Answer:
1 basaltic
2basaltic
3 andesitic
4 rhyolitic
and I'm sorry for not believeing you I hope that this helps you out good luck and follow me so I can help you when you need it
AAAAAUGACCAAAGUGGAGUAAUGGUAACCC please type first 3 letters of each amino acid separated by a dash.
Answer:
what?
Explanation:
True or false: Invasive species are harmful in every single environment/ecosystem in the world.
Answer: the answer is yes
Explanation: in Florida we have multiple different invasive species which are destroying the environment.
WILL GIVE BRAINLIEST!!!!
Use the drop-down menus below to identify the organ(s) that is/are responsible for each function of the excretory system.
produces feces
excretes sweat
converts poisonous substances to less toxic forms
excretes carbon dioxide and water
produces urine
Answers:
large intestine, skin, liver, lungs, kidney
Explanation:
large intestine, skin, liver, lungs, kidneyhope it is helpful to you
Answer:
1. Large intestine
2. Skin
3. Liver
4. Lungs
5. Kidney
Explanation:
Bc I said so
The above graph shows vertebrate diversity in terms of total
number of species. Which of the vertebrate classes listed in
the graph would have the BEST chance of at least some of
the species surviving a major environmental change?
A:bony fish
B:birds
C:sharks, rays
D: mammals
Answer: a
Explanation:
Answer:
a
Explanation:
Help!
For the global population growth rate to reach zero, the number of births would have to be
Answer:
same as the number of death
... is what you fill in.
Explanation:
If the death and birth number are equal, there are no changes in numbers made.
For the global population growth rate to reach zero, the number of births would have to be same as the number of death.
What do you mean by population growth rate?Population growth is the increase in the number of people in a population or dispersed group. Actual global human population growth amounts to around 83 million annually, or 1.1% per year. The global population has grown from 1 billion in 1800 to 7.9 billion in 2020.
Population in the world is, as of 2022, growing at a rate of around 0.84% per year (down from 1.05% in 2020, 1.08% in 2019, 1.10% in 2018, and 1.12% in 2017). The current population increase is estimated at 67 million people per year.
The world's population is expected to increase by nearly 2 billion persons in the next 30 years, from the current 8 billion to 9.7 billion in 2050 and could peak at nearly 10.4 billion in the mid-2080s.
Learn more about population growth rate:
https://brainly.com/question/14122627
#SPJ6
Which statement is not true about chicken-pox?
Answer:
where is your statements
What will most likely occur if population density increases in a population that is density dependent?
Birthrate will decrease.
Carrying capacity will increase.
Death rate will decrease.
Immigration will increase.
Answer:
D
Explanation:
Population density is the number of individuals in a unit square area. As if population density increases in a population that is density-dependent, will increase immigration, i.e., option D.
What is immigration?Immigration is a process by which individuals become residents of another country permanently.
The process of immigration is of great importance for social, economic, and culture of states.
As population density increases in a population that is density-dependent immigration will also increase.
Thus, the correct option is D.
For more details regarding immigration, visit:
https://brainly.com/question/13688875
#SPJ2
Fossils and Evolution On Study Island
A team of scientists are studying three different layers of sedimentary rock to learn about a particular reptile species. In the layer of rock that is closest to the Earth's surface, the reptiles' teeth fossils are found to be short and straight. In the layer below, the reptiles' teeth fossils are found to be long and straight. In the layer below that, the reptiles' teeth fossils are found to be long and curved.
Based on this information, the reptiles today most likely have
A.
long, straight teeth.
B.
no teeth.
C.
long, curved teeth.
D.
short, straight teeth.
Answer: short, straight teeth
Explanation: study island
Condensation is when water changes from a
A. gas to a liquid.
B. liquid to a gas.
Answer:
ima say its A but if its wrong im srry
Explanation:
The graph represents changes to two jackrabbit populations in two different areas over 15 years.
a. Which of these populations experienced the faster growth rate over the first five years? Explain your answer.
b. Which of these populations probably experienced more births than deaths over the first five years?
c. What is the approximate carrying capacity for each population, as indicated by the graph?
d. At carrying capacity, how would the growth rate of the population in area A compare with the growth rate of the population in area B?
e. Although the two populations started out at the same size, one population grew larger than the other. What are two environmental factors that could have limited the growth of one of these populations?
f. For the population in area A, which part of the chart shows exponential growth and which shows logistic growth?
g. What are two possible changes to environmental factors that could cause the population in area B to experience positive population growth that would allow it to reach the same carrying capacity as the population in area A?
Answer:
B: blue experienced more death than red
Scientists sink concrete blocks in oceans to create artificial coral reefs. Which successive event most likely occurs first on this type of coral reef
Answer:P
Explanation:got it right
Coral polyps attach themselves to the surface to grow is the event most likely occurs first on this type of coral reef.
What is Coral reef?Coral reefs are significant ocean habitats that make a strong argument for the dangers of climate change. Reefs are a significant contributor to the biodiversity of the planet; they have been referred to as "the rain forests of the seas." One of the most diverse environments on earth, coral reefs are home to 25 percent of all marine species, according to scientists.
According to Paulo Maurin, coordinator of education and fellowships for NOAA's Coral Reef Conservation Program, the reefs are essential to the biodiversity of our world.
Many fish species use them as fruitful nurseries, giving the young fish a place to live and an opportunity to develop, according to him. "The diversity of coral reefs is so great that we don't have a firm count of all the species that live there,"
Therefore, Coral polyps attach themselves to the surface to grow is the event most likely occurs first on this type of coral reef.
To learn more about Coral reef, refer to the link:
https://brainly.com/question/15794949
#SPJ2
Which event came first? The age of reptiles Amphibians leave the water Trilobites are one of the dominant species on Earth Early humans arise on Earth
Answer:
Trilobites are one of the dominant species on Earth
We know it's not D, the age of reptiles was just a "wee" bit before humans, and amphibians came after trilobites.
Answer
F1 development of the ozone layer
S2 sharks and trilobites abundant in oceans
T3 plants and animals colonize land
F4 dominance of reptiles >> dominance of mammals
You are exposed to the same pathogen twice in your lifetime. Which of the following
is true?
A.) Your body will fight the second exposure much slower because it has already
used up all its antibodies against that antigen.
B.) The reaction times will be almost equal.
C.) You cannot be exposed to the same pathogen twice in your life because you
already destroyed those pathogens with your Killer T cells.
D.) Your body will fight the second exposure much quicker because it has stored
memory cells against that specific antigen.
Answer:
the answer would be D
Explanation:
Answer:
d
Explanation:
. Aşağıdaki şekilde hazırlanan tampon çözeltilerin pH'larını hesaplayınız? a) 8 mmol NaCH3COO+ 200 mL 0.1 M CH3COOH b) 100 mL 0.05 M NaOH+ 100 mL 0.175 CH3COOH c) 40.0 mL 0.12 M HCl +160 mL 0.0420 M NaCH3CO
Answer:
can u write this in english
Explanation:
This oceanic zone contains some of the
deepest parts of the ocean.
A. Kelp Forest
B. Abyssal Zone
C. Coral Reefs
The abyssal zone, which lies between 4,000 and 6,000 meters (13,000 and 20,000 feet) below the surface, is the deepest region of the ocean. So, option B is the answer.
The region of the ocean that lies beyond the continental shelf is commonly referred to as the oceanic zone. The sunshine zone, twilight zone, midnight zone, and abyssal zone are the four vertical zones that make up the open ocean.
Abyssal zone is characterized by high pressure, low temperatures, and very little light.
Kelp forest is found in shallower areas, often between 20 and 100 meters deep and Coral reefs are located in tropical, shallow waters.
Therefore, option B is correct.
Learn more about oceanic zone here;
https://brainly.com/question/33307218
#SPJ5
Can anyone help me with my homework
Answer:
1) True
2) True
3) False
4) True
5)True
I do not know how to answer this question please help asap
Answer:
It would be Africa
Explanation:
It has the a lot of the color for water scarcity
Hope it helped!
Match each graph with its correlation coefficient.
+1.0
+0.85
+0.15
-0.50
-1.0
Answer:
-0.50
Explanation:
For the graph displayed, the most probable value of the correlation Coefficient is - 0.50 ; the line of best fit has a negative skoe and hence will have a negative relationship as the correlation Coefficient is a statistical value which measures the degree of relationship between two variables. Also, the distribution of data in the plot does not give a perfect fit, hence a correlation Coefficient of - 1.0 isn't possible for the distribution shown.
Answer:
fist graph: -0.50
second graph: +0.85
third graph: +0.15
fourth graph: +1.0
fifth graph: -1.0
Explanation:
im pretty sure this is the correct answers
can exoskeletons break?
A cladogram is shown below. What is a derived characteristic that distinguishes the salamander from the perch? lungs claws or nails fur jaws
About the question:
You will a cladogram in the attached files.
Answer:
lungs
Explanation:
A Cladogram is a tree-type graph based on cladistic analysis. It represents the common ancestral relationships among the involved groups.
• The tree-type graph is a ramified diagram that represents the relationship between the involved taxa.
• The cladistic analysis follows the maximum parsimony criterium. Explains the character state from the point of view of the fewest changes through history. Explains evolution with the minimal amount of evolutive changes. It recognizes the monophyletic groups as natural groups. These groups are the clades, and their classification -sequencing- represents their phylogeny.
• The sequencing term refers to lists of groups according to their relation. One group is the brother-group of the following one.
So the cladogram represents the relationship between groups according to a derived character.
The derived character is any trait that a group passes to the descendants. Through evolution, the characters change, and new changes are added. When referring to a derivate character, we mean that all the subsequent species in the cladogram carry the trait.
A cladogram provides an image of how new species keep characters that were inherited from older species.
In the attached cladogram, you can see that the lungs are the derived character that distinguishes the salamander from the perch.
Claws or nails separate salamander from lizards.
Fur separates birds and reptiles from mammals.
Jaws separate hagfish from perch.
Mutations occurred in evolution producing new traits, and these traits also appear in posterior groups. So, after the hagfishes emerged the jaws, and all the animals that followed the hagfishes have jaws.
Lungs appeared after the perch and before salamander, so salamander, and all the posterior animals, have lungs. And so on.
WILL GIVE BRAINLIEST IF CORRECT
The two mice pictured below are genetically identical. How were they produced?
Answer:
Both of the mice had the same allels by the parents (EE)
Explanation:
(Discussion topic)
Some people worry that the increasing number of cell phones will cause cancer
because of the energy of the radio waves they emit. Cell phones are a new technology
that only recently became widely used. And because cancer takes years to develop, the
amount of risk is not yet known.
K
Research this issue, and summarize what's known so far. In your summary, include
information about the energy of radio waves. Be sure to only use credible sources.
Based on what you learned from your research, do you think people should limit their cell phone use? Why or why not?
Answer:
No.
Explanation:
No, the increasing number of cell phones will not the cause of cancer because it emits low intensity of radio waves. Radiations such as x-rays, gamma rays, alpha particles, beta particles, and neutrons are responsible for causing damage to the cell and the main cause of cancer. High intensity of radio waves heats up the cells not causing cancer disease so we can conclude that the increasing number of cell phones will not cause cancer disease in humans.
Answer:
No, the increasing number of cell phones will not the cause of cancer because it emits low intensity of radio waves. Radiations such as x-rays, gamma rays, alpha particles, beta particles, and neutrons are responsible for causing damage to the cell and the main cause of cancer. High intensity of radio waves heats up the cells not causing cancer disease so we can conclude that the increasing number of cell phones will not cause cancer disease in humans.
Name 5 invasive species in Florida
Answer:
5 INVASIVE SPECIES:
-Burmese Python
-Iguanas
-Cane toads
-Lionfish
-Feral Hogs
Hope this Helps!
how do interactions among organisms affect their ecosystem
Answer:
Individual organisms live together in an ecosystem and depend on one another. ... One category of interactions describes the different ways organisms obtain their food and energy. Some organisms can make their own food, and other organisms have to get their food by eating other organisms
Why are viruses not considered living organisms by most people?
Answer:
Viruses are not considered living organisms because they require a host cell to replicate, unlike living organisms which can replicate on their own.
Question 2
Which of the following terms best describes the idea of managing and carefully using Earth's resources?
A
recycling
B
reducing
С
conservation
D
conclusion
What are the consequences of humans adding gases and other substances to earth's atmosphere?
Answer:
depends which kinds. some can eat the atmosphere like the hole in the atmosphere like the gases from aerosols like hair spray, some trap heat from the sun like greenhouse gases, silver oxide can collect moisture in the air to make rain, air pollution from dense factory and vehicle usage can cause smog and acid rain, fertilizer and pesticide from farms can run off into rivers and other bodies of water
Answer:
1.
2.
Explanation:
. . . .
A scientist thinks he has discovered a drug that
interferes with the functioning of a virus in the
human body. To effectively block infection, the
drug can
I
A weaken viral respiration.
B destroy viral mitochondria.
C reduce the ability of the virus to absorb cells.
D prevent the virus from entering cells.
Answer:
DExplanation:
https://brainly.com/question/9265902
Imma give u brainliest
If anyone answer these questions
Answer:
it is to do with something called angular moment. Gravity is the central force in the Universe, because it is the only one which has a significant pull over large distances.
5:Orbits are the result of a perfect balance between the forward motion of a body in space, such as a planet or moon, and the pull of gravity on it from another body in space, such as a large planet or star. ... These forces of inertia and gravity have to be perfectly balanced for an orbit to happen.
6;Gravity is the force that keeps planets in orbit around the Sun.
7.gravity
The dynamics of a rotating body is of course controlled by forces like gravity. Kepler's laws are a direct consequence of gravity
8.Rather, the term is derived from the concept of the tide "springing forth." Spring tides occur twice each lunar month all year long, without regard to the season. Seven days after a spring tide, the sun and moon are at right angles to each other
9.Neap tides occur halfway between each new and full moon – at the first quarter and last quarter moon phase – when the sun and moon are at right angles as seen from Earth.
An increase in heart rate (your heart pumps faster) results in...
A. No changes to cardiac output or pressure
B. Increase cardiac output and high pressure
C. Increased cardiac output but lower pressure
Answer:
B
Explanation: