Please help ASAP thanks! 30 points to people!

Please Help ASAP Thanks! 30 Points To People!

Answers

Answer 1
I think C
because before agent Egypt start officially using coins as their official currency in 500 BC, D Gyptian‘s use a system of value based on the weight of various metals like silver and copper
Answer 2

Answer: C

Explanation:

It C because they started officially using coins as the r official currency in 500 BC which the egyptians used a system of value based on the weights of various silver and other metals.


Related Questions

Challenges of District Assemblies in Ghana

Answers

Answer:

please mark as brainliest!!

Explanation:

District assemblies are unable to generate enough money for development, as government subventions are woefully inadequate. Inadequately trained staff is also one major problem facing district assemblies.

Since 2012, the country is divided into 275 single-member constituencies.

District assemblies are unable to generate enough money for development, as government subventions are woefully inadequate. ii. Inadequate trained staff is also one major problem facing district assemblies.

economics unit 5 vocab

Answers

Answer:

ummm

Explanation:

attempts by the federal govt to keep the economy healthy; includes monetary and fiscal policies         Stabilization Properties

percentage of the civilian labor force that is unemployed but is actively looking for work             Unemployment Rate

condition of the economy when the unemployment rate is lower than a certain percentage established by economists' studies       Full Employment

transactions by people who do not follow federal and state laws with respect to reporting earnings       Underground Economy

if you need more let me know

write about two similarities between the volunteer and the teachers in short. ​

Answers

Answer:

we may need to pay but volunteer are free helping.

Volunteer teacher are their for a temporary time or they are also called substitute and the teacher is one who is their for a long time4 to 5 years or more

how is the topography of the earth​

Answers

The features of the topography on the earth are different around the world because every area has various characteristics.

URGENT‼️‼️ I NEED IT RIGHT NOW (I will give brainliest). How has the role of the citizens in Russia changed since the fall of Communism & the Soviet
Union?

Answers

Answer:

The Russian Federation had multiple economic reforms, including privatization and market and trade liberalization, due to collapse of communism. Though the economy is much more stable compared to the early 1990s, inflation still remains an issue for Russia .

In order to understand the consequences related to the collapse of the Soviet Union, it is critical to first examine the overarching causes for the USSR’s downfall. Gorbachev’s loosening of governmental power created a domino effect in which Eastern European alliances began to crumble, inspiring countries such as Estonia, Lithuania and Latvia to declare their independence. The Berlin Wall fell on November 9, 1989, leading East and West Germany to officially reunite within a year, ending the Cold War. Once the Berlin Wall fell, citizens in Eastern European countries such as Czechoslovakia, Bulgaria and Romania staged protests against their pro-Soviet governments, hastening the collapse of communist regimes across the former Soviet bloc. Other countries—such as the Republic of Belarus, the Russian Federation and Ukraine—followed suit, creating the Commonwealth of Independent States. By the end of 1989, eight of the nine remaining republics had declared independence from Moscow, and the powerful Soviet Union was finally undone. By the summer of 1990, all the formerly communist Eastern European officials had been replaced by democratically elected governments, setting the stage for the region’s reintegration into Western economic and political spheres.

Explanation:

Write an informative essay analyzing the effects the Civil War had on Americans and their ideas about freedom.

Answers

Answer:

The Civil War was an armed confrontation that took place between 1861 and 1865, between the states of the North, abolitionists and members of the Union; and the states of the South, slavers and grouped in the Confederation. During this conflict, more than 600,000 Americans died, which constituted the most lethal war that took place in the United States. Ultimately, the Union was victorious, and slavery was abolished throughout the country.

This war forever changed the concept of freedom in the country, as from this event began to be included within this concept to the entire population of the nation, and not just whites. In addition, it was a kind of continuity of the American Revolution, as it extended the natural rights of life, liberty and the pursuit of happiness to members of society who until then did not enjoy those rights.

Answer:

In the beginning when America was uniting and trying to form its official government the northern states and the southern states had already different greatly from each other. The North was industrializing and working on expanding west and the South was booming with farming and its famous cash crop. The North wanted to abolish slavery and the South did not. Since the North and South had so many differences and could not keep a steady compromise, heavy tensions arose between the North and the South which then caused the Southern states of America to decide to leave the American Union and create their own Southern Confederacy. This tore our nation apart. The American Civil War had begun and the very people that were once neighbors had each…show more content…

For example, farming was the main source of income for the Confederate states. The main southern chief crop which came to be known as King Cotton, accounted for 57% of all U.S. exports (“Civil War”). However, in order to produce these large amounts of cotton, the southern Confederate states depended heavily on slave labor. Since cotton production began to dominate and fuel the southern economy, the South felt that they did not need to industrialize like their northern neighbors did. This caused the South to manufacture very little goods and caused them to purchase manufactured goods from the industrialized North or to purchase imported goods from overseas.

Unlike the Confederate South, the North decided to not utilize slave labor like the South did because their economy did not call for farming that required large amounts of labor for rapid production. The Union also decided to not utilize slave labor because slave labor was against many of the northerner’s morals. Since the North was industrialized and they manufactured goods, they had to compete with other manufactures overseas. To demolish competition from the imported goods from overseas, the northerners demanded high tariffs on the imported goods so that more people will buy the manufactured goods from the North instead of the now more expensive imported goods from overseas. The

Explanation:

Participants in an experiment by Toi and Batson listened to a tape recording in which a student (Carol) in their Introductory Psychology class described an accident that caused her to fall behind in the course. Some participants were encouraged to empathize with Carol, whereas others were encouraged to listen objectively to the interview. Half of the participants thought Carol was in their section of the class; the others thought she was in another section. When participants:______.
a. empathized with Carol, most participants helped whether she was in their section.
b. empathized with Carol, most participants helped only when she was in their section.
c. did not empathize with Carol, most participants helped when she was not in their section.
d. did not empathize with Carol, most participants helped whether or not she was in their section.

Answers

Answer:

a. empathized with Carol, most participants helped whether she was in their section.

Explanation:

Baton recognised that sometimes people helped others out of their own self interests. In this experiment, there were two groups, the high empathy group and the low empathy group.

Those in the high empathy group were found to be equally likely to help Carol in any circumstance, while those in the low empathy group only helped her out of their own self interests. As seeing Carol In school everyday made them have a sense of guilt if they refused to help.

Spanish settlements that served as centers for teaching Native Americans the Spanish religion and ways of living were called...

Answers

Answer:

missions

Explanation:

An employment-related decision that has a discriminatory effect on a particular group may be legally defensible if it is based on __________.
a. disparate impact
b. disparate treatment
c. affirmative action
d. business necessity

Answers

The correct answer is A) disparate impact.

An employment-related decision that has a discriminatory effect on a particular group may be legally defensible if it is based on disparate impact.

That is why there is legislation in the United States that protects workers and employers. That is why employers of a protected minority in the workplace are affected by the decisions of the managers or owners. For example, if a group of African Americans or Hispano people are not hired by their color of skin, race, or nationality. The same case if the minority protected group has a different sexual orientation. The EEOC or Equal Employment Opportunity Commission exists to protect the labor rights of minority groups in the United States, so everybody could have a fair chance to thrive in the workplace.

What year was Manifest Destiny used the first time?
1845
1800
1860

Answers

1845 thisneedstobelike20characterslongorsumforsomereasoneventhoitsliterally1845

Label where these words should go on the picture : Convergent, Divergent, Volcanic Arc, Trench

Answers

Answer:

Convergent should go above ocean floor and continent, because the two forces are converging together.

Divergent should go above ocean floors, because these two ocean floors are diverging apart. Trench should precisely go below this point because these divergent forces are what are forming the trench.

Finally, the Volcanic Arch should go above what looks like a schematic mountain range, in the same place where convergent should be written.

Answer:

1 3 4 2

Explanation:

The primary way an ethnographer learns about a culture is to live according to that society's standards. This is known as what type of research?

interviewing
surveying
field work
archival research

Answers

Answer:

I believe it is referred to as field work.

Explanation:

Which of these explanations best describes the Mandate of Heaven? a. The belief only people who were descendants of the Zhou Dynasty should become nders b. The belief that everything in nature is ordained by the heavens. The belief if a person lived an ethical life, he or she would be rewarded the dat d. The belief that the heavens approved of the emperor and his dynasty​

Answers

Answer:

b

Explanation:

I will give Brainlyist
For the first one



Read this excerpt from "Why Are They Called Black Holes?"

The gravity of a black hole will swallow matter and light that drift close enough to it. Some light passing by a black hole can be far enough away that it could avoid being sucked in, but the path of the light would still be bent by gravity.

Which statement best describes the relationship between the bending of a ray of light and a black hole?

When light disappears, it causes a black hole to come into existence.
A ray of light has gravity that will cause a black hole to move toward it.
Gravity from a black hole will pull a ray of light and cause its path to change.
A black hole’s gravity can cause a ray of light to gain gravity and attract objects.

Answers

Answer:C

Explanation:Im bigger brain than yeet >:(

As, by the given statement, gravity from a black hole will pull a ray of light and cause its path to change. Best describes the relationship between the bending of a ray of light and a black hole.

What is the statement?

Statements are sentences that express an information, idea, or opinion. Statements do not ask questions, make requests or give speech act. They are also not auditory communication.

As, the relationship between the bending of a ray of light and a black hole. The region around the black hole is a dark, round concretism. Light rays that pass a little longer away don't get caught, but do get bent by the black hole's graveness.

Therefore, The right option (C) is correct.

Learn more about the statement here:

https://brainly.com/question/2285414

#SPJ6

I GIVE BRAINLEIST!!!!! How does kinetic energy naturally flow; from hot to cold or cold to hot?

Answers

Answer:

Hot to cold

Explanation:

Heat is always the transfer of energy from an object at a higher temperature, so energy flows from the particles that are warm to the cold

Why did Swedish immigrants leave their homes and settle in the United States?
A. Farm land
B. To form colonies
C. Search for gold
D. Religious freedom

Answers

Answer:

A

Explanation:

A strong population growth in Sweden increased the pressure on a society that was fundamentally agricultural in nature, and moving to North America provided the Swedish emigrants with economic opportunity not available in the homeland. Religious and political reasons played a much smaller role for the move to America, although it was decisive in some instances.

Answer:

A

Explanation:

Kendra decides to go door-to-door and survey people who live near the pet shop she owns. On Tuesday, Kendra steps out during her lunch break and finds that many people aren't home. Of the people who are home, Kendra discovers that most of them are elderly or stay-at-home parents. Discovering that many people are not available to participate in her survey is an example of ______ bias. a.) nonresponse b.) response c.) unintentional d.) deliberate

Answers

Answer: nonresponse

Explanation:nobody was there and all of them were absent.

There is non-response bias when people are not available to participate in a survey that Kendra is facing in the given scenario. Option A is correct.

What is the nonresponse bias?

When non-responders from a sample distribution differ significantly from communicators or responders, then this is known as non-response bias. This is also known as late-response bias or early responders.

This bias has been shown to be a significant issue in survey examinations and is ordinary in logical, descriptive, and experimental research.

In the given case, Kendra decides to canvass the neighbors of her pet store. She notices that many people aren't at home. Most of the people at home are elderly or stay at home parents.

Therefore, option A is correct that nonresponse bias is when a researcher finds that many people are not available to take part in their survey.

Learn more about the survey, refer to:

https://brainly.com/question/15092519

#SPJ2

true or false
Napoleon Chagnon specifically chose to study the people of the village of Bisaasi-teri because he knew they were a good general representation of Yanomamo culture.

Answers

True that correct I know

Explain Hydrosphere

Answers

Answer:

The hydrosphere is the combined mass of water found on, under, and above the surface of a planet, minor planet, or natural satellite. Although Earth's hydrosphere has been around for about 4 billion years, it continues to change in shape.

Answer:

All the waters on the earth's surface, such as lakes and seas, and sometimes including water over the earth's surface, such as clouds.

Explanation:

Can i have Brainliest fi this is correct?

The head of the California Department of Education is the ________ ________ _______.

Answers

Answer: Is Tony Thurmond.

Explanation:

He was an educator, social worker and a public school parent who served the people of california for more than ten years in Office.(Superintendent Tony Thurmond).

what has ears but can not hear????????

Answers

Answer:

my stuffed animal :(

Explanation:

:(((((((((((((

:)))))))))))))

A photographer is a dream​

Answers

yes i d definitely are

Which of the following traits is found in major depression

Answers

Answer: umm sadness?

Explanation:

Lack of motivation, suicidal thoughts, major anxiety

Place the following events in order.
earlier
The English take over New Netherland and rename it New York.
The Duke of York gives two friends the right to start the New Jersey Colony.
Dutch settlers start a colony on the island of Manhattan.
The king of England gives William Penn a charter for the Pennsylvania Colony.
Colonists in the Three Lower Counties on the Delaware elect their own general assembly for the first time.
later
Submit









Answers

Answer:

Dutch settlers start a colony on the island of Manhattan.

The Duke of York gives two friends the right to start the New Jersey Colony.

The English take over New Netherland and rename it New York.

The king of England gives William Penn a charter for the Pennsylvania Colony.

Colonists in the Three Lower Counties on the Delaware elect their own general assembly for the first time.

Explanation:

Colony on Manhattan was established in 1624.

New York was renamed to New Amsterdam in 1664. Just a couple of months before that he allowed Lord Berkeley and Sir George Carteret to establish new colony in New Jersey.

Pennsylvania was established in 1682.

This general assembly was established soon after the established of colony of Pennsylvania.

The caste system in India was characterized by what?

A.toleration for various religious beliefs

B. equality between men and women

C. a lack of social mobility

D.the right of people to choose their occupations

Answers

Answer:

C. A lack of social mobility.

Explanation:

The caste system in India is a system of demarcation, alienation, or classification of society into groups based on their professions and class or belonging. This systematized level not only gave certain groups an advantage over the lower ones, but it also led to great stigmatization further leading to even alienation and discrimination.

The four levels or groups of the caste system were the Brahmins, Kshatriyas, Vaishyas, and lastly the Shudras. While the upper ones enjoy all amenities of life and lead a free life, the lower ones, especially the Shudras were more of the outcaste. They were made to do all of the odd jobs, the dirty work that was deemed improper. And added to that, they were again looked down upon by the ones in the higher class, which resulted in their discrimination intentionally and unintentionally, but mostly intentionally.

This classification of the people or society into such groups was a direct result of the social immobility, the lack of an influx or interaction among the different people, and their insistence on maintaining their own 'circles', thereby obstructing the need or chance to 'mingle' with each other outside of their respective 'circles'.

Explain the school as a community hub? 5pts.​

Answers

A school is essentially part of the community, meaning that they play and take their place in it. For example, when students are in need of supplies or food they work hard to ensure that they are supplied with those needs. Rather than just focusing on their education.

please help with 9. I’ll mark brainliest. It’s due today

Answers

One tusk is broken and the other is not. This shows the world has imperfections and perfections that blend together to make one whole thing.

According to the video, what are some challenges commonly faced by Postal Service Mail Carriers? Check all that apply. unfriendly coworkers hazards on routes difficult math calculations conflicts with politicians strenuous physical activity increased workload around holidays

B,E,F i got the answer myself thanks

Answers

Answer:

B,E,F

Explanation:

Answer:

bef

Explanation:

hi

Islam has roots in which other religion(s)?
Christianity
All of the above.
Zoroastrianism
Polytheism

Answers

The answer is Christianity

Answer: Christianity

Explanation:

[and the thora, but never mind..]

what did maggie want to find out from this experiment​

Answers

Answer:

what experiment

Other Questions
25 points! pls show work if can!!!!!!!! Why would more food lead to more jobs? Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo should the fact that a person has children in the UK over-rule their deportation after the have served a prison sentence ? What Solutions to population growthmight a penson from Europe suggest? What is 12x 9x 4x + 3 in factored form? hurry... Would you need circumference or area to find the amount of oil it takes to cover the bottom of a frying pan? At a book store there are 25 books on the clearance section. 20 of the books are young adult novels and the rest of the books are picture books. Which statement is not true?For every 4 young adult novels, there is 1 picture bookFor every 5 books, 4 are young adult novelsThe ratio of picture books to young adult novels is 1:4There is 1 picture book for every 5 booksAll statements are true As a result of the problems of the Industrial Age, some influential reforna new economic system.a single world government.a dictatorship in the United States. an end to all factories. pls help meh...... with the question.....pls it's urgent ........... A technician has a recipe for 32,500 mL; what is this in liters? -(4x - 7) + 1 = 2 (5 - 2x) solve for x You will start at the begining of the piece each time you practice. . True O B. False Right answer will get brainlist pleasee help choose the correct one Which best describes the scene that is described in Countee Cullens Tableau?A. Two children are running away from homeB. A man is remembering his grandfathers table C. A black boy and white boy are walking together as friends D.A black boy and a white body get into a fight on the street . example of secondary analysis Starch is a _____. jhcgrwzxcvhbnkjm What events transpired (occurred) in France from 1795-1815?I Choose the answer that is most descriptive of the Solar System. Sun, planets, moons, asteroids, comets Nebulas, star clusters, super nova, black holes, binary stars Jupiter, Neptune, Saturn, Uranus, dwarf planets Jupiter, Great Red Spot, 8 regular moons, 58 irregular moons