Answers
1. The other complementary strand of this DNA strand will be:
TAATTTGCTAGGTAGCGTCCA
2. TAA TTT GCT AGG TAG CGT CCA
The amino acid sequence of this strand will be: Stop codon, Phenylalanine, Alanine, Arginine, Stop codon, Arginine, Proline.
3. There are 7 codons in this gene.
4. There are 7 amino acids in this protein.
What are amino acids?Special chemical compounds known as amino acids are used by living things to build proteins. Nitrogen, oxygen, hydrogen, and carbon make up the majority of the elements in amino acids. Twenty distinct types of amino acids are used in the creation of proteins in our body. Some amino acids are actually made by our bodies, while the rest must come from diet.Transcription is the first stage of protein synthesis. At this point, the cell copies (or "transcribes") the DNA. Because it makes use of ribonucleic acid, a different kind of nucleic acid, the copy of DNA is known as RNA. The next procedure is known as translation, and it makes use of RNA.Translation is the following stage in the production of a protein. This is the process by which the RNA is changed (or "translated") into a series of amino acids that constitutes the protein.A complicated mechanism in the cell called the ribosome performs the translation process, which creates the new protein from the RNA instructions.To learn more about Amino acids, refer to:
https://brainly.com/question/14583479
#SPJ13
Related Questions
Glucose is processed via glycolysis, pyruvate oxidation, and the citric acid cycle. What is left of the original glucose molecule when this processing is complete?.
Answers
2 molecules of carbondioxide [[tex]CO_{2}[/tex]] is left of the original glucose molecule after glycolysis, pyruvate oxidation and citric acid cycle
Glycolytic pathway is a series of reactions that break down glucose into pyruvate and energy in the form of ATP.
2 molecules each of pyruvate and ATP are released at the end of glycolysis
During the pyruvate oxidation, pyruvate produced from glycolysis is converted to Acetyl CoA which is further broken down to produce 2 molecules of Carbondioxide and 3 molecules of NADP during Citric Acid Cycle
Citric acid cycle is also known as Kreb's cycle
Read more
https://brainly.com/question/13829791
#SPJ4
doctors use radioactive iodine as a tracer in diagnosing certain thyroid gland disorders. this type of iodine decays in such a way that the mass remaining after t days is given by the function m(t)
Answers
The initial mass of iodine decay after t days is 6 g
How much of the mass remains after 20 days is 1.053 g
Here's the complete question:
Doctors use radioactive iodine as a tracer in diagnosing certain thyroid gland disorders. This type of iodine decays in such a way that the mass remaining after
m(t) = 6e−0.087t
where m(t) is measured in grams.
a) Find the initial mass (mass at time t = 0).
b) How much of the mass remains after 20 days?
a) Find the initial mass (mass at time t = 0).
m(t) = 6e-0.087t
The unit t is assume to be in days.
m(0) = 6e⁰ g = 6 g
b) How much of the mass remains after 20 days?
Using the equation
m(x) = ne⁻⁰°⁰⁸⁷⁽²⁰⁾
m(20) = 6e⁻⁰°⁰⁸⁷⁽²⁰⁾ g ≅ 1.053 g
Learn more of mass of iodine decay from:
https://brainly.com/question/14135655?referrer=searchResults
#SPJ4
1. Chemical properties describe how a substance changes Trure Or False
Answers
Answer:
False
Example:
Only the physical properties like shape, size, appearance etc., are changed. Hence the given statement is false.
Answer:
server timed out. unable to load this answer. try again later
in the green alga chlamydomonas spp. the zygote divides only by meiosis, never by mitosis. haploid cells undergo mitotic divisions. this is an example of
Answers
The division of Chlamydomonas cell by meiosis and mitosis is an example of sexual and Asexual reproduction respectively
Chlamydomonas is a genus of green algae that are mostly found in ponds, freshwater lakes etc.
THEY used to be claasifeied as a protist but are generall regarded as plants
Chlamydomonas undergo both asexual, which can occur at any time and sexual reproduction that can only occur in favorable conditions
They reproduce asexually by a process known as mitosis is the division of one cell into daughter cells. each cell is genetically identical
During sexual reproduction, a single cell divides to produce four daughter cells through a process known as meiosis
Read more about mitosis and meiosis
https://brainly.ph/question/2441677
#SPJ4
What is the function of carbon dioxide in the atmosphere?
Answers
Answer:
To warm up the Earth.
Explanation:
Carbon dioxide in the atmosphere warms the planet causing climate change.
PLEASE GIVE ANSWER
The given diagram describes the Calvin cycle of photosynthesis. Where does the NADPH come from?
Answers
Answer:
Light-dependent reactions harness energy from the sun to produce ATP and NADPH so Light Reactions
Technology has advanced to be able to create artifical body parts (vital organs, blood, etc). At what point do we stop being human and are considered machine?
Answers
Answer:
The point at which you are no longer human is subjective to yourself.
Explanation:
If you replace the broken parts of a ship over decades and decades as it slowly breaks down, you don't ever have a completely different ship, even after all the parts have been replaced. Fixing something thats broken doesn't detract from what it was originally.
Why do some plants remove water from their cells to reduce the amount of water that freezes inside them during winter?
a. The frozen water constricts organelles and causes plant cells to shrink.
b. As water contracts during freezing, the cells pull away from each other causing damage.
c. Less water in the cells means the cells are smaller and need to do less work.
d. The expansion of water as it turns to ice inside the cells would break the cells apart.
Answers
Answer:
b. As water contract during freezing the cells pull away from each other causing damage
[tex]\Large \boxed{\sf D}[/tex]
The cells would split apart due to the expansion of extra water when it freezes inside them. The liquid inside the cells can freeze and expand when the temperature drops below 0°C. The crop becomes unproductive as a result of the cells breaking.
9. Is oxygen necessary for the production of ATP in your
cells? Why or why not?
Answers
Answer:
ATP production depends upon respiration
oxygen requirement depends on the type of respiration (aerobic or anaerobic) the cell does.
Explanation:
for anaerobic --->no oxygen is required e.g.red blood cells do not respire aerobically, only glycolysis produces ATP are utilized
for aerobic ----->oxygen is required.e.gliver cell
2. Congratulations! You are in charge of the world. List the three most important components of your strategy for dealing with urban
growth and sustainability in (a) developed countries and (b) developing countries.
Answers
Being in charge of the world , the three most important components of my strategy for dealing with sustainability would be completely different for developed and developing country.
What is sustainable development and how can it be achieved in developed and developing country ?See in today's world if something really is necessary then it is sustainable development , which needs to be approached and installed .Sustainable development is the development of the work along with taking proper care of natural environment.Dealing with these issues would be a different handling operation for developing country and developed country .In the context the statistical data shows that achieving sustainable development in developing country is far more difficult than doing it over developed country.To know more about sustainable development visit:
https://brainly.com/question/17411145
#SPJ13
dissimilatory reactions are so named . . . choose one:a. because the enzymes performing these reactions are not similar to any other enzymes.b. to distinguish them from reactions that will assimilate molecules into organic biomass of the organism.c. because they cause the oxidation of nitrogen.d. because ""dissimilatory"" is a synonym of ""assimilatory.""
Answers
The correct option is B.
To distinguish them from reactions that will assimilate molecules into the organic biomass of the organism.
The defining characteristic of sulfate-reducing prokaryotes is dissimilatory sulfate reduction (SRP). SRPs are known to play significant roles in the carbon and sulfur cycles in their primary environments, sulfate-rich marine sediments. Strictly anaerobic sulfate-reducing bacteria and archaea, which must create sulfite as an essential step, use dissimilatory sulfate reduction to conserve energy (pathway 2 in Fig. 2.2). Sulfate-reducing microorganisms are the names given to all of these cells (SRMs).
SRP plays a number of crucial biotechnological roles, including the treatment of wastewater and off-gas, bioremediation of hydrocarbons and metals, and bioelectrochemistry. However, SRP can also have undesirable effects, including the souring of oil reservoirs and other environments and the corrosion of iron and concrete.
Learn to know more about the dissimilatory reaction on
https://brainly.com/question/28557875
#SPJ9
after two cycles of pcr, how many double-stranded dna molecules correspond exactly to the desired product of amplification (i.e. have both strands the correct length)?
Answers
After two cycles of PCR, 4 copies of double-stranded DNA molecules correspond exactly to the desired product of amplification.
What is PCR?The polymerase chain reaction (PCR) is a technique that is frequently used to quickly create millions to billions of copies (complete or partial) of a specific DNA sample. This technique enables researchers to take a very small DNA sample and amplify it (or a portion of it) to a large enough quantity to study in detail. The PCR method of DNA manipulation was created in 1983 by American biochemist Kary Mullis at Cetus Corporation. Mullis and biochemist Michael Smith, who had created other crucial techniques for DNA manipulation, shared the 1993 Nobel Prize in Chemistry.
To learn more about PCR with the help of given link:
https://brainly.com/question/11417541
#SPJ9
estrogens are small hydrophobic lipid hormones that promote cell division and the development of reproductive structures in mammals. estrogens passively diffuse across the plasma membrane and bind to their receptor proteins in the cytoplasm of target cells. (a) describe one characteristic of the plasma membrane that allows estrogens to passively cross the membrane. (b) in a laboratory experiment, a researcher generates antibodies that bind to purified estrogen receptors extracted from cells. the researcher uses the antibodies in an attempt to treat estrogen-dependent cancers but finds that the treatment is ineffective. explain the ineffectiveness of the antibodies for treating estrogen-dependent cancers.
Answers
Estrogen exists nonpolar and can pass through the plasma membrane. Large proteins comprehended as antibodies exist incapable to enter cells. Intracellular estrogen receptors exist not bindable by extracellular antibodies.
What is meant by plasma membrane?The cell membrane has the quality of being permeable; some substances can pass through it naturally while others cannot. While ions and fat molecules like proteins and carbohydrates are blocked channel, small and nonpolar molecules can readily get through the membrane. Because estrogens are soluble in fat, they can pierce cell membranes by confusing the steroid hormone receptor.
Because estrogens are very hydrophobic, they can passively diffuse through cellular membranes and can also be concentrated in cellular membranes.
(a) Because it is nonpolar, estrogen can cross the plasma membrane.
(b) Large proteins known as antibodies are unable to enter cells. Intracellular estrogen receptors are not bindable by extracellular antibodies.
To learn more about plasma membrane refer to:
https://brainly.com/question/734740
#SPJ9
On average day the trillions of cell in human body perform many chemical processes. which form of energy do those processes use directly?
sunlight
ATP
glucose
glycogen
Answers
Since on average day the trillions of cell in human body carry out many chemical processes. The form of energy do those processes use directly is option B: ATP.
How does your body get energy from ATP?By adding a phosphate group to another molecule, ATP can drive biological operations (a process called phosphorylation). Special enzymes are responsible for carrying out this transfer, which connects the cellular processes that need energy to the release of energy from ATP.
Note that since ATP is produced in the human body, the majority of ATP synthesis takes place during cellular respiration within the mitochondrial matrix, producing about 32 ATP molecules for each oxidized glucose molecule.
Learn more about ATP from
https://brainly.com/question/897553
#SPJ1
In a culture of bacteria, there are some individuals that are unable to synthesize histidine. What is the best and most likely description of how these individuals differ from the other bacteria in the culture?.
Answers
In a culture of bacteria, individuals that are unable to synthesize histidine differ in their genotype and in their phenotype compared to other bacteria.
In a culture of bacteria, individuals that are unable to synthesize histidine differ in their genotype and in their phenotype compared to other bacteria.
Lower eukaryotes, plants, lower bacteria, and archaea all contain the old metabolic pathway that generates histidine. The majority of histidine biosynthesis research has been concentrated on Escherichia coli and Salmonella typhimurium, uncovering fundamental regulatory mechanisms in bacteria. An organism's observable attributes or characteristics are referred to as its phenotype, whereas the genetic information passed down through generations is known as its genotype. Bacteria that synthesize histidine do so because of their physical characteristics and genetic makeup, as opposed to bacteria that do not because of those same characteristics and genetic makeup.
To learn more about the culture of bacteria. Click, https://brainly.com/question/15605943
#SPJ4
Algal blooms, and the rapid proliferation of photosynthetic plankton can ultimately end up depleting all the oxygen from a body of water.
Please select the best answer from the choices provided
T
F
Answers
It is true that algal blooms, and the rapid proliferation of photosynthetic plankton can ultimately end up depleting all the oxygen from a body of water.
What is algal bloom?Algal bloom is the dense spread of algae on the surface of water. Algal bloom is caused by a process called eutrophication.
Eutrophication is the ecosystem's response to the addition of artificial or natural nutrients, mainly phosphates, through detergents, fertilizers, or sewage, to an aquatic system.
The proliferation of algal species will result in the increase in the number of decomposers such as bacteria when the algae die. This decomposers will make use of oxygen excessively causing a decline.
Learn more about algal bloom at: https://brainly.com/question/23831165
#SPJ1
Answer: its TRUE
Explanation: I got a 100% on the test
What is the major function of the endomembrane system? question 2 options: producing and storing energy manufacturing proteins directing the cell's activities transporting substances in a cell
Answers
The major function of the endomembrane system is transporting substances in a cell .
Endomembrane system in eukaryotic cells refers to the collection of membranes found inside the cytoplasm that work as a unified developmental and functional unit.
With the aid of vesicle transport, the membranes are either directly or indirectly coupled and exchange material.
This system's primary job is to transport, pack, and alter proteins and lipids into and out of the cell.
The Golgi apparatus, lysosomes, nuclear membrane, endoplasmic reticulum, and vesicles are the principal organelles that make up the endomembrane system.
To know more about endomembrane system visit the link:
https://brainly.com/question/13228109?referrer=searchResults
#SPJ9
When listing levels of organization in organisms from least to most complex to most complex which level is just organs in complexcity
Answers
In levels of organization in organisms from least to most complex the level which is just below organs in complexicity is Tissue and is denoted as option D.
What is Level of organization?This is referred to as the hierarchy of complex biological structures and the cell which is the simplest unit of life is the least complex in the level of organisation of organisms.
The most complex is referred to as the organ system which comprises of the aggregation of organs present in the body. The level which is below organs in complexicity is the Tissue which is formed from the aggregation of cells in the body which have similar structures and functions so as to achieve a common goal.
This is therefore the reason why option D was chosen as the most appropriate choice.
Read more about Level of organization here https://brainly.com/question/8824615
#SPJ1
The full question is:
When listing the levels of organization in organisms from least complex to most complex, which level is just below organs in complexity? cell organism organ system tissue
coat color in timber wolves ranges from white to gray to black. in forests and grasslands, shades of gray fur blend in with the vegetation better than white or black fur. white‑ or black‑furred individuals are sometimes driven out of their packs and are rarely allowed to mate. as a result, the majority of wolves have gray fur.
Answers
Coat color in timber wolves ranges from white to gray to black. in forests and grasslands, shades of gray fur blend in with the vegetation better than white or black fur. white‑ or black‑furred individuals are sometimes driven out of their packs and are rarely allowed to mate. as a result, the majority of wolves have gray fur. Stabilizing selection has taken place in this population.
Disruptive selection's opposite is stabilizing selection. It prefers the intermediate variants rather than people with extreme traits. The more severe phenotypes are typically eliminated by stabilizing selection, which increases the reproductive success of the typical or average phenotypes.
Stabilizing Choice The population undergoes stabilizing selection when selective pressures choose between two extremes of a trait. For instance, stabilizing selection may have an impact on plant height. If a plant is too short, it might not be able to compete for sunlight with other plants.
Learn more about Stabilizing Choices:
https://brainly.com/question/8563440
#SPJ4
Which of these is an agent of wedging?
A. Plant roots
B. Acid rain
C. Carbon dioxide
D. High winds
Answers
option B: Acid rain is an agent of wedging.
Acid rain is an important factor in this process of weathering or wedging of rocks. A chemical reaction takes place when acidic rainfall contacts limestone or chalk. The reaction produces new, soluble molecules. These disintegrate in the water, are washed away, and cause the rock to weather.
What is wedging in science?
When fractures in rocks or other surfaces fill with water, freeze, and then expand, the cracks become larger and finally shatter. This process is known as wedging or weathering.
What results in acid rain?
When sulfur dioxide (SO2) and nitrogen oxides (NOX) are released into the atmosphere and carried by wind and air currents, it results in acid rain. Nitric and sulfuric acids are created when the SO2 and NOX react with water, oxygen, and other substances. Then, before hitting the ground, they combine with water and other substances.
The majority of the SO2 and NOX that contribute to acid rain originates from burning fossil fuels, however a tiny amount comes from natural sources like volcanoes.
To know more about acid rain visit:
https://brainly.com/question/718250
#SPJ9
mendel found that a cross between true-breeding pea plants, one with violet flowers and one with white flowers, produced all violet flowers in the first generation. violet flower color is a trait.
Answers
Violet flower color is a dominant trait.
In a pea plant, white flowers with genotype vv and violet flowers with genotype VV are crossed. The V allele is the dominant one. The gametes that are produced are V and v. Vv will therefore be created following their fertilization in the F1 generation. Due to V (violet) being dominant to v (white), Violet will be the phenotype in a heterozygous state.
According to Mendel law of dominance in the crossing of parents, which is true for a particular trait, only one trait will be expressed in the phenotype. But among hybrid parents, the offspring exhibits the dominant characteristic. So, here also violet flowers are observed in F1 generation which shows the dominant character of violet flowers.
To know more about Mendel experiment: https://brainly.com/question/28546354
#SPJ4
What happens to the brain during creative thinking?
Answers
Answer:
i know that creative thinking involves the interplay of the brain's default and executive control networks, and that these connections allow us to spontaneously generate ideas and critically evaluate them, respectively.Jan 1, 2020
Explanation:
When u sit an egg in water where does the water go and why
Answers
List the energy saving adaptations that help aquatic amphibians manage the challenges of living in a dilute environment as efficiently as possible.
Answers
The majority of aquatic amphibians have a short Loop of Henle, which lessens mineral and water absorption. Water thus enters the kidney tubules directly.
Ammonia a safe waste product for amphibians :Ammonia is simple to excrete because it is small and easily diffuses through cell membranes. In essence, there is a trade-off between easy excretion and levels of toxicity. Due to the abundance of water available to diluted ammonia wastes, toxicity is minimal for aquatic animals.
How amphibians release their waste product ?The two kidneys in amphibians, like those in humans, filter waste from the bloodstream and combine it with water to form urine. The ureters transport urine from the kidneys to the bladder before it leaves the body through the cloaca.
To know more about amphibians :
https://brainly.com/question/13744586
#SPJ9
Helppppp this is due in 56 minutes
Answers
The image depicts erosion, specifically soil erosion. Soil erosion is the gradual deterioration of soil caused by the impact of water or wind on soil particles.
What are the consequences of soil erosion?Soil erosion refers to the denudation of the upper layer of soil. It is a form of soil degradation. This natural process is caused by the dynamic activity of erosive agents such as water, ice (glaciers), snow, air (wind), plants, and animals.Subsoil exposure, which frequently has poor physical and chemical properties. Higher runoff rates, shedding water and nutrients that would otherwise be used for crop growth crop failure in newly planted crops.Low-lying areas have silt deposits.Ways to prevent soil erosion :
Change your tillage practices. Soil tillage (digging, stirring, and overturning) is one of the most common methods of preparing land for crop cultivation.Keep an eye out for overgrazing.Think about terracing steep slopes.Create a buffer strip.To learn more about soil erosion refer to :
https://brainly.com/question/17905503
#SPJ13
If a serving of this food is 29 grams, what percentage of the food is made up of carbohydrates?
Answers
Answer: It depend on what you eat. For example, Dietary fibers are complex carbohydrates, so some people estimate that they provide 4 calories per gram just like any other carbohydrate
Explanation:
Which event results in a change in the number of chromosomes in a cell?
A. crossing over
B. deletion
C. insertion
D. nondisjunction
Answers
janet has joined the yoga class at her new university. she is surprised at the difficulty of some of the poses. many of the poses involve stretching her limbs as far as possible but still maintain muscle tone in the extended limb. on which property of muscle tissue do these yoga poses rely? check all that apply.
Answers
Janet has joined the yoga class at her new university. she is surprised at the difficulty of some of the poses. many of the poses involve stretching her limbs as far as possible but still maintain muscle tone in the extended limb. The fact that all of these—excitability, contraction, pretty extensive bility, and elasticity—are the unique qualities displayed by muscles—would therefore be the correct selection in this case.
What do you mean by muscle in human body?
The human body has roughly 600 muscles. In addition to aiding movement and pumping blood, muscles can also be used to lift heavy objects or give birth. Movement is produced by muscles either contracting or relaxing. This motion may be intentional (i.e., made voluntarily and consciously) or it may be unconscious (involuntary).
Our muscles are fuelled by glucose from the carbs in our diet. Muscle tissue also requires specific minerals, electrolytes, and other dietary components including calcium, magnesium, potassium, and salt to function effectively.
There are muscles that have unique capacities for elasticity, X. Sensitivity, contractibility, and excitability. Additionally, they can be categorised based on a variety of factors, including their location, appearance, and method of activity regulation. Skeletal muscles are one of three different types of muscles. There are many muscles, including heart muscles.
Hence The fact that all of these—excitability, contraction, pretty extensive bility, and elasticity—are the unique qualities displayed by muscles—would therefore be the correct selection in this case.
To learn more about Muscle from the given link
https://brainly.com/question/13920046
#SPJ9
what is not the function of a nuclues
Answers
Answer:
To provide shape and rigidity to the cells.
OR
To transfer traits from parents to offspring in the form of genes.
Explanation:
What can you do to take CO2 from the atmosphere?
Answers
Answer:
The first is by enhancing carbon storage in natural ecosystems, such as planting more forests or storing more carbon in soil.
Explanation: