on a beautiful day there are 65 cars in the beach parking lot 26 more cars park in the parking lot before noon but 17 car slept how many cars are in the beach parking lot ​

Answers

Answer 1

Answer:

a

Step-by-step explanation:


Related Questions

Keith spent half of his allowance going to the movies. He washed the family
car and earned 7 dollars. What is his weekly allowance if he ended with
14 dollars ?

Answers

Answer:

28

Step-by-step explanation:

because he spent half of 28 which is 14 and 7x4=28 BOOM

Please help. If this isn't done by today i'm grounded :(

A _____ magnet can be made by rubbing a permanent magnet the same way
along an item. The alignment of atoms does not last long.
permanent
temporary
atomic
polar

Answers

Answer:

permeant

Step-by-step explanation:

Stroking with one pole of a permanent magnet works because it aligns the atoms in the nail to line up in the same polar direction, giving the nail a north and a south magnetic pole.

In a board game, the player who makes the last move receives an 11-point bonus for ending the game. Let s represent the score before the endgame bonus and f represent the final score. Find the valué of f when s = 1

Answers

Answer:

12

Step-by-step explanation:

Given that :

Player who makes last move receives 11 - point bonus

Let s = score before end game bonus ; f = final score ;

Final score (f) when s = 1

Final score =) score before end game bonus) + 11 point bonus

Final score = 1 + 11 = 12

The measures of two supplementary angles are ( 2x-11 )° and ( 3x+1 )°. Find the value of x.

Answers

(2x - 11) + (3x+1) = 180
5x - 10 = 180
5x = 190
x = 38

For the high school's production of "Grease," 315 tickets were sold. The cost of a student ticket, s, was $5; the cost of all other tickets, t, was $8. The total income from ticket sales equaled $2211. The system of equations below can be used to determine the number of each type of ticket sold. s+t=315 55 + 8 = 2211 How many student tickets were sold?​

Answers

Answer:

103 students tickets were sold

Step-by-step explanation:

103 times $5 = $515

212 times $8 = $1696

$515 + $1696 = $2211

What is the slope of the line shown in the graph below?

Answers

Answer:

-2/3

Step-by-step explanation:

Since slope is just rise over run, find the y intercept and see how far it is from the x axis. If it goes down and is above  \the x axis, then it is negative and if it is under the x axis, then it is positive. Then count how far the x intercept is. Same concept as the y intercept. Then, you put it as a fraction (y goes on top of x) and simplify to get your slope.

The correct answer is -2/3

The movie theater sold 538tickets on Friday. On Saturday 907 tickets were sold how many more tickets were sold on Saturday

Answers

Answer:

369 more tickets

Step-by-step explanation:

907-538=369

A linear function models the height of a burning candle. Candle A comes out of the mold at 211 ​mm, and is expected to be at 187 mm after 8 hours of burning. The model for Candle B is h=210−5t​, where h is the height in millimeters and t is the time in hours. What are the initial values for each​ candle? What do the initial values for each candle tell​ you?

Answers

Given:

Candle A comes out of the mold at 211 ​mm, and is expected to be at 187 mm after 8 hours of burning.

The model for Candle B is

[tex]h=210-5t[/tex]

where, h is the height in millimeters and t is the time in hours.

To find:

The initial values for each​ candle and its interpretation.

Solution:

Candle A comes out of the mold at 211 ​mm, and is expected to be at 187 mm after 8 hours of burning.

So, initial value of candle A = 211 mm

The model for Candle B is

[tex]h=210-5t[/tex]

Putting t=0, we get

[tex]h=210-5(0)[/tex]

[tex]h=210-0[/tex]

[tex]h=210[/tex]

So, initial value of candle B = 210 mm

Initial values for each candle tell​ you about the height of the candles before they start burning.

Initial value of candle A is greater than B, so the height of candle A is greater than B before they start burning.

Therefore, the initial value of candle A is 211 mm and initial value of candle B is 210 mm.

A supermarket had bags of red grapes for $13.00 for 5 bags. They also had bags of green grapes priced at $5.08 for 2
bags. Which type of grape is most expensive?
A They are both the same price
B Green grapes
Red grapes

Answers

Answer:

They were both the same price

Step-by-step explanation:

$13.00 divided by 5 is 2.6

$5.08 divided by 2 equals 2.54 and if you round, it equals 2.6

30 greater than 1/2ₓ

Answers

Answer: True.

Step-by-step explanation:

The answer is : true
Good luck
God bless you

Find the degree of the polynomial below. 4x^3-9x^2+8x+5

Answers

Answer:

3

Step-by-step explanation:

4x³ - 9x² + 8x + 5

Here, the degree of the polynomial is 3

-TheUnknownScientist

Answer:

the right answer is 3

Step-by-step explanation:

right answer is 3

Find the slope of the line through each pair of points.
6. *
(4, 10), (0, 3)

Answers

Answer:

Slope: 1.75

Step-by-step explanation:

Slope = (3-10) / (0-4)

         = -7 / -4

         = 1.75

If 4m + 1 = 7 then 4m = 6
1) Symmetric Property 2) Subtraction Property of Equality
3) Substitution Property 4) Transitive Property

Answers

Answer:

2) Subtraction Property of Equality Properties

General Formulas and Concepts:

Pre-Algebra

Addition Property of Equality - Adding on both sidesSubtraction Property of Equality - Subtracting on both sidesMultiplication Property of Equality - Multiplying on both sidesDivision Property of Equality - Dividing on both sidesTransitive Property - If a = b and b = c, then a = cSymmetric Property - If a = b then b = a

Step-by-step explanation:

Step 1: Define

4m + 1 = 7 → 4m = 6

Step 2: Identify

We see that we subtracted on on both sides of the equation. Therefore, we would have to use the Subtraction Property of Equality. Therefore, 2 is our answer.

Will give brainliest!

Answers

Answer:

Answer is C multiply 5 by every ticket

Step-by-step explanation:

Li bought five lip balms. Each lip balm costs the same amount. She spent a total of $7.25.
Using the variable c to represent the cost of each lip balm, write an equation that represents the situation.

C=??

how did u get that answer=??

Answers

Answer:

Its 1.45, you didn't have to ask a question just look it up

Step-by-step explanation:

7.25-5c

If y by itself what does that means?

Answers

Answer:

[tex]here \: y \: by \: itself \: means \\ \: y \: stands \: alone \: with \: \\ nothing \: nearby \: it .\\ \\ hope \: it \: helps..[/tex]

by itself means it’s alone. or there’s no one of nothing near

PLS HELP ASAP PLSSS IT DETECTS IF ITS RIGHT OR WRONG HELPPP

Answers

Answer:

B - 500 + 10x = 700

Step-by-step explanation:

It’s not C because there’s nothing to subtract, he’s just gaining. It’s not A because he gains 10 every month, so the x would have to be on the 10, which means it’s B.

Answer:

B-500+10x=700

Step-by-step explanation:

A migrating bird flies 42 miles in 3 hours. How many miles does it fly in 5 hours?

Answers

42/3 = 14 miles per hour
14 * 5 = 70
Solution: 70 miles

Answer:

70 miles.

Step-by-step explanation:

In this question we are given the speed of the migrating bird. If we remember the definition of speed we will remember that speed is distance the object/body traveled, divided by the time it took the object/body to travel this distance.

Solution:

Firstly we need to find out what distance will the bird travel in 1 hour.  We can easily do that science we know the distance it travels in 3 hours. So we just use the property of a fraction that states that if we multiply or divide the denominator and the numerator by the same number we will get a fraction of the same value but written a bit differently. So we divide the numerator and the denominator by 3 and get

[tex]\frac{42 miles}{3 hours}[/tex] = [tex]\frac{14 miles}{1hour}[/tex]

Now we know what distance the bird travels in one hour so we can easily figure how much the bird will travel in 5 hours by multiplying the numerator and the denominator by 5. So we do...

[tex]\frac{14 miles}{1 hour}[/tex] = [tex]\frac{70 miles}{5 hours}[/tex]

And we get that the bird will travel 70 miles in 5 hours.

Sales tax in your community is 6 percent. If you go to a sporting goods store and buy a soccer ball for $19.95, socks for $5.95, and a headband for $10.00, what amount will you pay once the sales tax is added to your purchase?

Answers

Answer:

$26.90 + $1.61 = $28.51

Which phrase matches the algebraic expression below?
2(x - 7) +10

Answers

Answer:

2 times the difference of x minus 7 plus 10

Step-by-step explanation:

When dealing with equations, you ALWAYS do the parentheses first. The first relationship x and 7 are going to have is being subtracted from eachother. Once you do that, you can do the rest of the equation. Hope this helps!

what is 2 + (-7/20)? I've been trying to figure it out for a while but i cant seem to get the right answer.

Answers

The answer you should get is 33/20 or 1.65. How you get this answer is you start by removing the parentheses, then calculate the difference.

2 + (-7/20)

2 - 7/20

20 times 2 equals 40

Subtract 7 from 40

Keep your denominator the same and change your numerator to 33.

-8+-8(6n)+-8(1)
(Please help I need to get an 100% on the assignment I’m doing)

Answers

[tex] = - 8 + (- 8(6n)) (- 8(1)) \\ = - 8 - 48n - 8 \\ = - 16 - 48n[/tex]

Which expression can be used to determine 50% of 42? 42 minus 2 42 divided by 2 42 divided by 10 42 minus 10

Answers

Answer:

We know that 50% of 42 will be = 21

i.e. 50% of 42 = 50/100 = 21

The correct answer should be: 42 divided by 2

Step-by-step explanation:

We know that 50% of 42 will be = 21

i.e. 50% of 42 = 50/100 = 21

Also, when we divide 42 by 2, we get the answer 21.

i.e. 42/2 = 21

Therefore, the correct answer should be: 42 divided by 2

Answer:The Answer is b

Step-by-step explanation: i did this the other guy can get brainlyest.

Have a nice day! :D

be courteous to all but intimate with a few and let those few be well tried before u give them your confidence what does this mean

Answers

Answer:

You get out what you put in, like everything else in life. There are many levels of relationships and degrees of connection. We all respond and are available to different dynamics.

Step-by-step explanation:

The Sweetest Jelly Company sells jellies in i pound jars. How many jars can
be filled from 24 pounds of jelly?

Answers

He can fill 6 jars with 24 pounds of jelly

A line drawn from one side of a circular plate to the other, through the center of the plate, measures 25 centimeters.







What is the approximate area of the plate to the nearest square centimeter?




39 centimeters²

79 centimeters²

156 centimeters²

491 centimeters²

Answers

Answer:

39 centimeters

Step-by-step explanation:

to find the area of a circle you first find the radius which is the disctance from the edge of the plate to the center. you then multiply it by pi to find the total area.

The required area of the given plate with a diameter of 25 centimeters is 491 centimeters². Option B is correct.

What is an area circle?

The area of the circle is given by the pie times square of the radius.

Area of circle = πr^2

here,
A line drawn from one side of a circular plate to the other, through the center of the plate, measures 25 centimeters.

So, the Diameter of the plate = 25 centimeters,

The area of the plate is given as,
Area of plate = π × [diameter/2]²
                   = 3.14 × [25/2]
                   = 491 centimeters²

Thus, the required area of the given plate is 491 centimeters². Option B is correct.

Learn more about circle here:

brainly.com/question/11833983

#SPJ2

What is the mapping notation for translating point
(x,y) down 3 units?
A.
(x,y+3)
B.
(x-3,y)
C.
(X+3,y)
D.
(x,y-3)

Answers

D.(x,y-3)
Because x basically represents the horizontal and y represents vertical
D because when it goes down the y axis and is negative

what is the distance between the points (-2, 1) and (3, 1)

Answers

Answer:

Step-by-step explanation:

2.23606797

PLS HELP ASAP PLSS I ONLY HAVE 10 MINUTES

Answers

Answer:

$20 :)

Step-by-step explanation:

There's a pattern in the table of adding 20 each time, so subtract 20 from 40 to get the answer!

Your answer is B: $20.

(You can get to this answer by dividing the number of tickets by the cost.)

Hope this helps!

What inequality sign would be used for the words, "no fewer than?"

Answers

Answer: The no fewer then sign would be <
Reason: let’s say that Alex wanted no fewer then 5 sheets of paper for a project. Alex can’t finish his assignment with only 4 sheets of paper. He can with 6, 7, 8, 9, etc. how we would label this is like this < 5 sheets. Think of the sign like a monster crocodile. It can eat as much as it can.
Other Questions
Which country closed its ports to farmers?A. SpainB. FranceC. England Can you help me plz? Write an equation in point-slope form for the line through the given point with the given slope(8,-3);m= -1/4 a drum has a diameter of 18 in and is 16 in deep find the volume What is the special rule with multiplying or dividing an equality by a negative number? (Im in a rush to get this answered,Im taking a test) What was one effect of the State Colonization Law of 1825?A. Mexico gained its independence from Spain.B. San Antonios population reached 20,000.C. Slavery was banned in Texas.D. The Old Three Hundred were recruited to settle Texas. please help me I don't answer this I'll give brilliance What is the graph of the linear function that is represented by the equation y= 1/2x-2 25 POINTS AND BRAINLIEST!! Clay wants to ride a Ferris wheel that has a radius of 80 feet and is suspended 9 feet above the ground. The wheel makes 6 revolutions in one minute. Find the period and amplitude. Read the following excerpt from "Woman Who Helped Hide Anne Frank Dies at 100" by Teri Schultz.Ms. MIEP GIES: I, myself, I'm just a very common person. I simply had no choice. I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks. And this was not the kind of life I was looking for at all. SCHULTZ: Gies explained another motivation for emphasizing her modesty. She said if people are allowed to think it takes remarkable qualities to act boldly on behalf of others, few will attempt it. Ms. GIES: People should never think that you have to be a very special person to help those who need you.Which detail best illustrates Miep Giess purpose in this excerpt?People should never think that you have to be a very special person to help those who need you.I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks.And this was not the kind of life I was looking for at all. Gies explained another motivation for emphasizing her modesty. At a meeting of musicians, 56 of the musicians play the piano but only 35 play the violin. What is the minimum number of people at the meeting who play both piano and violin? |-10| divided by 2 x |5| The graph of the equation x + 3y = 6intersects the y-axis at the point whosecoordinates are: (Find the y intercept)which answer?(0,2)(0,6)(0,18)(6,0) How many men did it take to capture Antigonea. 2b. 5c. 1d. 7 Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC Jake walks to town every fifth day. Sam rides his bike to town every fourth day. What is the first day they are likely to meet in town? Why do numA and numB have the same scope in the subtract function? def subtract(numA, numB): return numA - numB def divide(numC, numD): return numC / numD answer = subtract(24,6) print (answer) The coda is considered to be Which process is best illustrated by the diagram? Billy has a gift card with a $160 balance. He buys several video games that cost $40 each. After the purchases, his gift card balance is $40. Enter an equation to help find out how many video games Billy bought.