:

After mitosis, two identical cells are produced with the same original number of chromosomes of the parent's cell. In this case, if a cell has 24 chromosomes, each daughter cell will have 24 chromosomes after mitosis


Related Questions

Why are packed juices contaminated with yeast

Answers

Answer:

It is because yeast is responsible to fix the carbon dioxide.

Because of o2
Is responsible

what is the difference between sexual and asexual reproduction for plants and animals?​

Answers

Answer:

That is the main difference between sexual and asexual reproduction. Sexual reproduction just means combining genetic material from two parents. Asexual reproduction produces offspring genetically identical to the one parent.

A tropical wet climate exists in the United States only in
1 point
a. Oregon and Washington,
b. Florida.
c. Hawaii.
O d. California.

Answers

Answer:

C. Hawaii

Explanation:

Question: A tropical wet climate exists in the United States only in

a. Oregon and Washington,

b. Florida.

c. Hawaii.

d. California.

The answer you are looking for is C. Hawaii

Ball and socket joints allow bones to move _____.

back and forth
in all directions
across each other
up and down

Answers

Answer:

in all directions

Explanation:

Your shoulder is a ball and socket joint and it can move in all directions as an example.

Answer:

B.) in all directions

Explanation:

Ball-and-socket joints are as the name implies. A ball-shaped end of bone attaches to an indentation on another, the socket. It rotates around in any direction, with an example being the end of your arm that attaches to your torso. This design makes it more mobile than any other type of joint.

When you see wood burning, what evidence do you observe that a
chemical change is happening? Click ALL that apply.

Answers

I feel like 5 is one of the answers

Answer: It's heat given off

Explanation:

You just wrote in the template strand of DNA. Use the template strand to transcribe a strand of mRNA.
Write down the tRNA anti-codons that pair with the mRNA strand.

Answers

Answer: the codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain. The anticodon is the complementary three nucleotide sequence in the appropriate tRNA. Template stand is the DNA strand off which the mRNA is synthesized.

Explanation:

The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.

What is Codons?

The anticodon is the complementary three nucleotide sequence in the appropriate tRNA. Template stand is the DNA strand off which the mRNA is synthesized.

Codons are units of genomic information made up of three nucleotides (trinucleotides) in DNA or RNA that code for a specific amino acid or indicate the end of protein synthesis (stop signals). There are 64 distinct codons, of which 3 serve as stop signals and 61 identify amino acids.

The bases that make up DNA and the associated messenger RNA are called bases. These nucleotides are frequently identified in RNA by the letters A, U, C, and G.

Therefore, The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.

To learn more about codon, refer to the link:

https://brainly.com/question/22991780

#SPJ2

BRAINLIEST:
in which month is a hurricane most likely to occur: October or December? explain

Answers

Answer:

October

Explanation:

October is one of the hurricane season months

In certain rats, black fur is dominant over white fur, If two rats that are both heterozygous for fur colored are mated, what would their offspring be expected to have?

Answers

Answer:

Three different genotypes and two different  colors

Explanation:

Because both rats have heterozygous genes, meaning they have 2 different alleles, ex: "Yy") The offspring can have different genotypes and colors because the parents have heterozygous genes.

hope this helps!

The offsprings of the cross between two heterozygous rats will have the following genotypes: BB (black), Bb (black) and bb (white).

According to this question, a gene coding for fur color in rats is involved. The allele coding for black fur (B) is dominant over the allele for white fur (b).

If two rats that are both heterozygous for fur are crossed i.e. Bb × Bb, gametes B and b will be produced by both rats. Using this gamete in a punnet square (see image), the following offsprings will be produced: BB, Bb and bb.

BB - black offspringBb - black offspringbb - white offspring

Therefore, the offsprings of the cross between two heterozygous rats will have the following genotypes: BB (black), Bb (black) and bb (white).

Learn more at: https://brainly.com/question/3712307?referrer=searchResults

What is the correct DNA base sequence for the following line of DNA:
ATATCGCG

TATAGCGC
O ATATCGCG
O ATCGATCG
O GGCATTAT

Answers

Answer:

I took this a couple weeks ago and the answer is your thrid option I believe.

Hope this helps :))))

Explanation:

A plant cell with 02 M NaCl is
placed in 0.5 M Nacı
solution. Describe the
movement of water and
solutes and justify your
prediction

Answers

Answer:

Water will diffuse into the cell.

Explanation:

As the NaCl conentration in cell is greater then in water so water will diffuses into the cell and NaCl will move out of the cell

Binary fission and mitotic cell division is the same true or false

Answers

Answer:

False

Explanation:

Binary fission is method of asexual reproduction.

Mitotic cell division results in a 2 cell daughter type thing

*not exact words on the Mitotic Cell one*

According to ___________________, processes occur today as they did in the past.

Answers

Answer:

Uniformitarianism

Explanation:

RNA interference (RNAI) is a mechanism of gene regulation in eukaryotes. RNAI is initiated by ____, which leads to the ____ of specific genes.
Box 1:
single-stranded RNA
double-stranded RNA
double-stranded DNA
Box 2:
silencing
induction
expression

Answers

Answer:

double-stranded RNA;  silencing

Explanation:

The RNAi mechanism is a natural process of gene silencing triggered by different small non-coding RNAs such as, for example, siRNAs, miRNAs and piRNAs. RNAi is a powerful technique to induce gene silencing in a sequence-specific manner. The delivery of exogenous double-stranded RNAs (dsRNAs) can be used to induce this evolutionarily conserved mechanism.  The dsRNAs first bind to RNAi core components (Ago, Piwi proteins) and then target complementary mRNAs to induce their degradation.

In guinea pigs the allele for black fur (B) is dominant over the allele for brown fur (b), and the allele for short fur (F) is dominant over the allele for long fur (f). What percentage of the offspring from a BBFF x bbff cross would be expected to be heterozygous for both traits?

Answers

Answer:

100%

Explanation:

This question involves two genes in guinea pigs; one coding for fur color and the other for fur length. The alleles of black fur (B) and short fur (F) is dominant over the alleles for brown fur (b) and long fur (f).

In a cross between two offsprings with genotypes: BBFF x bbff, the following gametes will be produced by each parent:

BBFF - BF, BF, BF, and BF

bbff - bf, bf, bf, bf

Using these gametes in a punnet square (see attached image), one will notice that all of the offsprings will have the genotype: BbFf i.e all or 100% of the offsprings are heterozygous for both of the genes or traits.

The law of universal gravitation applies to all objects in the universe
True
False

Answers

Answer:

Explanation:

yes true the gravitational pull does ap

ply to all objects of the universe

Answer:true

Answer:

true

Explanation:

which process occurs when bacteria converts nitrogen gas to a usable form ​

Answers

Answer:

Fixation

Explanation:

Answer:c

Explanation:fixation

which part of the heart has the thickest walls?

Answers

Answer:

left ventricle. Hope this helps!

Answer:

left ventricle

Explanatation:

The left and right ventricle are similar in structure, the walls of the left ventricle are thicker and stronger.

why is cell called the fundamental unit of life ​

Answers

Answer:

Cell is called the Fundamental Unit of Life Because all basic metabolism activity starts from the cell. Inside the cell, energy is produced , food is stored and many more activities take place

it is structural and functional unit of living beings

it includes all the activities of cells

it is there in each and every life process

Explanation:The cell is called the structural and functional unit of life as all living organisms are made up of cells. ... Furthermore, cells provide form and structure, process nutrients and convert it into useable energy. Multicellular organisms have specialized cells that perform specific functions.

Which of the following is outer covering of human heart?
1.Pericardium
2.Myocardium
3.Endocardium
4.None of them.
5.Other:​

Answers

Answer:

pericardium is outer covering layer of heart. pericardium is double layered membrane.

Explanation:

Answer:

2. Myocardium yan po

I'm not sure

which part of a plant is necessary for photosynthesis​

Answers

Answer:

Chloroplasts

Explanation:

Answer:

chloroplasts........

What binomial nomenclature? A two-word name for organisms where the first word is the family and the second word is the species
A two-word name for organisms where the word is the genus and the second word is the species
A two-word name for organisms where the first is the genus and the second word is the class
A two-word name for organisms where the first word is the species and the second word is the genus

Answers

Answer:

A two-word name for organisms where the word is the genus and the second word is the species

Explanation:

Binomial nomenclature is the system biologists use to name species of living beings. When we translate this term, we get the two-name naming system. This tells us a lot about how species are named - their name consists of two components. The first component is the name of the genus the species belongs to and the second is the name of the species. For example, the scientific name used for cats is Felis catus. Felis is the genus and the species is catus.

Please help me in my homework (keep it simple,i couldnt find Science ;-; I am sorry) What is environment? What are three main aspect of environment? 2)Write down any four importance of environment.

Answers

Answer: It is then the space in which the life of living beings and the interaction between them and other things takes place. It is made up of living organisms, abiotic elements and artificial elements. It includes physical, chemical and biological components of the organisms and elements that form it. It is important because it is the place of habitat of humanity, it provides natural elements such as water and food, it provides fuels and raw materials that serve to manufacture artificial things and it contributes to the sustainability of life on the planet.

Explanation:

The environment is a system made up of living organisms (such as animal and plants), abiotic elements (lifeless, such as stones or water) and artificial elements (created by man, such as buildings) that are related to each other and can be modified by human action. It is then the space in which the life of living beings and the interaction between them takes place.

It includes physical, chemical and biological components of the organisms and elements that form it. That is, how is its composition and its function in the environment.

The importance of the environment lies in:

It is the place of habitat of humanity, so it influences the life of human beings and future generations. It is the space where life develops at this time with all living beings and their natural components.It provides natural elements such as water and food since it offers all its natural resources needed by the human being. It provides fuels and raw materials that serve to manufacture the artificial things we use daily, to build houses, have light, transport, among many other benefits to exist. In the environment we find a great biological diversity of plants and animals that help maintain the ecological balance of the earth. This contributes directly to the sustainability of life on the planet. Each organism has a unique role to play.

Therefore, all societies must guarantee their care for their existence and make rational use of all their resources.

3.
Which of the following does NOT occur during cytokinesis of animal cells?

Answers

Answer:

A cell plate forms.

Hope I was able to help! ♡♡

Unlike fat, protein contains:
1)Carbon
2)Oxygen
3) Nitrogen
4) Hydrogen
HELPP PLEASE!!!!

Answers

Answer:

Nitrogen

Explanation:

Hope this helps :)

Answer:

C. Nitrogen

Explanation:

Fat contains Carbon, Oxygen, and Hydrogen, like protein. However, protein also contains Nitrogen which fat does not.

Hope this helped. :)

The Pacific plate collides with and is subducted under four other crustal plates. The area where this happens has lots of
volcanic activity. This area is called the
Ring of Volcanoes
Bermuda Triangle
Ring of Fire
Ring of Heat

Answers

Answer:

Ring of fire

Explanation:

what dose cloraplast do​

Answers

n particular, organelles called chloroplasts allow plants to capture the energy of the Sun in energy-rich molecules; cell walls allow plants to have rigid structures as varied as wood trunks and supple leaves; and vacuoles allow plant cells to change size.

Answer:

Chloroplasts are a plant cell organelles and help. plants capture the energy of the sun.

Explanation:

they convert light energy to the sun relatively stable chemical energy via the photosynthetic process. By doing so, they sustain life on Earth

What is crossing over in meiosis and how does it ensure genetic diversity?

Answers

Answer:

When homologous chromosomes form pairs during prophase I of meiosis I, crossing-over can occur. Crossing-over is the exchange of genetic material between homologous chromosomes. It results in new combinations of genes on each chromosome. ... It is obviously another source of genetic variation in offspring.

Explanation:

i looked it up on google

The phylum Nematoda includes the flatworms.
a. true
b. false

Answers

false i believe!!! hope this helpedb

Answer:

False

Explanation:

which organelle packages materials and distributes them throughout the cell?
A: Lysosome
B: Chloroplast
C: Golgi Body
D: Cell membrane

Answers

Answer:

C: Golgi Body

Explanation:

I know this for sure

Answer:

Golgi body

Explanation:

A Golgi body, also known as a Golgi apparatus, is a cell organelle that helps process and package proteins and lipid molecules, especially proteins destined to be exported from the cell. Named after its discoverer, Camillo Golgi, the Golgi body appears as a series of stacked membranes.

PLEASE HELP ME!!!


3) Describe a eukaryotic cell. Your description should include where you would expect to
find these types of cells.

4)Describe a prokaryotic cell. Your description should include where you would expect to
find these types of cells.

Answers

3)Eukaryotic cells have membrane-bound organelles. They have a nucleus. They are usually found in animals and plants. In all multicellular organisms and some unicellular(amoeba)

4)Prokaryotic cells don't have a nucleus. They don't contain membrane-bound organelles they only contain ribosomes.They are much smaller. Bacteria are prokaryotes.

Other Questions
what is 5 1/3 as an improper fraction?? Solve for x.And please show me how u got the answer 9124x - 2)3x + 2 Comparing FunctionsHow much money will Bob in December have if his bank account growth stays at the same rate?Month Bank-Acc |January | $5,000February $6,700March $8,400April $10,100May $11,800 Which country closed its ports to farmers?A. SpainB. FranceC. England Can you help me plz? Write an equation in point-slope form for the line through the given point with the given slope(8,-3);m= -1/4 a drum has a diameter of 18 in and is 16 in deep find the volume What is the special rule with multiplying or dividing an equality by a negative number? (Im in a rush to get this answered,Im taking a test) What was one effect of the State Colonization Law of 1825?A. Mexico gained its independence from Spain.B. San Antonios population reached 20,000.C. Slavery was banned in Texas.D. The Old Three Hundred were recruited to settle Texas. please help me I don't answer this I'll give brilliance What is the graph of the linear function that is represented by the equation y= 1/2x-2 25 POINTS AND BRAINLIEST!! Clay wants to ride a Ferris wheel that has a radius of 80 feet and is suspended 9 feet above the ground. The wheel makes 6 revolutions in one minute. Find the period and amplitude. Read the following excerpt from "Woman Who Helped Hide Anne Frank Dies at 100" by Teri Schultz.Ms. MIEP GIES: I, myself, I'm just a very common person. I simply had no choice. I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks. And this was not the kind of life I was looking for at all. SCHULTZ: Gies explained another motivation for emphasizing her modesty. She said if people are allowed to think it takes remarkable qualities to act boldly on behalf of others, few will attempt it. Ms. GIES: People should never think that you have to be a very special person to help those who need you.Which detail best illustrates Miep Giess purpose in this excerpt?People should never think that you have to be a very special person to help those who need you.I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks.And this was not the kind of life I was looking for at all. Gies explained another motivation for emphasizing her modesty. At a meeting of musicians, 56 of the musicians play the piano but only 35 play the violin. What is the minimum number of people at the meeting who play both piano and violin? |-10| divided by 2 x |5| The graph of the equation x + 3y = 6intersects the y-axis at the point whosecoordinates are: (Find the y intercept)which answer?(0,2)(0,6)(0,18)(6,0) How many men did it take to capture Antigonea. 2b. 5c. 1d. 7 Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC Jake walks to town every fifth day. Sam rides his bike to town every fourth day. What is the first day they are likely to meet in town? Why do numA and numB have the same scope in the subtract function? def subtract(numA, numB): return numA - numB def divide(numC, numD): return numC / numD answer = subtract(24,6) print (answer)