ng
he
34. The dimensions of Dawn's porch are shown.
Dawn's Porch
6 feet
A
B
6 feet
A. 32
2 feet
11 feet
What is the area, in square feet, of Dawn's porch?
B. 42
2 feet
C. 46
D. 50

Nghe34. The Dimensions Of Dawn's Porch Are Shown.Dawn's Porch6 FeetAB6 FeetA. 322 Feet11 FeetWhat Is

Answers

Answer 1

Answer:

[tex]the \: answer \: for \: the \: question \: is \: 50[/tex]


Related Questions

PLEASE HELP WILL GIVE BRAINLEST FOR CORRECT ANSWER ONLY !!

Answers

Answer:

Option A is the correct choice that shows a function.

Step-by-step explanation:

What is a function?

A function is when there are no repeating "x" values.

For example:

These set of points: {(1,1), (1,2), (1,3), (1,4)} does not  show a function because there is repeating "x" values.

Option A shows that the points {(4,5), (5,5), (6,1), (8,2) is a function because there is no repeating "x" values.

Answer is option A is a function

Explanation

A function from x to y will have one output (y) for every input (x)

✅ Option A has one output for each input

❌ Option B - input of 4 has output of 0 and 5 so it is not a function

❌ Option C - input of 2 has output of 3 and 6 so it is not a function

❌ Option D - input of 5 has output of 2 and 7 so it is not a function

See attachment

Help now quickly will give brainlist

Answers

Answer:

x = - 12

Step-by-step explanation:

the central angle subtended by the arc with measure 45° are congruent, that is central angle is 45°

the 3 angles on the diameter then sum to 180° , that is

45 + 65 + x + 82 = 180

x + 192 = 180 ( subtract 192 from both sides )

x = - 12

Can you explain why you need to multiply x and y (and not add x and y) when you are adding
logarithms?

Answers

The exponent by which base b must be raised to get a positive real number an is the logarithm of a positive real number a with regard to base b, a positive actual number that is not exactly one.

What is a logarithm?

A logarithm is the power to which a number must be raised in order to receive extra values. The simplest approach to express really large numbers is in this way. A number of important features of a logarithm demonstrate the fact that multiplication and division of logarithms can also be used to represent addition and subtraction logarithms.

The exponent by which base b must be raised to get a positive real number an is the logarithm of a positive real number a with regard to base b, a real number that is positive but not equal to one.

i.e., [tex]b^y=a[/tex] ⇔ [tex]log_b[/tex] a = y

In this case, "A" and "B" are two positive real numbers.

Y is an actual number.

Argument occurs inside the log as "a" by the name argument.

It is said that the base, or "b," is at the bottom of the log.

To put it another way, the logarithm provides a solution to the problem of "How many times is a number divided to get the other number?"

How numerous times must three be multiplied, for instance, to yield the number 27?

27 is the outcome of multiplying 3 times by 3.

Consequently, the logarithm is 3.

The logarithm form is written as follows:

[tex]log_3[/tex] (27) = 3 - equation 1

The base 3 logarithm of 27 is therefore 3.

It is also possible to write the above logarithm form as:

3x3x3 = 27

3³ = 27 - equation 2

Equations (1) and (2) are hence equivalent.

To know more about logarithms, visit:

brainly.com/question/9832815

#SPJ1

Select the statement that is not true.

A. The translation of a line is a pair
of parallel lines.

B. The rotation of a pair of parallel lines is a pair of parallel lines.

C. The reflection of a line is a line.

D. The rotation of a line is a line.

Answers



Answer: B. The rotation of a pair of parallel lines is a pair of parallel lines.

Explanation: A translation of a line is a displacement of the line, or a transformation which moves all points of the line, without changing its shape or orientation. This means that a pair of parallel lines will remain parallel after a translation.

A rotation of a line is a transformation in which all points of the line are rotated around a pivot point, and the line will change its orientation.

A reflection of a line is a transformation in which all points of the line are reflected across a single axis. This means that a line will remain a line after a reflection.

Therefore, the statement that is not true is B. The rotation of a pair of parallel lines is a pair of parallel lines.

Estimate, correct to three decimal places, all the zeros of the following polynomials. (Enter your answers as comma-separated lists.)

(a) P(x) = 4x³5x² - 2x + 1
X=

(b) P(x) = 5x³+x² - 7x-2
X=

(c) P(x) = 2x³-6x² - 5x + 4
X=

(d) P(x)=x² - 4x³ + 5x - 1
X=

Answers

(a) P(x) = 4x³ + 5x² - 2x + 1
The zeros of P(x) are approximately -1.160, -0.086, and 0.246.

(b) P(x) = 5x³ + x² - 7x - 2
The zeros of P(x) are approximately -1.518, -0.471, and 0.660.

(c) P(x) = 2x³ - 6x² - 5x + 4
The zeros of P(x) are approximately -1.343, 0.515, and 1.828.

(d) P(x) = x² - 4x³ + 5x - 1
The zeros of P(x) are approximately -0.408 and 1.225.

Simplify
Write your answer with positive exponents only.

Answers

The simplified exponential expression for this problem is given as follows:

xy^7/z^(14).

How to simplify the exponential expression?

The first step in simplifying the exponential expression is applying the power of power rule at the numerator, as follows:

(y² x z^-5)² = y^4z^(-10).

(for the power of power rule, we keep the bases and add the exponents).

When two terms with the same base and different exponents are divided, we keep the base and subtract the exponents, hence the exponents are given as follows:

x: -1 - (-2) = -1 + 2 = 1.y = 4 - (-3) = 7.z = -10 - 4 = -14.

The negative exponent means that the number appears in the denominator, hence the simplified expression is given as follows:

xy^7/z^(14).

More can be learned about exponent rules at https://brainly.com/question/11975096

#SPJ1

The simplified exponential expression for this problem is given as follows:

xy^7/z^(14).

How to simplify the exponential expression?

The first step in simplifying the exponential expression is applying the power of power rule at the numerator, as follows:

(y² x z^-5)² = y^4z^(-10).

(for the power of power rule, we keep the bases and add the exponents).

When two terms with the same base and different exponents are divided, we keep the base and subtract the exponents, hence the exponents are given as follows:

x: -1 - (-2) = -1 + 2 = 1.y = 4 - (-3) = 7.z = -10 - 4 = -14.

The negative exponent means that the number appears in the denominator, hence the simplified expression is given as follows:

xy^7/z^(14).

More can be learned about exponent rules at https://brainly.com/question/11975096

#SPJ1

What are the values of w and x?

Answers

The angle measures of w and x are given as follows:

w = 51º.x = 78º.

How to obtain the angle measures?

In this problem we have an isosceles triangle, meaning that two of the side lengths, along with two of the angle measures, are congruent.

The congruent side lengths are given as follows:

SR and RQ.

Hence the congruent angle measures are given as follows:

w -> opposite to SR.51º -> opposite to RT.

Hence angle w is given as follows:

w = 51º.

The sum of the measures of the internal angles of a triangle is of 180º, hence the measure of angle x is given as follows:

x + 2 x 51 = 180

x = 180 - 102

x = 78º.

More can be learned about angle measures at https://brainly.com/question/25716982

#SPJ1

Help on Part A and B​

Answers

Answer:

The Correct answer is B

Step-by-step explanation:

The answer is option b

Janeesa lives 247.5 miles away from her grandmother, and the speed limit on that stretch of
highway is 55 miles per hour. Today, she only has 4 hours to get to her grandmother's birthday
lunch on time!
How much faster over the speed limit does Janeesa need to drive to make it on time? Round to the
tenths place if your answer isn't a whole number.
mph.

Answers

To find out how fast Janeesa needs to drive to make it on time, we can use the formula:

distance = rate x time

In this case, the distance is 247.5 miles, the time is 4 hours, and the rate is what we're trying to find. Rearranging the formula to solve for rate, we get:

rate = distance / time

Plugging in the values we know, we get:

rate = 247.5 / 4 = 61.875

So Janeesa needs to travel at an average speed of 61.875 miles per hour to make it to her grandmother's birthday lunch on time. Since the speed limit is 55 miles per hour, she would need to drive 6.875 miles per hour faster than the speed limit. Rounding to the tenths place, that's about 6.9 miles per hour over the speed limit. However, it's important to remember that speeding is dangerous and can result in serious accidents. It's always better to leave earlier and plan ahead to avoid the need to speed.

Janeesa needs to drive about 6.9 mph faster than the speed limit to make it on time.

What is the  speed limit

To find out how fast Janeesa needs to drive to make it on time, one can use the formula:

distance = rate x time

In this case, the distance is 247.5 miles, the time is 4 hours, and the rate is what we're trying to find. Rearranging the formula to solve for rate, we get:

rate = distance / time

Plugging in the values we know, we get:

rate = 247.5 / 4 = 61.875

To know how much faster Janeesa needs to drive, one has to subtract the speed limit from the required speed:

Speed Difference = Required Speed - Speed Limit

= 61.875 mph - 55 mph

 = 6.875 mph

Therefore, Janeesa needs to drive approximately 6.9 mph faster than the speed limit to make it on time.

Learn more about speed limit from

https://brainly.com/question/28488266

#SPJ2

Help asap math homework

Answers

it would be 85 degrees since there is a 30 beside then the 55 degrees is given
it’s 275. i just learned this in class
u need to find the measure of arc GK to get arc HGJ. add all the given numbers and minus it from 360; a full circle. u would get 50, so then add HG, GK, and KJ which is 155+50+70 to get 275

We have 2 squares. One square is shaded 2/12 and the other shaded square in the diagram is 2/15 shaded. How much of the total diagram is shaded?

A.0.148
B.0.148 repeated
C. 0.3
D.0.3 repeated

Answers

Answer: The answer to your question is C. Brainliest?

Step-by-step explanation:

For the first square, we can multiply both the numerator and denominator by 5 to get an equivalent fraction with a denominator of 60:

2/12 = (2 x 5) / (12 x 5) = 10/60

For the second square, we can multiply both the numerator and denominator by 4 to get an equivalent fraction with a denominator of 60:

2/15 = (2 x 4) / (15 x 4) = 8/60

Now, we can add the two fractions:

10/60 + 8/60 = 18/60

Simplifying this fraction by dividing both numerator and denominator by 6, we get:

18/60 = 3/10

Therefore, the total shaded area in the diagram is 3/10 or 0.3 in decimal form.

The answer is C. 0.3.

The population in North Dakota in 2012 is 0.7 million people. North Dakota has a yearly population growth of 0.028 million people. The population of South Dakota in 2012 is 0.83 million people. South Dakota has a yearly population growth of 0.0195 million people. Enter the minimum number of years it will take the population of North Dakota to equal the population of South Dakota given the current rates of growth. Round your answer to the nearest tenth of a year.​

Answers

Based on an equation, the minimum number of years it will take the population of North Dakota to equal the population of South Dakota given the current rates of growth is 15.3 years.

What is an equation?

An equation describes the equality or equivalence of two or more mathematical expressions.

Equations use the equal symbol (=), while mathematical expressions combine variables with numbers, constants, values, and mathematical operands.

The population of North Dakota in 2012 = 0.7 million

The yearly population growth rate = 0.028 million

The population of South Dakota in 2012 = 0.83 million

The annual population growth rate = 0.0195 million

Let the number of years for the populations to equal = x

Equation:

0.7 + 0.028x = 0.83 + 0.0195x

0.0085x = 0.13

x = 15.3 years

Learn more about equations at  brainly.com/question/22688504.

#SPJ1

Precision manufacturing: A process manufactures ball
bearings with diameters that are normally distributed
with mean 25.1 millimeters and standard deviation
0.08 millimeter.
a. Find the 60th percentile of the diameters.
b. Find the 32nd percentile of the diameters.
c. A hole is to be designed so that 1% of the ball bearings will
fit through it. The bearings that fit through the hole will be
melted down and remade. What should the diameter of the
hole be?

Answers

a. To find the 60th percentile of the diameters, we need to find the diameter that separates the smallest 60% of the diameters from the largest 40%. We can use a standard normal distribution table to find the z-score that corresponds to the 60th percentile:

z = invNorm(0.6) = 0.2533

Now we can use the formula z = (x - mu) / sigma to find the diameter x that corresponds to this z-score:

0.2533 = (x - 25.1) / 0.08

x - 25.1 = 0.020264

x = 25.120264

Therefore, the 60th percentile of the diameters is 25.120264 millimeters.

b. To find the 32nd percentile of the diameters, we need to find the diameter that separates the smallest 32% of the diameters from the largest 68%. We can use a standard normal distribution table to find the z-score that corresponds to the 32nd percentile:

z = invNorm(0.32) = -0.4472

Now we can use the formula z = (x - mu) / sigma to find the diameter x that corresponds to this z-score:

-0.4472 = (x - 25.1) / 0.08

x - 25.1 = -0.035776

x = 25.064224

Therefore, the 32nd percentile of the diameters is 25.064224 millimeters.

c. To find the diameter of the hole, we need to find the diameter that separates the smallest 1% of the diameters from the largest 99%. We can use a standard normal distribution table to find the z-score that corresponds to the 1st percentile:

z = invNorm(0.01) = -2.3263

Now we can use the formula z = (x - mu) / sigma to find the diameter x that corresponds to this z-score:

-2.3263 = (x - 25.1) / 0.08

x - 25.1 = -0.186104

x = 24.913896

Therefore, the diameter of the hole should be 24.913896 millimeters.

a cable technician working fo the local cable company needs to lay down cable down through the neighborhood below. He is unsure how much cable cable he needs, though. Use the pythagorean theorem to help him find the length in feet of cable he needs to fufill his duty

Answers

To use the Pythagorean theorem to find the length of cable the technician needs, we need to know the distance he needs to cover and the height difference between the two points.

Let's say the distance he needs to cover is 1000 feet and there is a height difference of 200 feet between the two points.

Using the Pythagorean theorem, we can find the length of cable he needs:

c² = a² + b²

where c is the length of the cable, a is the distance he needs to cover, and b is the height difference between the two points.

Plugging in the values we have:

c² = 1000² + 200²

c² = 1,040,000

c = √1,040,000

c ≈ 1,020.62

Therefore, the technician needs approximately 1,020.62 feet of cable to fulfill his duty.

An urn contains 10 red balls, 20 yellow balls, and 60 orange balls. If you reach into the urn and select a single ball at random, what is the probability of selecting a orange ball?

Answers

Answer:

2/3 or 67%

Step-by-step explanation:


To find the exact probability for you to reach into the orange balls you'll have to do a data table on which you'll include how many orange balls are by the total amount of balls that are within the urn.

For example:
The urn contains:

* 10 red balls
* 20 yellow balls
* 60 orange balls

Total amount of balls that you have on the urn is 90, you'll get this result by doing a simple addition of the table of content.

Afterwards, we have to find the probability, so you will have to take the amount of orange balls (which is 60) and divide it by 90 (Which is the total amount of balls you have on the urn).

60/90

A quick tip for you to do this on a simplified manner is by dividing the numerator and the denominator by their greatest common divisor (Which in this case is 30) (30x2 = 60) (30x3 = 90)

60/90 = (60 divided 30) / (90 divided 30) = 2/3

To resolve this problem, we get that the probability of selecting an orange ball is 2/3 or approximately 0.67 which we'll simplify to 67%

I hope this helped you

A recipe uses 3/4 teaspoon of cinnamon for every 4 cups of granola mix.
How many teaspoons are needed for 12 cups of granola mix?

Answers

Okay, here are the steps to solve this problem:

* The recipe calls for 3/4 teaspoon of cinnamon for every 4 cups of granola mix.

* So for 1 cup of granula mix, you need 3/4 / 4 = 3/12 teaspoon of cinnamon.

* For 12 cups of granula mix, you would need 12 * (3/12) = 3 teaspoons of cinnamon.

Therefore, for 12 cups of granola mix you would need 3 teaspoons of cinnamon.

An amount of $290,000 is borrowed for a periad of 25 years loan is below. Payments of $1, 530.73 are made monthly Payment # Payment Interest Debt Payment 1 1,530.73 966.67 564.06 N 1,530.73 964.79 565.94 3 1,530.73 962.90 567.83 4 5 rest rate of 4%. The amortization schedule for this Balance 289, 435.94 288, 870.00 288,302.17 Calculate 2, the balance on the loan at the end of month 4. Give your answer to the nearest dollar. Do not include com or the dollar sign in your answer.

Answers

The balance on the loan at the end of month 4 is approximately $289,836.23.

We are given that;

Amount borrowed= $290,000

Time 25 years

Payment=  $1, 530.73

Now,

To calculate the balance on the loan at the end of month 4, we can use the following formula2:

Balance = (Loan amount - Debt payment) * (1 + Interest rate / 12) - Debt payment

Where:

Loan amount is the original amount borrowed ($290,000)

Debt payment is the amount of principal paid in each monthly payment ($564.06 for the first month and $565.94 for the second month)

Interest rate is the annual interest rate divided by 100 (0.04)

Plugging in the values, we get:

Balance = ($290,000 - $564.06) * (1 + 0.04 / 12) - $565.94 Balance = $289,435.94 * 1.003333 - $565.94 Balance = $290,402.17 - $565.94 Balance = $289,836.23

Therefore, by the interest the answer will be $289,836.23.

Learn more about simple interest here;

https://brainly.com/question/1548909

#SPJ1

Can someone please explain this to me?

Answers

[tex]\textit{since we know that }\triangle FGH \cong \triangle CDE \\\\[-0.35em] ~\dotfill\\\\ HF=EC\implies -3s+44=-3t+50 \\\\\\ HG=ED\implies 6s=t+43\implies \boxed{6s-43=t} \\\\\\ \stackrel{\textit{substituting on the 1st equation}}{-3s+44=-3(6s-43)+50}\implies -3s+44=-18s+129+50 \\\\\\ 15s+44=129+50\implies 15s+44=179\implies 15s=135 \\\\\\ s=\cfrac{135}{15}\implies \boxed{s=9}\hspace{9em}\stackrel{ 6(9)-43 }{\boxed{t=11}}[/tex]

Why do you think influences exchange rates?

(Subject: Economics)

Answers

interest and inflation
Several factors can influence exchange rates, including interest rates, inflation, political stability, economic performance, and global events.

Find the volume of the right cone below. Round your answer to the nearest tenth if necessary.
16
7

Answers

The volume of the given right cone is approximately 597.9 cubic units.

In this problem, we are going to find the volume of a right cone. A cone is a three-dimensional object that has a circular base and tapers to a point. The term "right" means that the axis of the cone is perpendicular to its base. The formula for the volume of a right cone is V = (1/3)πr²h, where V is the volume, r is the radius of the circular base, and h is the height of the cone.

Now, let's apply this formula to the given cone. We are given that the radius of the circular base is 16 and the height of the cone is 7. So, we can substitute these values into the formula to get:

V = (1/3)π(16)²(7) V = (1/3)π(256)(7) V = (1/3)(1,792π) V ≈ 597.9

We round our answer to the nearest tenth as requested. So, the final answer is V ≈ 597.9.

To know more about volume here

https://brainly.com/question/11168779

#SPJ1

Does each of these graphs have an Euler circuit? If so, find it.

Answers

Only first figure of graph have an Euler circuit.

We have to given that;

There are 3 graphs are shown in figure.

Since, A graph has an Euler circuit if and only if the degree of every vertex is even.

Hence, In first graph,

Every vertex have even degree with 2 or 4.

Thus, It shows an Euler circuit.

In second graph,

Some vertex have odd degree with 3.

Hence, It does not shown an Euler circuit.

In third graph,

Some vertex have odd degree with 3.

Hence, It does not shown an Euler circuit.

Thus, Only first figure of graph have an Euler circuit.

Learn more about the angle visit:;

https://brainly.com/question/25716982

#SPJ1

Jane is painting her garden fence whose area is 46 m². A tin contains half a litre of paint. The instructions say 1 litre of paint will cover 12 m². 11 (a) How many tins does Jane need to buy? ​

Answers

The number of tins that Jane needs to buy is 8.

What is the area of a figure?

The area of a given figure is the space that the shape will cover when considered in a 2 dimensional plane. To determine the area of a figure, the type and parts of the figure are to be considered.

Given that the area of the garden fence = 46 m^2

Then, 1 liter of paint will cover 12 m^2. So that;

number of liters required = 46/ 12

                                          = 3.83

Since a tin contains half a liter of paint, then;

the number of tins that Jane needs = 2*3.83

                                                           = 7.66

Jane has to buy 8 tins to paint the garden fence.

Learn more about area at https://brainly.com/question/27640119

#SPJ1

The number of tins that Jane needs to buy is 8.

What is the area of a figure?

The area of a given figure is the space that the shape will cover when considered in a 2 dimensional plane. To determine the area of a figure, the type and parts of the figure are to be considered.

Given that the area of the garden fence = 46 m^2

Then, 1 liter of paint will cover 12 m^2. So that;

number of liters required = 46/ 12

                                          = 3.83

Since a tin contains half a liter of paint, then;

the number of tins that Jane needs = 2*3.83

                                                           = 7.66

Jane has to buy 8 tins to paint the garden fence.

Learn more about area at https://brainly.com/question/27640119

#SPJ1

Marcus and Tony work for Lombardo's Pipe and Concrete. Mr. Lombardo is preparing an estimate for a customer. He knows that Marcus lays a slab of concrete in 9 hours. Tony lays the same size slab in 3 hours. If both work on the job and the cost of labor is $48.00 per hour, decide what the labor estimate should be.​

Answers

If both Tony and Marcus work on the job and the cost of labor is $48.00 per hour then labor estimate for the job is $576.00.

Marcus: 1 slab / 9 hours = 1/9 slab per hour

Tony: 1 slab / 3 hours = 1/3 slab per hour

The total amount of work they can do in one hour is the sum of their individual rates:

Marcus and Tony: 1/9 + 1/3 = 4/9 slab per hour

So together, Marcus and Tony can lay 4/9 of a slab per hour.

time = work / rate

time = 1 / (4/9) = 2.25 hours

total labor cost = hours worked x cost per hour

The total number of hours worked is the sum of the hours worked by Marcus and Tony:

total hours worked = 9 hours + 3 hours = 12 hours

The cost per hour is $48.00, so the labor estimate for the job is:

total labor cost = 12 hours x $48.00/hour

= $576.00

Therefore, the labor estimate for the job is $576.00.

To learn more on Equation:

https://brainly.com/question/10413253

#SPJ1

solve for x input numerical value only!! solve asap!!! for brainlist

Answers

The value of x in the rectangle is,

⇒ x = 6

We have to given that;

Corresponding angles are,

⇒ (8x + 19)° and (21x - 13)°

Hence, We can say that;

⇒ (8x + 19)° + (21x - 13)° = 180°

⇒ 29x + 6 = 180

⇒ 29x = 174

⇒ x = 174/29

⇒ x = 6

Thus, The value of x in the rectangle is,

⇒ x = 6

Learn more about the angle visit:;

https://brainly.com/question/25716982

#SPJ1

how many square killometers

Answers

Answer:

120 km²

Step-by-step explanation:

You just need to add all areas, (3×5) + (9×3) + (13×6) = 15 + 27 + 78 = 120

URGENT PLEASE HELP !!!

Answers

The correlation coefficient for the data-set in this problem is given as follows:

r = 0.75.

How to obtain the correlation coefficient?

To obtain the correlation coefficient of the data-set in this problem, we must insert the points of the data-set into a correlation coefficient calculator.

From the table, the points of the data-set are given as follows:

(0, 5.9), (0.8, 8.6), (1.3, 15.5), (1.6, 17.3), (13.3, 21.5).

Inserting these points into a calculator, the correlation coefficient is given as follows:

r = 0.75.

More can be learned about correlation coefficient at https://brainly.com/question/16355498

#SPJ1

WHAT IS THE 3 KINDS OF SYSTEM OF LINEAR EQUATION ACOORDING TO THE No. OF SOLUTIONS BRAINLY

Answers

The types of systems of linear equations are as follows:

Dependent: The system has infinitely many solutions. The graphs of the equations represent the same lines. Example:

. The system has infinitely many solutions.

Independent: The system has exactly one solution. The graphs of the equations intersect at a single point.

Inconsistent: The system has no solution. The graphs of the equations are parallel lines.

• What is the cost price of a bag if it was sold for Rs 500 at a loss of 5%? ​

Answers

Answer:

526.32

Step-by-step explanation:

Let's assume that the cost price of the bag is "C".

Selling Price = Cost Price - Loss

We get:

500 = C - 0.05C

500 = 0.95C

C = 500/0.95

C ≈ 526.32

Therefore, the cost price of the bag was approximately Rs 526.32.

Find the tangent of each angle that is not the right angle.
Drag and drop the numbers into the boxes to show the tangent of each angle.

Answers

The solution is,  the tangent of each angle that is not the right angle is:

angle tan A = 1.33

angle tan B = 0.75

Here, we have,

Given:

ABC is a right triangle.

angle ACB = 90

To find:

tan A

tan B

We know that tangent of an angle is given by the ratio

= opposite / adjacent

The opposite side and adjacent side is taken with respect to the angle for which the tangent is to be found.

tan A = BC/ AC

         = 8/6

         = 4/3

         = 1.33

and, tan B = AC/BC

                 = 6/8

                 =0.75

To learn more about trigonometric relations click :

brainly.com/question/14450671

#SPJ1

A roller for construction work is 5 feet in diameter. When the roller has made one turn, how far has it
traveled?

Answers

Answer:

Approximately 15.7 ft

Step-by-step explanation:

We want to find the circumference of the circle

C = pi * diameter

C = pi *5

C = 5pi ft or approximately 15.7 ft

The distance traveled by the roller when it has made one turn is equal to its circumference. The formula to find the circumference of a circle is:

C = 2πr

where C is the circumference, π (pi) is a mathematical constant approximately equal to 3.14, and r is the radius of the circle.

We are given that the diameter of the roller is 5 feet. The radius of the roller is half of the diameter, which is:

r = d/2 = 5/2 = 2.5 feet

Substituting this value in the formula for the circumference, we get:

C = 2πr = 2π(2.5) = 5π

Therefore, when the roller has made one turn, it has traveled a distance equal to 5π feet (approximately 15.7 feet).
Other Questions
A rule that CANNOT be violated by database users is called a:(A) password.(B) program.(C) constraint.(D) view. Which of the following variables of an asteroid collision affects the impact crater they leave behind?O SizeO SpeedO MassO All of the above 1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose? Question 1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose? You are spinning two identical balls attached to strings in uniform circular motion, Ball 2 has a string that is twice as long as the string with ball 1, and the rotational speed (v) of ball 2 is three times the rotational speed of ball 1. What is the ratio of the centripetal force of ball 2 to that of ball 1? Select all of the ratios that are equivalent to 1:5. What starting alkyl halide and ketone would give 2-methyl-2-pentanol? Write a grignard synthesis for this reaction. Please help!!!There is a photo! Pleasee help!! to the principal for remission of fine What are the bond angles? You want to buy a house within 3 years, and you are currently saving for the down payment.You plan to save $5000 at the end of the first year, and you anticipate that your annual savingswill increase by 10 % annually thereafter. Your expected annual return is 7%. How much wouldyou have for a down payment at the end of year 3? how do the values of the integral 1 2 q/t compare for a reversible and irreversible process between the same end states? calculate the change in entropy for the vaporization of xe at its boiling point of -107 c given that vaph = 12.6 kj/mol. 1. -0.118 j/k mol 2. -13.2 j/k mol 3. 0.750 j/k mol 4. 75.9 j/k mol FeatureThe Ethanol DebateNatalie StewartOur society has recently undergone a shift towards greener living. People have grown more aware of how their actions seriously and negatively impact the environment. Many are seeking out new ways to decrease pollution levels and to find cleaner energy sources to power their homes and businesses. Ethanol is an increasingly popular fuel alternative to gasoline, made from distilled, fermented corn. The benefits of ethanol include lowering the amount of harmful carbon dioxide gases released into the air by burning fossil fuels like gasoline, as well as decreasing the United States dependence on foreign oil. Though many people support the production of ethanol for use as an alternative fuel, most of them ignore the serious drawbacks of ethanol use.One important economic factor in producing ethanol is its influence on the price of corn. Corn prices have more than doubled since 2005 because of increased demand, according to financial experts. Farmers know that corn is highly sought after, so they allot more space on their farms to grow large amounts of corn. This leaves less room for growing other kinds of crops, such as wheat or soybeans. These smaller amounts force suppliers to raise the prices of these now secondary crops as well. Bread and cereal manufactures are also involved in the economics of ethanol. These companies then pass rising costs of their crops to consumers, leading to higher prices at the grocery store.Corn is also a common source of food for livestock. Many farmers are now struggling to feed their herds of cows, chickens, and pigs. The increased cost of feeding their animals has forced many farmers to reduce the size of their herds, decreasing the supply of meat available to consumers. Shoppers are certain to see the prices of beef, chicken, and pork increase if corn prices continue to skyrocket. Unfortunately, hardworking farmers and ranchers see very little profits from this increase in price. Many of them oppose ethanol as an alternative fuel source because of the extreme impact it is having on their way of life.In addition, opponents of ethanol note that government subsidies cost American taxpayers more money. State and federal government subsidy programs offer tax credits to gas stations for each gallon of ethanol they mix in with the gasoline they sell. Government programs also supply companies that produce ethanol with corn! Where does the government get the money for these subsidies? Money for these projects comes from ourthe taxpayerspockets. These costs are in addition to rising fuel prices, which are currently almost four dollars per gallon. Many people are disappointed in ethanol because they believed that it would help reduce the price at the pump, not increase it. Overall, it would be more cost-effective for everyone if the government pursued other options for fuel and energy sources.Ethanol has some benefits. However, overenthusiastic supporters should consider all sides of the issue before taking actions that are already putting Americas economy in a precarious position. Ethanol is not the answer to our economic and environmental problems. Instead of focusing on a technology that is too costly to be practical, we should be encouraging our government to continue investing in other alternatives. Only then will we see our food and energy prices stabilize. Which two pieces of evidence from the passage support the author's point of view as identified in the previous question?ResponsesA The increased cost of feeding their animals has forced many farmers to reduce the size of their herds, decreasing the supply of meat available to consumers.The increased cost of feeding their animals has forced many farmers to reduce the size of their herds, decreasing the supply of meat available to consumers.B People have grown more aware of how their actions seriously and negatively impact the environment.People have grown more aware of how their actions seriously and negatively impact the environment.C Another benefit of ethanol is decreasing the United States dependence on foreign oil.Another benefit of ethanol is decreasing the United States dependence on foreign oil.D One benefit of ethanol includes lowering the amount of harmful carbon dioxide gases released into the air by burning fossil fuels like gasoline.One benefit of ethanol includes lowering the amount of harmful carbon dioxide gases released into the air by burning fossil fuels like gasoline.E Many people are disappointed in ethanol because they believed that it would help reduce the price at the pump, not increase it. Please answer question #35 According to Thomson Financial, last year the majority of companies reporting profits had beaten estimates. A sample of 162 companies showed that 94 beat estimates, 29 matched estimates, and 39 fell short.(a) What is the point estimate of the proportion that fell short of estimates? If required, round your answer to four decimal places.pshort = .2407(b) Determine the margin of error and provide a 95% confidence interval for the proportion that beat estimates. If required, round your answer to four decimal places.ME = (c) How large a sample is needed if the desired margin of error is 0.05? If required, round your answer to the next integer.n* = Discussion What part of the life cycle is represented by the mature pollen grain int[] oldArray = {1, 2, 3, 4, 5, 6, 7, 8, 9}; int[newArray = new int[3][3]; int row = 0; int col = 0; for (int index = 0; index < oldArray.length; index++) { newArray[row][col] = oldArray[index]; row++; if ((row % 3) == 0) { col++; row = 0; } } System.out.println(newArray[0][2]); What is printed as a result of executing the code segment? Determine if each of the following relationships represents a proportional relationship or not.SELECT ALL situations that represent a proportional relationship.A). Natalia is selling fresh eggs at the local farmer's market. She sells 6 eggs for $3.12, a dozen eggs for $6.24, and eighteen eggs for $9.36.B). Joey is training for a bicycle race and has been completing his longer training rides on Saturdays. Over the past month, Joey has ridden his bicycle 36 miles in 3 hours, 46 miles in 4 hours, and 22 miles in 2 hours.C). graph 1 provided in the picturesD). graph 2 provided in the picturesE). Azul bought several different packages of 8-inch by 10-inch art canvases for craft project at her family reunion. The number of canvases in a package and the cost of the package is shown in the table. (TABLE PROVIDED IN PICTURES)F). Kareem is comparing the cost of regular unleaded gasoline at three different gas stations near his home. Instead of filling up his car's gas tank at one station, he puts a few gallons in at each of the three different stations. The number of gallons of gasoline and the cost of the gasoline is shown in the table. (TABLE PROVIDED IN PICTURES) In the financial statements, dividends in arrears on cumulative preferred stock should be _____Select one: a classified as an offset to retained earnings b. classified as a liability either current or long term.C. disclosed in the footnotes. d. classified as an offset to net income f q1 has the same magnitude as before but is negative, in what region along the x-axis would it be possible for the net electric force on q3 to be zero? (a) x , 0 (b) 0 , x , 2 m (c) 2 m , x