Answer:
Plant cells have a large, singular vacuole that is used as a storage and to maintain the shape of the cell. Even though animal cells have vacuoles, they are smaller. Plant cells have a cell wall and a cell membrane. Animal cells only have a cell membrane, and no cell wall.
Explanation:
What is the importance of Mitosis in both Prokaryotic and Eukaryotic Cells
Answer:
Mitosis is the process by which the overwhelming number of cell divisions in eukaryotic organisms occur. Eukaryotes (animals, plants and fungi) typically consist of literally trillions of cells, and at any time, countless worn-out, dead or irreparably damaged body cells need to be replaces. Mitosis is the eukaryotic answer to binary fission in the single-celled prokaryotes, which is similar on the surface but simpler at the level of details.
Explanation:
What is the major difference during cytokinesis in eukaryotes with or without a cell wall?
Answer:
Cytokinesis in eukaryotic animal cells do not have a cell wall, it occurs through a strangulation process carried out from the plasma membrane, this process is called segmentation. Plant cells are characterized by cytokinesis based on septate, since the cell wall does not allow strangulation.
Explanation:
Cytokinesis means: cell division, it is a cellular process parallel to mitosis whose purpose is the division of the stem cell's cytoplasm between daughter cells. In animal cells, cytokinesis occurs by cleavage. At the end of anaphase and during telophase, the central part of the cell narrows, forming the segmentation groove, which deepens (strangulation). Plant cells, as they lack centrosomes, will form the achromatic spindle from two polar caps. In this case, cytokinesis does not occur by strangulation, but a cell wall is formed between the two daughter cells. This septum, called a fragmoplast, is formed from vesicles from the Golgi apparatus.
The major difference during cytokinesis in eukaryotes with or without a cell
wall is in the formation of cell plate in cells with cell wall while in animal
cells cytokinesis occurs through the formation of a cleavage furrow.
Cytokinesis is the process of cell division in which the cytoplasm divides
into two. Plants have cell walls while animals lack cell walls.
Animal and plant cells form cleavage furrow and cell plate respectively
which aids division into two equal parts.
Read more about Cytokinesis here https://brainly.com/question/5615155
During photosynthesis, water and carbon dioxide become glucose and oxygen.
True
False
Answer:True
Explanation:
During photosyntheses
6co2+12H2O=glucose (C6H12O6)+6O2+6H2O
Answer: The correct answer is (True)
Explanation:
A stiff layer on the outside of the cell to provide protection and helps the cell maintain its shape. Not in animal cells. BTH-This is in science.
Answer:
Cell Wall
Explanation:
Plant cells have cell walls, as animal cells do not. :)
Answer:
Cell wall
Explanation:
This is found outside the cell membrane. Its main purpose is to provode protection and to maintain its shape.
HOPE THIS HELPED
Humans always have a negative impact on the environment.
Please select the best answer from the choices provided
T
F
What is the primary cause of deforestation?
Select one:
a. Conversion of land for crops and pasture land
b. Harvesting for fuel wood
c. Paper industry pressures
Answer: B
Explanation: Googl/What is the primary cause of deforestation?
Skim the headings and bold words in this section. Write four steps scientists might take to solve a problem.
Answer:
1) Create a hypothisis 2) Create experiment 3) collect data 4) write conclusion
The four steps that a scientist uses to solve a problem are creating hypothesis, experiment, data sorting and writing conclusion.
What are hypothesis?A hypothesis is an elaboration posited for a characteristic. The scientific technique requires that a hypothesis be testable in order for it to be considered a scientific hypothesis.
Scientists typically base scientific hypotheses on previous findings that cannot be adequately explained by existing scientific theories.
Any process that co-ordinate system data into some defined order to make it simpler to understand, analyze, or visualize is referred to as data sorting.
The conclusion is the final section of an academic essay. The conclusion should restate your response to the question and briefly summarize key points. It does not contain any new points or information.
A scientist solves a problem by developing a hypothesis, conducting an experiment, sorting data, and writing a conclusion.
Thus, by using these steps, scientist can come to an end for the problem.
For more details regarding hypothesis, visit:
https://brainly.com/question/17173491
#SPJ2
Why are construction sites considered major sources of water pollution?" 1 point
They introduce high levels of salt into local water sources.
Soil erosion rates accelerate dramatically, impacting water quality in streams and
rivers
They cause sinkholes to form, which pollute local water sources.
Sawdust leaches into the soil, causing the water that runs into rivers and streams to
be cloudy and full of particles
Soil erosion rates accelerate dramatically, impacting water quality in streams and rivers.
Answer:
B
Explanation:
What are the two products made during the electron transport chain?
Answer:
Water and ATP
Explanation:
Answer:
H20 and ATP
Explanation:
Hope this helps :)
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
Answer:
I don't know the answer
Explanation:
is is this even a question cos I don't think so.
which of the following are part of the central nervous system?
Answer:
The central nervous system is made up of the brain and spinal cord
Explanation:
ion if that's the answer you were looking for but here go.
Only answer if you know the answer
Answer:
B. A helicase enzyme unwinds the DNA molecule, then corresponding nucleotides are added to the separated original strand forming two separate semiconservative molecules
Explanation:
DNA Replication is an important phenomenon as far as cell division is concerned. It is the process whereby a DNA molecule doubles its content or forms two DNA molecules from one.
In the semi-conservative model of DNA replication, an enzyme called DNA helicase unwinds the double stranded DNA molecule into two single strands. The single strands are then used as template for DNA polymerase to synthesize another molecule of DNA. Hence, two separate DNA molecules comprising of one old strand and one new strand.
PLS HELP ITS DUE SOON !! IT WOULD MEAN THE WORLD IF U CAN !
please helpp if you dont know the answer that's ok but please helpp
Is a seed a living organism
Answer:
Yes they are living organisms
What is seed dispersal? Name some agents of seed dispersal
Answer:
The Process by which seeds spread over a wide area is known as seed dispersal..
some agents
Air
water
animals
etc..
Answer:
Seed dispersal is the movement, spread or transport of seeds away from the parent plant.
The most common methods are :
wind, water, animals, explosion and fire.
Guys i need this quickly! i promise to give brainliest. This is way overdue too!
In a cross between a round seed (Rr) plant and wrinkled seed plant (rr), what percent of the offspring would have round seeds?
(Hint: create your own Punnett square on scratch paper!)
Answer:
50% of them would have round seeds
Answer:
When the given parents are crossed, they produce offspring with the genotypes rr ( showing wrinkled seeds) and Rr ( round seeds) in the ratio 1:1. Thus, the probability that the offspring will have wrinkled seeds is 50 percent
Explanation:
Apply: Which type of moth do you think was more common before the 19th century, when most trees were light in color?
Answer:
light moths
Explanation:
yes their were most light color in most trees
Light moths was more common before the 19th century, when most trees were light in color.
What are the functions of light moths?Insects, like moths, are drawn to bright lights because they make it difficult for them to navigate. It's a common sight, particularly in the summer: The lights, like lamps, were surrounded by moths and other insects.
Most nocturnally dynamic moths are drawn to light, a peculiarity known as sure phototaxis. However, because they are phototactic, some species, like the Old Lady (Mormo maura), tend to avoid it.
No one really knows why moths are drawn to light, but there are a few theories, and they also like the smell of fermented sugar and ripe fruit, which are both food sources.
Learn more about light moths:
https://brainly.com/question/14452844
#SPJ3
URGENT: Why does an increase in carbon dioxide increase the quantity of hydrogen ions in blood?
A.) When carbon dioxide mixes with water, it loses two electrons?
B.) When carbon dioxide mixes with blood, it slows the transfers of hydrogen ions.
C.) When carbon dioxides dissolves in water, it releases hydroxides.
D.) When carbon dioxide is dissolved in water, it forms carbonic acid?
Answer the more carbonic acid in the blood, the lower the pH level is. The amount of carbon dioxide removed from the blood messes with the pH level of the blood. this increases the amount of hydrogen ion concentration in blood and it decreases the blood pH levels
Explanation:
what is anaerobic respiration
Answer:
Anaerobic respiration is the type of respiration through which cells can breakdown sugars to generate energy in the absence of oxygen.
During a period of drought, members of a community may volunteer to water their lawns every other day, rather than daily. The most important benefit of this action is - It adds nitrogen to the soil It fertilizes the soil It reduces air pollution It conserves the groundwater supply
Answer:
hi love you have a nice day
Explanation:
3.4.3 Lab: Why are cells so small?
Answer: The important point is that the surface area to the volume ratio gets smaller as the cell gets larger. Thus, if the cell grows beyond a certain limit, not enough material will be able to cross the membrane fast enough to accommodate the increased cellular volume. ... That is why cells are so small.
Explanation: because they can absorb nutrients much more efficiently. Because they are smaller they can efficiently absorb enough food. ... When a cell doubles in size the volume increases much more then the surface area, which is why large cells cannot receive enough food efficiently for their volume. Cells are small because they are more efficient as smaller entities. Information within small cells is transmitted more quickly and efficiently than within larger cells. ... Thus a higher cell surface area-to-volume ratio, i.e., smaller cell size, is desired for most efficient cellular activity.
The cells are so small because their small size allows them to take in food and get rid of the waste.
The cells are the basic structural and functional unit of all organisms on earth except the Viruses. The size of the cell is so little it allows the organism to maximize the ration of surface area to volume. Smaller cells are expected to have greater ratio which promotes more molecules as well as ions to move across the plasma membrane.The small size of the cell facilitate to get the nutrients inside the cell and waste outside the cell quickly. Hence, small size of cell facilitates to get food inside and get rid of waste.Learn more about cell:
https://brainly.com/question/3142913
The lymph nodes in your neck may become swollen when you have a bacterial infection in your throat as a result of:
clotting factors in the blood.
clotting factors in the blood.
the rapid division of bacteria in the lymph nodes.
the rapid division of white blood cells in the lymph nodes.
the rapid division of red blood cells in the lymph nodes.
Help pls
Answer:
i could be wrong but i think its
the rapid division of bacteria in the lymph nodes.
the rapid division of white blood cells in the lymph nodes.
Which of the following is true about CO_2CO
2
?
A
It does not have much effect on the climate.
B
It is a greenhouse gas.
C
Very little CO_2CO
2
is being emitted now.
D
If we cut CO_2CO
2
emissions by half, the temperature will stop rising.
Answer:
B.
Explanation:
It has a huge impact on the environment
It is being emitted in large amounts
And if we cut our carbon emissions in half it would delay the risk of raising the global temperature of 1.5 degrees Celsius but half of it would still pumped into the atmosphere along with the carbon dioxide already in the atmosphere.
But it is a greenhouse gas because it helps trap the heat remaining in Earth's atmosphere which is why the Earth is warming.
CO2 is a greenhouse gas.
what are greenhouse gases?
Greenhouse gases are gases in the atmosphere that affect the energy balance of the planet. The greenhouse effect is caused by them. Carbon dioxide (CO2), methane, and nitrous oxide, the most well-known greenhouse gases, can all be present in low concentrations in the environment.
The greenhouse gases in the atmosphere trap heat and warm the earth.
Carbon dioxide, methane, nitrous oxide, and water vapor (all of which exist naturally) are the principal greenhouse gases, as are fluorinated gases (which are synthetic).
Carbon dioxide (CO2) is released into the atmosphere as a result of the combustion of fossil fuels (coal, natural gas, and oil), solid waste, trees, and other biological materials, as well as chemical processes (e.g., manufacture of cement). As part of the biological carbon cycle, carbon dioxide is absorbed by plants and released from the atmosphere.
hence, CO2 is a greenhouse gas.
To know more about greenhouse gas here
https://brainly.com/question/14131369
#SPJ2
Phototropism -
Definition:
Sentence:
Picture:
Can someone please help me?!
Answer:
Phototropism is the type of tropism where an organism responds to light as the stimulus.
Forexample, a plant enclosed in a box with a small hole and placed in light, the tip of the plant will grow towards the hole
Why is the nucleus called the "control center" of the cell?
3. What type of bond holds the backbone together?
A. Covalent
B. Hydrogen
C. lonic
Answer: The answer is B
Explanation:
when a carbohydrate chain is attached to a protein what is the structure called
Which device works similar to the way kidneys work in the human body? HELP IM BEING TIMED!!!
Hemodialysis uses a machine to pull blood out of the body, filter it, and pump the clean blood back into the body again. The actual filtering happens in a part of the machine called a dialyzer, or artificial kidney. The dialyzer has two parts. One part is for blood.
i hope this is right-
Word Bank: Slowly, Within, Different, Transmitted, Densely, Sonar, Solids, Absorption, Bounces
Mechanical waves react to different mediums in different ways. Some mechanical waves are _________________ through a medium, meaning they pass through the medium. The way in which waves are transmitted depends upon the type of material. In ________________, mechanical waves travel rapidly, because the molecules are ___________________ packed. In liquids and air, however, mechanical waves travel more _________________, because the molecules are spread farther apart.Other mechanical waves are reflected off a medium. When a mechanical wave is reflected, it ______________ off the medium and then travels in a ______________ direction. ______________ is an application that uses sound wave reflection to determine how deep water is. A third way mechanical waves react to a medium is _______________. When a mechanical wave is absorbed, it remains __________________ a medium and is not transmitted to another medium.
Answer:
Mechanical waves react to different mediums in different ways. Some mechanical waves are TRANSMITTED through a medium, meaning they pass through the medium.
The way in which waves are transmitted depends upon the type of material. In SOLIDS, mechanical waves travel rapidly, because the molecules are DENSELY packed. In liquids and air, however, mechanical waves travel more SLOWLY, because the molecules are spread farther apart.
Other mechanical waves are reflected off a medium. When a mechanical wave is reflected, it BOUNCES off the medium and then travels in a DIFFERENT direction. SONAR is an application that uses sound wave reflection to determine how deep water is.
A third way mechanical waves react to a medium is ABSORPTION. When a mechanical wave is absorbed, it remains WITHIN a medium and is not transmitted to another medium.
The fill in the blanks will be filled with TRANSMITTED, SOLIDS, DENSELY, SLOWLY, BOUNCES, DIFFERENT, SONAR, ABSORPTION, WITHIN
Mechanical waves:react to distinct mediums in various ways. Some mechanical waves are TRANSMITTED via a medium, meaning they pass via the medium. The way in which waves are transmitted based upon the type of material. In SOLIDS, mechanical waves travel rapidly, due to the molecules are DENSELY packed.
In liquids and air, however, mechanical waves travel more SLOWLY, due to the molecules being spread farther apart.Other mechanical waves are reflected off a medium.
When a mechanical wave is reflected, it BOUNCES off the medium and then travels in a DIFFERENT direction. SONAR is an application that uses sound wave reflection to determine how deep water is.
A third way mechanical waves react to a medium is ABSORPTION.When a mechanical wave is absorbed, it remains WITHIN a medium and is not transmitted to another medium.
Learn more about the waves here: https://brainly.com/question/3102539