Answer:
Hunting in groups, keen eyesight, chemicals to paralyze prey
Explanation:
Answer:
Hunting in groups
Keen Eyesight
and Camouflage
Explanation:
These are all the main adaptations that predators are born with. The rest of them do not help them at all. PLease give brainliest :)
what is the function of mitrochondria
Answer: Mitochondria are membrane-bound cell organelles (mitochondrion, singular) that generate most of the chemical energy needed to power the cell's biochemical reactions. Chemical energy produced by the mitochondria is stored in a small molecule called adenosine triphosphate (ATP).
Explanation:
Answer: The mitochondrionis a double membrane-bound organelle found in most eukaryotic organisms. Some cells in some multicellular organisms lack mitochondria (for example, mature mammalian red blood cells). A number of unicellular organisms, such as microsporidia, parabasalids, and diplomonads, have reduced or transformed their mitochondria into other structures.
Explanation:
Why does DNA need to make a transcript of itself and what is this transcript called?
Answer:
DNA needs to be transcribed itself as a mechanism for the multiplication of its molecules, and this transcription process is called DNA replication.
Explanation:
DNA replication is a mechanism that allows it, from one molecule, to obtain two molecules identical to the original. In other words, it transcribes the information from one of its strands to a new strand.
The process of DNA replication is semi-conservative, because each new molecule is formed by an original strand and a new strand, which contributes to maintaining the integrity of the genetic information.
As a requirement of the cell division process, as mitosis, DNA must replicate so that each daughter cell has the same genetic information as the original cell. This is why replication of this nucleic acid occurs.
In the seventeenth century, Francesco Redi performed experiments using raw meat placed in jars.
• Half of the jars were covered, and half were left open,
• Redi noticed that the meat in the sealed jars did not have maggots, but the meat in the open jars did have maggots.
Redi concluded that only flies could make more flies,
.
Which part of the cell theory corresponds to Redi's findings?
Answer: B
Explanation:
''New cells come from the existing cells'' is a part of the cell theory which corresponds to Redi's findings.
Experiment performed by Francesco RediFrancesco Redi conducted an experiment in which he showed that living organisms come from other living organisms. This worked combine with the work of other later scientists, helped to develop the third part of the cell theory which is cells come from other living cells.
Learn more about cell theory here: https://brainly.com/question/3966602
Which macromolecule plays a central role as an energy source?
Answer:
Carbohydrates
Explanation:
Ex: Glucose (monosaccharide)
7th Grade Science Yes i will brain list
What is a convection current?
a current in a fluid that results from convection.
(Many points) PLS HELP QUICK dont guess answer pls ad dont say random answers for points pls
Cheng made a chart to list the functions of certain fish structures.
(The image below)
Which headings correctly complete the chart?
X: Fin
Y: Swim bladder
Z: Lateral line
X: Fin
Y: Lateral line
Z: Swim bladder
X: Lateral line
Y: Swim bladder
Z: Fin
X: Lateral Line
Y: Fin
Z: Swim bladder
Answer:
x:fin
y:lateral line
z:swim bladder
Answer: The answer for this question is Fin for x Lateral line for y and
swim bladder for z
Explanation:
I took the test
write the code for RNA from this DNA STRAND :
AAAAAATTTTTTCCCGGGGTTTATATATC
Answer:
UUUUUUAAAAAAGGGCCCCAAAUAUAUAG
Explanation:
All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)
the receptionist said to the manager,'I have booked your flight tickects for Monday'. change into imdirect speech
Answer:
The correct answer is- The receptionist told the manager that he had booked his flight tickets for Monday
Explanation:
Indirect speech is the expression any statement of a consverstaion that occured in past without quoting explicitly. Indirect speech is the stating any quoted statement in simple statement. In this type of speech some grammer and certain noun and pronoun change accordingly.
So the correct indirect speech of the receptionist said to the manager,'I have booked your flight tickects for Monday'. would be The receptionist told the manager that he had booked his flight tickets for Monday
Do humans and plants get their nutrients the same way?
Answer:
As humans require a lot of nutritious food for the growth, same way plants also require nutrients in order to grow. Plants which are grown in the soil gets all the required nutrients from the fertilizers and from the land where natural nutrients are stored.
Bacteria reproduce in a process called binary fission which of the following is true about binary fission?
Interphase
21. Before Meiosis, comes
cell activities, like making
During interphase, the ce
for example.
22. Uncoiled stringy DNA is called
Can u pls help me this is due today I will give brainliest
Answer:
exmaple z
Explanation:
it is the heaviest so it would require more to push
What is one way during the G0 phase that a mistake during the cell cycle could result in problens for the G0 phase?
The G0 phase (G sub zero) or the zero of G is a period of the cell in which it remains in a vegetative state.This phase is related to the "Post-Mitotic" state because they are in a non-dividing phase outside of the cell cycle.
Which muscle cells are often considered as G0 phase cells?Poly-nucleated muscle cells that do not undergo cytokinesis are often considered G0 phase cells.The G0 phase is seen as a distinct and quiet stage that occurs outside the cell cycle.
Mitosis is the procedure with the aid of which a mobile replicates its chromosomes after which segregates them, producing two identical nuclei in training for mobile division. Mitosis is generally followed by way of same department of the mobile's content material into daughter cells that have identical genomes.
The two phases of cell cycle are interphase in which DNA replication occurs, 3 stages of interphase are: G1 phase, S phase and G2 phase and mitotic in which division occurs phase. Mitosis occurs after the completion of DNA replication and doubling of chromosome number and cell contents and after mitosis, two daughter cells are produced of equal number of chromosomes.
Therefore, The G0 phase (G sub zero) or the zero of G is a period of the cell in which it remains in a vegetative state.This phase is related to the "Post-Mitotic" state because they are in a non-dividing phase outside of the cell cycle.
Learn more about mitosis on:
https://brainly.com/question/29776367
#SPJ5
1. Energy transfer is inefficient between trophic levels because
A. Molecules are fully digested from each trophic level.
B. Dead organisms and waste are recycled throughout the trophic levels.
C. Organisms within a trophic level are fully consumed.
D. All organisms within a trophic level die.
2. Primary productivity is defined as
A. The rate that plants and other photosynthesis organisms produce organic compounds.
B. The process where green plants and some other organisms convert light energy into chemical energy using carbon dioxide and water.
C. The overall amount of energy captured by plants and other photosynthetic organisms by the chloroplast.
D. The adjusted amount of energy in an ecosystem due to energy use by organisms for respiration.
Thanks if you help, It's highly appreciated. :-)
Answer: b dead organisms And waste are recycled throughout the tropic levels.
Explanation:
Answer:
part 2
the rate that plants and other photosynthetic organisms produce organic compounds.
Explanation:
:)
ANY ALT PEOPLE HERE
Answer:
LOL THIS IS NOT THE PLACE FOR THIS XDDDDDD
Explanation:
Answer:
thanks for the points
Explanation:
Which of these is an advantage of fossil fuels? *
O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable
Answer:
reliable
Explanation:
Explanation:
Fossil fuels are a non-renewable resource.
Why are the rocks on the bottom folded but the top ones are not? What could’ve caused this?
Answer: The basic answer could be because of the tectonics plates.
Explanation: Because when two forces act towards each other from opposite sides, rock layers are bent into folds.
Typically, sedimentary rocks are arranged in layers, one on top of the other, the oldest items are listed last, followed by the youngest, this is the concept of "superposition.
Why are rocks folded?Erosion has removed the top layers of the rocks, resulting in the formation of valleys and hills, the top layer might be penetrated with sufficient power. The plates might shift due to erosion, and plate movement.
Many of the stratified rocks, however, are no longer horizontal, we know that sedimentary rocks that are not horizontal either were created in unique ways.
Therefore, more frequently, were shifted from their horizontal position by subsequent processes, such as tilting during episodes of mountain construction, thanks to the Law of Original Horizontality.
Learn more about rocks, here:
https://brainly.com/question/29561452
#SPJ2
What size molecules can pass through a cell membrane by a process called passive transport?
Answer:
diffusion and osmosis
Explanation:
lipid_ soluble substance
through lipid baleyer
through protein channel
Transported proteins carry small substances like water, amino acids, and charged ions. One to fifteen angstroms is the range in molecule size that can pass through the membrane. The easier it is for a molecule to move across the cell membrane, the smaller it is.
What is cell membrane ?All cells have a cell membrane, also known as a plasma membrane, which separates the interior of the cell from the external environment. A semipermeable lipid bilayer makes up the cell membrane. The movement of materials into and out of the cell is controlled by the cell membrane.
Small molecules or ions can traverse the cell membrane passively without the cell providing any energy. The three basic types of passive transport are osmosis, assisted diffusion, and diffusion.
Gases like oxygen and carbon dioxide, as well as small hydrophobic compounds, quickly traverse membranes. Water and ethanol are examples of small polar molecules that can move across membranes, though more slowly.
Thus, The easier it is for a molecule to move across the cell membrane, the smaller it is.
To learn more about cell membrane, follow the link;
https://brainly.com/question/13524386
#SPJ2
What is the main function of the smooth and rough Endoplasmic Reticulum in a cell?
Answer:
Smooth endoplasmic reticulum provides vesicles for the Golgi apparatus whereas rough endoplasmic reticulum provides biochemical for the Golgi apparatus. Both smooth and rough endoplasmic reticulum helps in the synthesis and storage of proteins.
Hope this helped!
MULTIPLE CHOICE QUESTION
Are a majority of the problems associated with down syndrome a result
of an over or under expression of chromosome 21?
under
over
Pls help me
10 points
If a defendant appeals the verdict from a state court of last resort, which
court would most likely hear the appeal next?
A. An intermediate appellate court
B. The U.S. Supreme Court
C. A federal district court
D. A municipal court
SUBMIT
Answer:
b
Explanation: peeps in washington are going crazy.
how do you think the idea of sustainability influences the work of foresters?
help me
Someone help me match the last two to their definition
Hypotonic and Isotonic
20 points and will mark brainliest!! Explain how you got it!
Answer:
OF COUSE IT C
Explanation:
Answer:
C
Explanation:
I think the answer is C.
The different kinds of water effects the water and the sunlight. This helps show how much water and sunlight each plant gets and it will bring results.
I hope this helps you! Have a great day!
Do all plants respond the same to all abiotic factors?
Answer:
Light intensity: limited light will limit photosynthesis. This will affect the distribution of plants, and therefore the distribution of animals that eat plants. ... Temperature: temperature is a limiting factor for photosynthesis - and low temperature therefore limits growth of plants.
what direction was the texas annexation in?
7. What is a layout of chromosomes in humans in order from largest to smallest with the
sex chromoosomes at the end called?
Answer:
Look down!!! ;)
Explanation:
In a human karyotype, autosomes or “body chromosomes” (all of the non–sex chromosomes) are generally organized in approximate order of size from largest (chromosome 1) to smallest (chromosome 22). However, chromosome 21 is actually shorter than chromosome 22.
Hope this helps!! ;)
Which term describes a pure substance that is made up of only one type of atom?
O matter
Orock
O compound
o element
Which best describes the relationship between DNA, genes, and chromosomes?
DNA are segments of genes that form tight coils called chromosomes.
Genes are segments of DNA that form tight coils called chromosomes.
Chromosomes are segments of DNA that form tight coils called genes.
Genes are segments of chromosomes that form tight coils called DNA.
Answer:
genes are segments of chromosomes that form tight coils called dna
The statement that best describes the relationship between DNA, genes, and chromosomes is as follows:
Genes are segments of chromosomes that form tight coils called DNA.Thus, the correct option is D.
What is Chromosome?A Chromosome may be defined as a thin thread-like structure that appears during the process of cell division. Such types of thread-like structures are significantly present in the nucleus of the cell.
Chromosomes are made up of DNA, RNA, histones, and some non-histone proteins. Chromosomes were first discovered by E. Strausburger in 1875.
Genes are small stretches that significantly considered the segments of chromosomes. Together they form a tightly coiled structure remarkably known as DNA. Genes carry nucleotide sequences that can produce functional enzymes or proteins.
All such parts carry genetic information with respect to the existence of organisms on the basis of morphology and function.
Therefore, the correct option for this question is D.
To learn more about Chromosomes, refer to the link:
https://brainly.com/question/11912112
#SPJ6
Certain gene mutations can cause genetic disorders. However the same gene can also have a positive effect. The genetic mutation that led to sickle cell anemia can also give its carriers protection from which of the following diseases?
A.
strep throat
B.
Type I diabetes
C.
malaria
D.
hemophilia
Answer:
its malaria
Explanation:
I got it wrong and it showed me that it was malaria