on Monday Therease went to the doctor and got an antibiotic for strep throat. The doctor told her take a dose of 4.8 ml every 12 hours for 7 days. If Thereas took her first dose at 9:00 AM on Monday, what day and time should she take her 7th dose?

Answers

Answer 1

Theresa should take her 7th dose at 9:00 AM on Friday.

What are arithmetic operations?

Arithmetic operations is a branch of mathematics that studies numbers and the operations on numbers that are useful in all other branches of mathematics. It consists primarily of operations like addition, subtraction, multiplication, and division.

we have,

The doctor told her to take a dose of 4.8 ml every 12 hours for 7 days.

If Theresa took her first dose at 9:00 AM on Monday,

Simply add 12 hours every time up to the 7th dose,

First dose  ----> 9:00 AM on Monday,

Second dose  ----> 9:00 PM on Monday,

Third dose  ----> 9:00 AM on Tuesday,

Fourth dose  ----> 9:00 PM on Tuesday,

Fifth dose  ----> 9:00 AM on Thursday,

Sixth dose  ----> 9:00 PM on Thursday,

Seventh dose  ----> 9:00 AM on Friday,

Hence, Theresa should take her 7th dose at 9:00 AM on Friday.

To learn more about arithmetic operations visit,

brainly.com/question/4721701

#SPJ1


Related Questions

Manuel watered all the flowers at a business park. While watering, he noticed the daisies had been planted in groups of 11 and the lilies had been planted in groups of 12. If Manuel watered the same number of each flower, what is the minimum number of each that he must have watered?

Answers

Answer:

The minimum number of daisies and lilies that Manuel must have watered is 11.

Step-by-step explanation:

To find the minimum number of daisies and lilies that Manuel must have watered, we need to find the least common multiple (LCM) of 11 and 12. The LCM of two numbers is the smallest positive integer that is a multiple of both numbers.

To find the LCM of 11 and 12, we can list the multiples of each number and find the smallest number that appears in both lists. The multiples of 11 are 11, 22, 33, 44, 55, 66, 77, 88, 99, 110, 121, etc. The multiples of 12 are 12, 24, 36, 48, 60, 72, 84, 96, 108, 120, 132, etc.

We can see that the smallest number that appears in both lists is 11, which is the LCM of 11 and 12. Therefore, the minimum number of daisies and lilies that Manuel must have watered is 11. If he watered the same number of each flower, he must have watered at least 11 daisies and 11 lilies.

Find the equation of the line tangent to the function at the given point. Your answer should be in slope-intercept form. SHOW ALL WORK, LABEL APPROPRIATELY. F(x)= x - 4x² + 7 at x = 1 Find the instantaneous rate of change of the function at the given value. f(x) = 2x² + x +1; -2

Answers

On solving the provided question, we can say that - the instantaneous rate of change of the function at the given value, by solving the equation  y = 11 - 5x, f'(1) = 3-8 = -5

What is an equation ?

A mathematical equation is a formula that uses the equals symbol (=) to link two expressions and represent their equivalence. A mathematical statement that demonstrates the equality of two mathematical expressions is an equation in algebra, in its most basic form. Consider the equation 3x + 5 = 14, where 3x + 5 and 14 are two expressions that are separated by the symbol "equal."

y = f(x) =

[tex]x^3 - 4x^2 + 7 \\at x =1[/tex]

f(x) = 3-4+7

= 6

F'(x) = [tex]3x^2 - 8x[/tex]

f'(1) = 3-8 = -5

equation = y - 6 = -5(x-1)

y = 11 - 5x

To know more about equation visit:
https://brainly.com/question/649785

#SPJ4

If the point starts at and rotates counterclockwise, which statement is TRUE? a. x=cosθ andy=sinθ and both functions have a period ofπ . b. x=sinθ andy=cosθ and both functions have a period of 2π . c. x=sinθ andy=cosθ and both functions have a period ofπ . d. x=sinθ andy=cosθ and both functions have a period of 2π .

Answers

The correct statement regarding the unit circle is given as follows:

x = cos(θ) and y = sin(θ), and both functions have a period of 2π.

What is the unit circle?

For an angle [tex]\theta[/tex] the unit circle is a circle with radius 1 containing the following set of points: [tex](\cos{\theta}, \sin{\theta})[/tex].

These points are contained according to the following identity:

[tex]\cos^2{\theta} + sin^2{\theta} = 1[/tex]

(standard identity of trigonometry).

From the x-coordinate and the y-coordinate of each point on the unit circle, the function definitions are given as follows:

x = cos(θ)y = sin(θ)

The period of both functions is of 2π, as the entire unit circle forms an angle of 360º = 2π.

More can be learned about the unit circle at https://brainly.com/question/20691579

#SPJ1

Spencer sampled 50 students of a private school who were questioned about their scores in Mathematics. Spencer wants to test the hypothesis that the private school students score better than the general public which has an average of 62 marks with a population standard deviation of 7 marks.
z equals fraction numerator x with bar on top minus mu over denominator begin display style fraction numerator sigma over denominator square root of n end fraction end style end fraction

If the sample mean is 65 marks, what is the z-score? Answers are rounded to the hundredths place.

Answers

The answer is 3.03

What is a sample mean?

A sample mean is an average of a set of data . The sample mean can be used to calculate the central tendency, standard deviation and the variance of a data set.

Given here μ=62 σ=7 sample mean x = 65 and n=50

now the formula given is z= x-μ / σ÷√n

                                            = 65-62 / 7÷√50

                                            = 3√50/7

                                            = 3.03

Hence the final answer is 3.03

Learn more about z-score here:

https://brainly.com/question/15016913

#SPJ1

NO LINKS!!
The approximate lengths and diameters (in inches) of bright common wire nails are shown in the table. Find a logarithmic equation that relates the diameter y of a bright common wire nail to its length x. (Use the first and last lengths and diameters to form the equation. Round your answers to three decimal places.)

ln(y)=

Length, x Diameter, y
2. 0.113
3. 0.151
4. 0.192
5. 0.222
6. 0.262

Answers

Answer:

[tex]\ln (y) = 0.210x-2.601[/tex]

Step-by-step explanation:

Given table:

[tex]\begin{array}{|c|c|}\cline{1-2} \sf Length & \sf Diameter \\x & y\\\cline{1-2} \vphantom{\dfrac12} 2 & 0.113\\\cline{1-2} \vphantom{\dfrac12} 3& 0.151\\\cline{1-2} \vphantom{\dfrac12} 4& 0.192\\\cline{1-2} \vphantom{\dfrac12} 5& 0.222\\\cline{1-2} \vphantom{\dfrac12} 6& 0.262\\\cline{1-2} \end{array}[/tex]

To convert  y = abˣ  to linear form, take natural logs of both sides and rearrange:

[tex]\begin{aligned}y=ab^x \implies \ln y &= \ln ab^x\\\implies \ln y &= \ln a + \ln b^x\\\implies \ln y &= \ln a + x \ln b\\\implies \ln y &=x \ln b+ \ln a\end{aligned}[/tex]

This is in the straight-line form y = mx + c.

Substitute the first and last values of x and y from the table into the natural log formula:

[tex]\ln 0.113 = 2 \ln b+\ln a[/tex][tex]\ln 0.262 = 6 \ln b+\ln a[/tex]

Subtract the first equation from the second equation to eliminate ln(a);

[tex]\implies \ln 0.262 - \ln 0.113 = 6 \ln b - 2 \ln b[/tex]

[tex]\implies \ln 0.262 - \ln 0.113 = 4 \ln b[/tex]

Apply the quotient log law:

[tex]\implies \ln \dfrac{0.262}{0.113} = 4\ln b[/tex]

Rearrange and solve for ln(b):

[tex]\implies \ln b = \dfrac{1}{4}\ln \dfrac{0.262}{0.113}[/tex]

[tex]\implies \ln b = 0.210\; \sf (3\;d.p.)[/tex]

Substitute the found value of ln(b) into one of the equations and solve for ln(a):

[tex]\implies \ln 0.262 = 6 \cdot \dfrac{1}{4}\ln \dfrac{0.262}{0.113}+\ln a[/tex]

[tex]\implies \ln a=\ln 0.262 -\dfrac{6}{4}\ln \dfrac{0.262}{0.113}[/tex]

[tex]\implies \ln a = -2.601\; \sf (3\;d.p.)[/tex]

Substitute the found values of ln(a) and ln(b) into the formula to create an equation for ln(y):

[tex]\boxed{\ln (y) = 0.210x-2.601}[/tex]

One hundred offices need to be painted. The workers choose between yellow, blue, or red paint. They decide that 45% of the offices will be painted yellow; 28% will be painted blue, and the remaining offices will be painted red. What amount of offices will be painted red?

Answers

Answer:

27 offices will be painted red

-------------------------------------------------

Out of 100 offices:

45% of the offices will be painted yellow ⇒ 45 offices28% of the offices will be painted blue     ⇒ 28 offices

Remaining offices will be painted red:

100 - (45 + 28) = 100 - 73 =27

Answer:

27 offices will be painted red.

Step-by-step explanation:

Yellow offices:

= 45% of 100 offices

= 0.45 × 100

= 45 yellow offices

Blue offices:

= 28% of 100 offices

= 0.28 × 100

= 28 blue offices

Red offices:

= Total number of offices - yellow offices - blue offices

= 100 - 45 - 28

= 55 - 28

= 27 red offices

Therefore, 27 offices will be painted red.

What is the range of the relation?

{(2, -5), (1, 4), (-3, 0), (6, 2)}

Responses

{-3, 1, 2, 6}

{-3, 0, 2, 6}

{-5, 1, 2, 4}

{-5, 0, 2, 4}

Answers

The correct option is (d) i.e. the range of the relation is {-5, 0, 2, 4}.

What is Range ?

A function's range is a collection of all of its potential results, or alternatively, the collection of all conceivable representations of the domain's elements.

Given, {(2, -5), (1, 4), (-3, 0), (6, 2)}

Range is the result of a relation.

let say, X⇒ Y is a relation where X represents the domain and Y represents the range and both can be represented as ( X, Y).

So, all the values at the position of Y are called range of the given relation.

Hence, Range will be {-5, 0, 2, 4}.

Learn more about Relation and Functions from the given link:

https://brainly.com/question/24779057

#SPJ1

Consider the following three polynomial functions.
f(x) =3x3 +5x-2
9 (x) =582-3x +2 m(x) =2x2 - 2x
Write an expression to represent f(x) + [g (x) - m(x)].
Use the carrot (^) for exponents and leave no spaces between terms.

Answers

The Solution for the given problem is 6x² +4x

What is Polynomial?

A polynomial is a mathematical statement made up of indeterminates and coefficients that solely includes the operations of addition, subtraction, multiplication, and positive-integer powers of variables.

Solution:

We are given with the values of the following terms f(x), g(x), and m(x)

f(x) = 3x² + 5x - z

g(x) = 5x² - 3x + z

m(x) = 2x² - 2x

To find: f(x) + [g(x) - m(x)]

so, we need to put the respective values in the equation and simplify it

3x² + 5x - z + [5x² - 3x + z - 2x² + 2x]

3x² + 5x - z + [3x² - x + z]

6x² +4x

To learn more about Polynomials from the given link

https://brainly.com/question/24662212

#SPJ1

Holly wants to invest $6,800.00 in a savings account.

Determine the simple interest rate required for Holly's investment to grow to $16,500.00 in 14 years.

Round your answer to the nearest tenth of a percent and don't forget to include a percent sign, %, in
your answer.

The interest rate required to grow the investment to $16,500.00 is______

Answers

Answer:

Below

Step-by-step explanation:

16500 - 6800 = 9700 interest required to meet this situation in 14 years

6800 * i * 14  = 9700       where i = decimal interest

i = 9700/(6800*14) = .1018  = 10 .2 %

Margo sells bracelets for $8 each and necklaces for $12 each. The equation below can be used to calculate E , her total earnings. E=8b+12n If is the number of bracelets, and n is the number of necklaces she sold, which equation can be used to find b , when E and n are known?

Answers

The equation that can be used to find b, when E and n are known is: b = (E - 12n) / 8.

This equation can be derived from the original equation of E=8b+12n. To solve for b, we can start by subtracting 12n from both sides of the equation to isolate b. We then divide both sides of the equation by 8 in order to solve for b.

The result is b = (E - 12n) / 8. This equation can be used to find the number of bracelets (b) when the total earnings (E) and the number of necklaces (n) are known.

We can rearrange the equation to solve for b.

E = 8b + 12n

Subtract 12n from both sides:

E - 12n = 8b

Divide both sides by 8:

(E - 12n)/8 = b

Therefore, the equation to find b, when E and n are known, is:

b = (E - 12n)/8

For more questions like Equation click the link below:

https://brainly.com/question/1529522

#SPJ4

which of the following graphs shows the solution set to the system of inequalities below? {y>12x 4y>5

Answers

Answer:

Step-by-step explanation:

find the solution of the differential equation dr sec21 dt tant 1 which passes through the point (x,5).

Answers

The solution of the differential equation is given by r = 5tan(t + c) where c is the constant of integration, determined by the initial condition (x, 5).

The given differential equation is dr sec21dt tant 1. This is a first order linear differential equation which can be solved using an integrating factor. The integrating factor is given by e^(integral(sec^2(t)dt)). The solution of the equation is given by

[tex]r = (integral(sec^2(t))) + c[/tex]

where c is the constant of integration

Let y = sec(2x)

dy/dt = 2tan(2x)sec(2x)

Now, substituting the given point, we get

5 = sec(2x)

⇒ 2x = arccosec(5)

⇒ x = arccosec(5)/2

Now, substituting this in the equation of the differentiable curve, we get

[tex]\int\limits^a_b {x} \, dx dy/dt = 2tan(arccosec(5))sec(arccosec(5))[/tex]

Hence, the solution of the differential equation passing through the given point is y = sec(2x) = sec(arccosec(5))

or r = sec(arccosec(5))

Learn more about equation here

https://brainly.com/question/29657992

#SPJ4

A family compares the cost of renting a truck from two different companies for its 2-day move to another state.The costs are shown in the table.

Answers

A. The functions are given as follows:

Company X: X(m) = 245.9 + 0.59m.Company Y: Y(m) = 91.9 + 0.79m.

B. The company from which the family should rent the truck is: Company Y.

How to define the functions?

There are two costs in the problem, given as follows:

Fixed costs: base, drop-off and insurance.Variable: cost per mile.

The fixed costs for Company X are given as follows:

Base: 2 x 29.95 = 59.90.Drop-off: 150.Insurance: 2 x 18 = 36.

The variable cost is of 0.59 per mile, hence the function, considering a trip of m miles, is given as follows:

X(m) = 59.90 + 150 + 36 + 0.59m.

X(m) = 245.9 + 0.59m.

The fixed costs for Company Y are given as follows:

Base: 2 x 19.95 = 39.90.Drop-off: included.Insurance: 2 x 26 = 52.

The variable cost is of 0.79 per mile, hence the function, considering a trip of m miles, is given as follows:

Y(m) = 39.90 + 52 + 0.79m

Y(m) = 91.9 + 0.79m.

The trip is of 750 miles, hence the costs are given as follows:

X(750) = 245.9 + 0.59 x 750 = $688.4.Y(750) = 91.9 + 0.79 x 750 = $684.4.

Due to the lower cost, Company Y should be chosen.

More can be learned about functions at https://brainly.com/question/24808124

#SPJ1

find the measure of m< VTK

Answers

Measure of angle VTK is 90°.

Define angle.

Angles come in many different varieties in geometry. Angle is among the most crucial and fundamental units. Two rays or lines are linked at their shared terminus when they create an angle. We use angles in many facets of our daily lives, starting with the construction of buildings, dams, and monuments, not only in mathematics. The study of angles is essential to civil engineering. Two rays (half-lines) combined into an angle have a single terminal. The latter is known as the vertex of the angle, while the rays are known as its sides, occasionally as its legs, and occasionally as its arms.

Given

∠VTK = 90°

∠VMK = 90°

∠VTK is given

∠VTK = 90°

Measure of angle VTK is 90°.

To learn more about angle, visit:

https://brainly.com/question/28451077

#SPJ1

5. A recent college graduate hopes to have $200,000 saved in their retirement account 25 years from now by contributing $150 per month in a 401(k) plan. The goal is to earn 10% annually on the monthly contribution. Will they have the $200,000 at the end of the 25 years?

Answers

Answer: No

Step-by-step explanation:

To determine whether the college graduate will have $200,000 saved in their retirement account after 25 years, we can use the formula for compound interest:

A = P * (1 + r/n)^(nt)

where A is the total amount of money in the account after the specified time, P is the initial amount of money deposited in the account, r is the annual interest rate, n is the number of times the interest is compounded per year, and t is the number of years the money is invested.

In this case, the initial amount deposited each month is $150, the annual interest rate is 10%, the number of times the interest is compounded per year is 12 (once per month), and the number of years the money is invested is 25. Plugging these values into the formula above gives us:

A = $150 * (1 + 10%/12)^(12*25) = $150 * (1.0083)^300 = $150 * 3.4955 = $524.33

Since the goal is to have $200,000 saved in the account after 25 years, the college graduate will not have enough money in their account if they contribute $150 per month at 10% interest. In order to reach their goal, they would need to save more money each month or earn a higher interest rate on their contributions.

An experiment is carried out to determine the relationship between the average speed (rpm) and power (hp) of a mixer.
Construct a scatter plot for the data obtained in the experiment. Complete your work in the space provided or upload a
file that can display math symbols if your work requires it. Be sure to label the axes and include an appropriate scale for
the numerical labels.

Answers

Answer:

Step-by-step explanation:

So your first point has x=325.0 and y=1.10, your second point has x=348.9 and y=1.40, and so on.

The graph should look something like this:

The conclusion that you would draw from your plot is that the power seems to vary linearly with the speed. The data points are almost in a straight line. They are not perfectly aligned, of course. There is always some variability in real data, but you can see a trend.

tan^2x/sec^2x + cot^2x/csc^2x

Answers

The value of the trigonometric expression will be 1. Then the correct option is C.

What is trigonometry?

Mathematical capabilities inspect the collaboration between the aspects and points of a three-sided structure.

The meaning of straightforwardness is simplifying something to accomplish or get a handle on while likewise making it somewhat less troublesome.

The expression is given below.

⇒ tan²x / sec²x + cot²x / cosec²x

Simplify the expression, then the value of the expression is given as,

⇒ tan²x / sec²x + cot²x / cosec²x

⇒ (sin²x × cos²x) / cos²x + (cos²x × sin²x) / sin²x

⇒ sin²x + cos²x

⇒ 1

The worth of the mathematical articulation will be 1. Then, at that point, the right choice is C.

More about the trigonometry link is given below.

https://brainly.com/question/22698523

#SPJ1


Use the scale to help you solve the equation and find the value of x. Enter the
value of x below.
x+2=8
X=

Answers

Answer: 6

Step-by-step explanation:

x=8-2

x=6

In a study, the residents of Edinburgh, Scotland, were classified as having either black hair, brown hair, blonde hair, or red hair. The probabilities of a randomly selected resident having black, brown, or blonde hair are 0.17, 0.47, and 0.20 respectively. Assuming each resident has one of these four hair colors,(a) what is the probability that a randomly selected resident has red hair?(b) what is the probability that a randomly selected resident has brown or black hair?(c) what is the probability that a randomly selected resident does not have blonde hair?

Answers

a) probability that a randomly selected resident has red hair is 0.16

b) probability that a randomly selected resident has brown or black hair   is  0.67

c) probability that a randomly selected resident does not have blonde hair is 0.8.

P(black hair color) = 0.17

P (Brown hair)  = 0.47

P (blonde hair)  = 0.20

a) Probablity that a randomly chosen resident has red hair is:

P(red hair) = 1 - P(black hair) - P(brown hair) - P(blonde hair)

=> 1 - 0.17 - 0.47 - 0.20

=> 0.16

b) P(brown hair) + P(black hair) is the likelihood that a randomly chosen resident has brown or black hair (black hair)

= 0.47 + 0.20

= 0.67

c) The Probability that a randomly chosen resident does not have blonde hair is equal to 1 - P (blonde hair)

=> 1 - 0.20

=> 0.8

To know more about probalility click on below link:

https://brainly.com/question/30034780#

#SPJ4

The probability that a randomly selected resident has red hair and brown or black and  black, brown, or blonde hair is 0.16, 0.80 and 0.20

The probabilities of a randomly selected resident having black, brown, or blonde hair are 0.17, 0.47, and 0.20 respectively.

P (black hair) = 0.17

P (brown hair) = 0.47

P (blonde hair) = 0.20

The probability is the measure of the likelihood of an event to happen. It measures the certainty of the event. The formula for probability is given by; P(E) = Number of Favourable Outcomes/Number of total outcomes.

(a). Probability that a randomly selected resident has red hair is

P (red hair) = 1 -P(black hair)-P (brown hair)-P (blonde hair)

 = 1 - 0.17 - 0.47 - 0.2

 = 0.16

(b).  Probability that a randomly selected resident has brown or black hair

  = P (brown hair) + P (black hair)

  = 0.47 + 0.20  

  = 0.67

(c). Probability that a randomly selected resident does not have blonde hair

   = 1 - P (blonde hair)

   = 1 - 0.20

   = 0.80

Therefore, the probability is 0.16, 0.80 and 0.20.

For such more questions about probability

https://brainly.com/question/17089724

#SPJ4

round 87388 to the nearest thousand

Answers

87000 is the answer!

After the 7 is a 3, this number is below 5 therefore you round down

Answer:

To round a number to the nearest thousand, we first need to identify the thousands digit in the number. In this case, the thousands digit is 8, because 87388 is between 80000 and 90000.

To determine whether to round up or down, we need to look at the hundreds digit, which is 7 in this case. If the hundreds digit is 5 or greater, we round up. If the hundreds digit is less than 5, we round down. In this case, the hundreds digit is 7, which is greater than or equal to 5, so we need to round up.

To round up, we add 1000 to 87388, which gives us 88388. So, 87388 rounded to the nearest thousand is 88000.

the following sorting algorithm is stable and in runs in place. none of the others quicksort counting sort mergesort. true or false

Answers

A stable sorting algorithm is one that keeps the relative order of two equal elements. Quicksort is a sorting algorithm that has a high degree of instability, which means that it may alter the relative order of two equal components.

Which sorting algorithm is stable?

The Merge Sort, Timsort, Counting Sort, Insertion Sort, and Bubble Sort are just a few examples of popular sorting algorithms that are by their very nature stable. Others, like Quicksort, Heapsort, and Selection Sort, are erratic. Stable sorting algorithms can be modified to be more efficient.

Because we swap elements according on the location of the pivot, QuickSort is an unstable algorithm (without considering their original positions). A sorting algorithm is said to sort in-place if it never stores more than a fixed number of input array members outside of the array. If the order of elements with the same value is not altered by a sorting technique, it is stable. Binary insertion sort is the only stable algorithm available from the options offered.

Therefore the correct answer is false.

To learn more about algorithm refer to :

https://brainly.com/question/11302120

#SPJ4

In two or more complete sentences, describe the transformation(s) that take place on the parent function,
f(x) = log(x), to achieve the graph of g(x) = log(-3x - 9) - 1.

Answers

Answer:

The function g(x) = log(-3x - 9) - 1 is obtained from the parent function f(x) = log(x) through two transformations: a shift to the right and a shift downward. The shift to the right is achieved by multiplying x by -3 and subtracting 9, which results in a rightward shift in the function's graph. The shift downward is achieved by subtracting 1 from the final result, which results in a downward shift in the function's graph. These transformations result in a graph that is shifted to the right and downward compared to the graph of the parent function.

[tex]log( - 3x - 9) = log( 3( - x - 3)) \\ = log( 3) + log( - (x + 3))[/tex]

A vertical shift by 1 unit downwards

A vertical shift by log(3) units upwards

A horizontal shift by 3 units to the left

A reflection along the line x=-3

Write the statement "the sum of a number and 11.5 is more than −4.5" as an inequality.

−4.5 + b ≥ 11.5
−4.5 + b < 11.5
b + 11.5 > −4.5
b + 11.5 ≤ −4.5

Answers

An inequality that can represent the sum of a number and 11.5 is more than −4.5 is  b + 11.5 > −4.5 .

What is inequality?

In mathematics, a relationship between two expressions or values that are not equal to each other is called ‘inequality.’ So, a lack of balance results in inequality. For example, if you want to buy a new bicycle that costs 250 but you have 225. It is also an inequality as you are comparing two numbers that aren’t equal.

We use ‘=’ when two quantities are equal and when they are not equal we use the symbol ≠ to denote not equal. If two things are not equal, the first value can be either greater than (>) or lesser than (<) or greater than equal to (≥) or less than equal to (≤) the second value. So, as per the above example, 250 > 225.

Given :  the sum of a number and 11.5 is more than −4.5

Let us assume the number be "b"

according to question,

b + 11.5  is more than −4.

Thus, An inequality that can represent the sum of a number and 11.5 is more than −4.5 is  b + 11.5 > −4.5 .

Hence ,  b + 11.5 > −4.5 is the correct answer .

Learn more about Inequalities at :

https://brainly.com/question/24372553

#SPJ1

Answer:

Step-by-step explanation:

thx for the points

A restaurant wants to make sure that they are serving customers quickly enough. Every day for 10 days, they sample 16 random customers, and measure how long it is until the waiter shows up. Using this sample data, the company calculates the 3-sigma control limits as LCL = 3.5 minutes and UCL = 6.5 minutes.
What would be the LCL and UCL if the company uses 2-sigma control limits instead?
O LCL = 4.5 minutes and UCL = 5.5 minutes
O LCL = 4.5 minutes and UCL = 7.5 minutes
O LCL = 3 minutes and UCL = 7 minutes
O LCL = 4 minutes and UCL = 6 minutes

Answers

LCL would be 4 minutes and UCL would be 6 minutes if the company uses 2-sigma control limits instead.

Describe mean.

The average of a group of variables is referred to as the mean in mathematics and statistics. There are several methods for calculating the mean, including simple arithmetic means (adding the numbers together and dividing the result by the number of observations), geometric means, and harmonic means. The arithmetic mean, also known as the arithmetic average or simply the mean or average, is the sum of a set of numbers divided by the total number of numbers in the set. The collection frequently consists of a series of findings from a survey, experiment, or observational study.

Given

LCL = 3.5 minutes

UCL = 6.5 minutes

Mean = LCL + UCL/2

Mean = 3.5 + 6.5/2

Mean = 5

Standard deviation = UCL - LCL/6

Standard deviation = 6.5 - 3.5/6

Standard deviation = 0.5

LCL = 5 - 2(0.5)

LCL = 4

UCL = 5 + 2(0.5)

UCL = 6

LCL = 4 minutes and UCL = 6 minutes

To learn more about mean, visit:

https://brainly.com/question/10528201

#SPJ4

A circular rug is cut from a square piece of carpet. Each side of the square piece of Carpet is 40 inches long. After cutting out the circular rug, approximately how much carpet will be left over?

Answers

Answer:

Below

Step-by-step explanation:

Area of square - area of circle = remnant               area of circle = pi r^2

(40 x 40) - pi (20^2) = 343 . 4 in^2  left over

( this assumes the circle touches the edges of the square)

A card is drawn from a pack of 52 playing cards. Find the probability that the card will be a king, given that it is a face card. (The face cards are the jacks, queens, and kings. Enter your probability as a fraction.)

Answers

Answer:

Step-by-step explanation:

There are 4 kings in a deck of playing cards.

There are 52 cards in a deck.

So the probability is 4 out of 52.

Which is 4/52,

Which can be reduced to 1/13.

4 divided by 4 = 1 and 52 divided by 4 =13.

Evaluate 8a+3b-10+c^28a+3b−10+c
2
8, a, plus, 3, b, minus, 10, plus, c, squared when a=2a=2a, equals, 2, b=5b=5b, equals, 5, and c=4c=4c, equals, 4.
4

Answers

The solution is A = 37

The value of the equation A = 8a + 3b - 10 + c² is A = 37

What is an Equation?

Equations are mathematical statements with two algebraic expressions flanking the equals (=) sign on either side.

It demonstrates the equality of the relationship between the expressions printed on the left and right sides.

Coefficients, variables, operators, constants, terms, expressions, and the equal to sign are some of the components of an equation. The "=" sign and terms on both sides must always be present when writing an equation.

Given data ,

Let the equation be represented as A

Now , the value of A is given by

A = 8a + 3b - 10 + c²

When the value of a = 2 , the value of b = 5 and the value of c = 4 ,

The equation A is given as

Substitute the value of a , b and c in the equation , we get

A = 8a + 3b - 10 + c²

A = 8 ( 2 ) + 3 ( 5 ) - 10 + 4²

A = 16 + 15 - 10 + 16

On simplifying the equation , we get

A = 31 + 6

The value of A = 37

Therefore , the value of A is 37

Hence , The value of the equation A = 8a + 3b - 10 + c² is A = 37

To learn more about equations click :

https://brainly.com/question/19297665

#SPJ1

In right triangle ABC, altitude CD with length h is drawn to its hypotenuse. We also know AD = 12 and DB=3. What is the length of h?
Only sides/angles known are
Base= 12+3,
Angle= Right angle/90°.
No clue how to solve this. I tried many methods. everyone who’s asked this question on here did not get a good answer. Please explain how it is done and what theorem is used.

Answers

Answer:

h = 6

Step-by-step explanation:

h is the short leg for AD in ΔADC: AD = 12

h is the long leg for DB in ΔCDB: DB = 3

Hence:

12/h = h/3

3 * 12/h = 3 * h/3  ==> isolate h by multiplying 3 on both sides

36/h = h

h * 36/h = h*h  ==> multiply by h on both sides to remove fractions

36 = h^2

h = [tex]\sqrt{36}[/tex]

h = 6

Assume that a company uses a standard cost system and applies overhead to production based on direct labor-hours. It provided the following information for its most recent year:

Total budgeted fixed overhead cost for the year $ 300,000
Actual fixed overhead cost for the year $ 276,000
Budgeted direct labor-hours 60,000
Actual direct labor-hours 56,000
Standard direct labor-hours allowed for the actual output 58,000

What is the fixed overhead volume variance?

Multiple Choice
$20,000 U
$20,000 F
$10,000 U
$10,000 F
Group Ends

Answers

On solving the provided question, we can say that The $289,000 in fixed overhead that was used in production at that time

What are fixed overhead?

In accounting and economics, expenses for a firm are referred to as "fixed costs," often known as "indirect costs" or "overhead costs" since they are independent of the volume of goods or services the organization produces. They often have a periodic nature, such monthly rent or interest payments. These expenses are frequently capital costs as well.

The fixed overhead rate equals the budgeted amount Budgeted hours / Fixed overhead costs

Fixed overhead rate (predetermined) = 300,000/60,000

The fixed overhead rate (predetermined) is $5 per hour.

Applied Standard hours permitted with a predetermined overhead rate equals fixed overhead (fixed)

Fixed overhead applied = 57,800 * $5 per hour

$289,000 for applied fixed overhead

Therefore, $289,000 in fixed overhead was allocated to production during that time.

To know more about fixed overhead visit:

https://brainly.com/question/14989348

#SPJ1

The graph of the function f(x) = −1 + 0.5x is shown on the coordinate plane. For what value of x does f(x) = 2?

A.
x = -6

B.
x = 5

C.
x = 5

D.
x = 6

Answers

x = 6 is the value of x does f(x) = 2.

What is a function?

A relation between a collection of inputs and outputs is known as a function. A function is, to put it simply, a relationship between inputs in which each input is connected to precisely one output. Each function has a range, codomain, and domain.

Here, we have

Given function:  f(x) = −1 + 0.5x

We have to find the value of x does f(x) = 2.

For this, we put the different values of x and see what value satisfies the given function.

For x = -6

f(x) = −1 + 0.5(-6)

f(x) = -4

For x = 5

f(x) = −1 + 0.5(5)

f(x) = 1.5

For x = 6

f(x) = −1 + 0.5(6)

f(x) = 2

Hence, x = 6 is the value of x does f(x) = 2.

To learn more about the function from the given link

https://brainly.com/question/10439235

#SPJ1

Other Questions
when constructing an angle bisector, the compass must be used to make three arcs. do all three arcs need to have the same radius? explain. What two symbols does the Animal Farm flag have? What is mixed economy in economics? PLEASE HELP MECan someone please explain how the "-6000(1+1.1+1.1^2+...+1.1^7)" became "-6000(1.1^8/0.1)"????Thank you very much which of the following is a true statement? multiple choice a remainder interest held by the decedent at the time of death is not included in the decedent's gross estate. the value of a remainder interest depends in part on the section 7520 interest rate at the time of death. the value of a remainder interest in a life estate is independent of the age of the life tenant. the value of a life estate does not depend upon the age of the life tenant. none of the choices are true. 16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word? An organization whose members have a common cause for which they seek to influence public policy is called an ____. how did the Erie canal help the united states economy? give an example of culturaul diffusion found in the today explain where you would find the example and where it originated What is demand-pull caused by? 4. Give a brief summary (two or three sentences) of what you think the Chorus is talking about overall on pages 10, 11 and 12. (3 points) Why do expansionary policies lead to inflation? There are four requirements to becoming a qualified nursing assistant who can receive a delegation. Write the correct words in "c" and "d" below.a. Be either a NA-R or NA-C in the state of Washington.b. Have completed the education requirements for delegation.c. Be willing to perform the) to be delegated.d. Demonstrateto perform the specific tasks correctly without directsupervision of the delegating RN. People who favored presidential What is the example of unique number? Juan is trying to factor x + 7x+3 and makes the following table.- see picture-Juan concludes that x + 7x+3 cannot be factored using integers.a. Is Juan correct? b. Comment on Juan's strategy and improve it if possible. Consider the linear equation. 5x+6y=15 Which point represents a solution to the equation?