pls help asap
sword out the words to the correct category

Pls Help Asapsword Out The Words To The Correct Category

Answers

Answer 1

Answer:

Look in photo for where they go.

Explanation:

Pls Help Asapsword Out The Words To The Correct Category
Answer 2
Reactants: Water, Oxygen, Carbon Dioxide
Products: Glucose, Energy

Related Questions

Match each example of figurative language with its interpretation

Answers

Can you take a correct picture
Need a clearer picture to help

Both of the stories are adventure stories about finding treasure. Which of the following describes a similarity between the two stories in regard to the nature of the treasure hunts?

In both stories, the characters have some clues and riddles to solve, and they solve them with the help of the characters they are working together with on the treasure hunt.

In both stories, the characters set out on an adventurous treasure hunt where they are searching for ancient, long-lost treasure.

In both stories, the characters set out on a treasure hunt because a friend or family member has set up the hunt as a fun activity, and they are promised a reward

In both stories, there is a certain element of danger that the characters encounter, and they overcome the dangerous obstacles with the help of the other characters.

Answers

Answer:

The correct answer is d. The characters in both stories love nature.

Explanation:

In both stories we can see how nature represents a lot of positive feelings. First , in Huckleberry Finn, it is evident how Huck loves the river as a representation of freedom, becasue he and Jim can be there free and able to do anything. Second in My Antonia, the nature is showed as a symbol of connection between human being and the natural landscape, some elements such as the sunset and the landscapes, suggest harmony between the man and the nature.

why is it important to understand how someone else is feeling during a certain situation i need 3 reasons

Answers

Becaus it just is Important
Alright, 1. You might need to get to know the person better.
2. The situation is bad, and you need to understand what they’re going through to comfort them
3. You did something wrong, and have to put yourself in their shoes

please HELP ME ASP PLEASEEEEEEEEE

Answers

Answer:

C

Explanation:

Sorry, if it's incorrect, for me it seems like the most reasonable answer if she ran out and they started running towards her, BUT, I am pretty sure thats the right answer. Hope this helped

Answer:

I think the correct answer is C

Explanation:

I think its C because if the animals did not rush to Alice, she would have not run away. If we knew why the animales rushed to her, then we will know why she ran away.

Hope this helps:)

WHAT CAN YOU FIND IN AN AIRPORT TERMINAL?
list THINGS YOU COULD FIND
PLEASSSSSSSSSSSSSSSSSSS HELPPPP

Answers

food
bathrooms
employees
old people

Answer:e

batthroom

Explanation: becauas like when you have to go to the bathroomit is right there

Match the definition to the word.

1. incredible
A. pardonable
2. lovable
B. difficult to believe
3. sensible
C. capable of being defended
4. inevitable
D. sure to happen
5. defensible
E. sound reason; good sense
6. excusable
F. not firmly fixed
7. infallible
G. able to be loved
8. unstable
H. free from error

Answers

1.b
2.g
3.e
4.d
5.c
6.a
7.h
8.f

Read the excerpts from "The Royal House of Thebes" and "The Story of a Warrior Queen."

Antigone and Ismene heard with horror what Creon had decided. To Ismene, shocking as it was, overwhelming her with anguish for the pitiful dead body and the lonely, homeless soul, it seemed, nevertheless, that nothing could be done except to acquiesce [to accept without protest]. She and Antigone were utterly alone. All Thebes was exulting that the man who had brought war upon them should be thus terribly punished. "We are women," she told her sister. "We must obey. We have no strength to defy the State." "Choose your own part," Antigone said. "I go to bury the brother I love."

–"The Royal House of Thebes"

"Is it not better to be poor and free than to have great wealth and be slaves?" she [Boadicea] asked. "And the Romans take not only our freedom but our wealth. They want to make us both slaves and beggars. Let us rise. O brothers and sisters, let us rise, and drive these robbers out of our land! Let us kill them every one! Let us teach them that they are no better than hares and foxes, and no match for greyhounds! We will fight, and if we cannot conquer, then let us die—yes, every one of us—die rather than submit."

–"The Story of a Warrior Queen"

Answers

it’s answer a !!! :)

Read the passage.

John had improved his study habits by always completing his homework before dinner. Then, spring and good weather came. He regressed; he started playing basketball until dinner every night and sometimes didn't get to his homework until right before class the next day.
What does the word regressed mean?


A. changed his mind

B. moved forward

C. rearranged

D. moved backward

Answers

Answer:

it a he moved changed his mind he enjoyed the weather and didn't want to do his work

Actually it’s d, regressed means to return to a less developed state ex: relapse,revert, and so on

How is the experience of reading a dramatization of A Christmas Carol different from reading the original story? Analyze elements such as stage directions and dialogue. Use your reading notes and be sure to cite textual evidence in your response.

Answers

The experience of reading a dramatization of, "A Christmas Carol", is very different from reading the original story in many ways. For instance, there is more description of what's happening, and it also tells me more of what the words are meant to mean. A detail from the drama is on line 12-14 the text states, "Gravestone turns front and grows ten feet high. Words upon it: EBENEZER SCROOGE. Much smoke billows now from the grave."  By this evidence I can tell that there is much more detail in this drama, they add effects to make it seem more dramatic, this makes since because this is supposed to be a novel turned into a dramatic play.

In many ways, reading a dramatization of "A Christmas Carol" differs significantly from reading the original text.

What is a Christmas carol?

For instance, more of what's happening is described, and it also clarifies more of what the words' intended meanings are. Lines 12–14 of the book provide a dramatic detail: "The gravestone turns toward the front and rises 10 feet. It has the words Ebenezer Scrooge.

Now, a lot of smoke is rising from the grave." From this information, I can infer that this drama contains a lot more detail. They add effects to make it seem more dramatic, which makes sense given that this is a dramatic performance based on a novel.

Therefore, reading a dramatization of "A Christmas Carol" is very different from reading the original book in many respects.

To learn more about a Christmas carol, refer to the link:

https://brainly.com/question/29772454

#SPJ2

3.
Choose the correct problem for the fraction .
25 x 20
20 ÷ 20
25 ÷ 20
20 ÷ 25

Answers

Answer:

25 divide by 20

it's correct!

The correct problem for the fraction will be 20 ÷ 25. The correct option is D.

What is fraction?

When writing a fraction, a numerator and a denominator are used, with the denominator being greater than the numerator. An example of a fraction is 1/2 or 1/3.

The components of a whole or group of items are represented by fractions. A fraction consists of two components. The numerator is the figure at the top of the line.

It details the number of equal portions that were taken from the total or collection.

An expression for a portion of a whole is a fraction. In general, the whole can be any particular thing or value, and the fraction might be a portion of any quantity out of it.

The solution to the fraction's problem will be 20 divide 25.

Thus, the correct option is D.

For more details regarding fraction, visit:

https://brainly.com/question/10354322

#SPJ2

PLZZZZZZZZZZZZ HELP ITS HALF MY GRADE!!!

Type a summary of "Rethinking the Wild" You must have the following criteria to receive full credit.


Your typing must be in paragraph form.

You must indent the first line of your paragraph.

You must have at least 7 complete sentences in your paragraph.

You must begin the first word of each complete sentence with a capital letter

You must end each complete sentence with an end punctuation.

If you do not type 7 complete sentences you will receive deductions in numbers 3-5.

Answers

      There have been many attempts to save the whooping crane, an endangered species of crane. One of these includes "Operation Migration. The operation was designed to save the whooping crane. They helped the birds migrate to Florida by disguising a plane to look like one of the birds. They flew along with the flock, guiding them to where they were supposed to go. When they arrived they were put into a "release pen." The release pen just so happened to also be near the Gibbs' house. Being near humans and getting comfortable with them isn't good for the cranes, so representatives from Operation Migration told Mrs. Gibbs about the situation, asking her to remove the feeders from her backyard. She refused to move the feeders because her husband was suffering from Alzheimer's, and loved seeing the whooping cranes because it brought him joy. The story didn't get to the scientist's, but they had to back down in the end.

This took me a while, can i have brainliest please?

The question above wants to assess your ability to write a summary. In that case, it's not right for me to write a summary for you, but I'll show you how to write one.

First, you should know that a summary is a short text, which presents the most important information from another text. Therefore, the summary presents only the information relevant to the understanding of the text.

In this case, to write your summary you must:

Read all the text your question refers to.Identify the most important information that this text presents.Write sentences that present this information.Avoid plagiarism by writing sentences with different words but with the same meaning.Write the sentences harmoniously and coherently, adapting them to form a fluid text.

More information:

https://brainly.com/question/3270226?referrer=searchResults

Which of the following is the corrected sentence for the following sentence?

werent their no cookies left

a
Werent there no cookies left.
b
Weren't their any cookies left.
c
weren't there any cookies left?
d
Weren't there any cookies left?

Answers

Answer:

D.

Explanation:

Answer:

Weren't there any cookies left?

Explanation:

A sentence begins with a capital letter, since it was a question, you use a question mark. You don't use their since "their" is a possessive pronoun. As for "there" is used as an adjective.

Should we stay fully remote, return to blended, or go all-in? Write at least one paragraph in support of your position . Be sure to write at least six sentences and include your position and supporting reasons.

Answers

Answer:

fully remote

Explanation:

who ever want to go back is coco

Which is NOT a context clue?

Compare and contrast
Definition
Synonym and Antonym
Inference
Causation

Answers

Causation or definition
Answer: Inference
I’m pretty sure this is it

NEED NOW!!!!!!!!

Which excerpt from The People Could Fly best reflects the historical fact that enslaved people were forced to work under brutal conditions?


They kept their secret magic in the land of slavery.

Nehemiah was always bein moved from one plantation to another.

She flew clumsily at first, with the child now held tightly in her arms.

The slaves labored in the fields from sunup to sundown.

Answers

The last one is correct

Answer:

The slaves labored in the fields from sunup to sundown.

Explanation:

What is one thing you learned by reading each article that you find interesting? Use text evidence from each article to explain why you find that thing particularly interesting.

The texts are below. NO TROLLS I WILL REPORT YOU. AND USE TEXT EVIDENCE pls....

I will give brainliest and 50 points...

Answers

Answer:

Most snakes feed on small mammals

Explanation:

This took a lot of my storage btw

Snakes eat on small animals like rabbit, frog, etc

Why SHOULDN'T we have community service?
PLS I LITTERALLY SAID SHOULDN'T PLS I BEG OF U SHOULDN'T NOT SHOULD
(15 points)

Answers

Answer: We shouldn't have Community Service because it is pretty much forced labor and that is against the Constitution.

Answer:

bc it's pretty much forced labour/unfree labour and that is. Unfree labour is any work relation, especially in modern or early modern history, in which people are employed against their will with the threat of destitution, detention, violence, compulsion, or other forms of extreme hardship to themselves or members of their families

PLEASE HURRY UP AND ANSWER :)

The story is called: AND THE DRILLING BEGINS

The Question: People knew there was “rock oil” in Titusville because of the?

Answers

Answer:

they use seismology, creating shock waves that pass through hidden rock layers and interpreting the waves that are reflected back to the surface.

Explanation: B)

Because of the person that cracked open a rock and told everyone

How is the structure of "Past and Present Ships" different from the structure of "The Impact of Boating?"

A"Past and Present Ships" uses a cause and effect text structure to show the impact of ships on the world, while "The Impact of Boating" uses a chronological order text structure to show the laws put into place to protect the environment.
B"Past and Present Ships" uses a chronological text structure to show the development of navigation tools over hundreds of years, while "The Impact of Boating" uses a problem and solution text structure to show the laws created by the government to make boating better for the environment.
c"Past and Present Ships" uses a compare and contrast text structure to show the similarities and differences between ships used by early explorers and those used now, while "The Impact of Boating" uses a cause and effect text structure to show the damage boating does to the environment.
D"Past and Present Ships" uses a problem and solution text structure to show how problems faced by ships were solved, while "The Impact of Boating" uses a compare and contrast text structure to show healthy and unhealthy waterways.

Answers

Answer:

B"Past and Present Ships" uses a chronological text structure to show the development of navigation tools over hundreds of years, while "The Impact of Boating" uses a problem and solution text structure to show the laws created by the government to make boating better for the environment.

Explanation:

Got it right on my test. Trust me :D

Answer:

It's B. I did the test right now.

Explanation:

I hope this helps.

True or false Bible Question
4. Aaron wear holy garments made by gifted artisans
PLEASEEEE HELLPPPP THIS IS UREGENTTTT

Answers

Answer: true

Explanation:

Explanation:

True.

Exodus 28:2-4 Priesthood Holy Garments 2 And you shall make holy garments for Aaron your brother, for glory and for beauty. 3 So you shall speak to all who are gifted artisans, whom I have filled with the spirit of wisdom, that they may make Aaron's garments, to consecrate him, that he may minister to Me as priest. 4

Which Sentence is a Generalization?
A. Some teachers are nice
B. My teacher is Funny
C, All teachers are strict
D. Many teachers like to travel
PLEASEEEEEE HELPPPP PLEASEEEEE

Answers

Answer:

D

Explanation:

"many teachers like to travel" this is a generalization because its saying, in general, teachers like to travel.

Compare and contrast the themes of “The Bake Sale” and “Fourteen Days in Tokyo.” Include clear text evidence to show how characters in each respond to challenges.

Story:

Answers

Answer:

Help

Explanation:

I don't know

Heres the other 2 help ASAP

Answers

Answer:

The first one is C.

The second one is A.

Explanation:

Hope this helps :)

Can somewone ansere this question i will give brainless points!!!

Read the sentence from Barrio Boy by Ernesto Galarza.

I pushed a chair under it and after some instruction from my mother proceeded to create lightning in the room by turning the switch as fast as I could.

1. form a picture of flashing light.

2. compare himself to his mother.

3. give human qualities to the light.

4. imagine what the chair looks like.

Answers

Answer:

The author uses figurative language to form a picture of flashing light.

Explanation:

The author uses figurative language to create an image inside the readers head to help picture how the room might look as he turned the light on and off. realy hope I helped

Answer:

1- To form a picture of flashing light

Explanation:

Based on Wiesel’s speech, why do people “tell the tale” of the horrible events in the Holocaust?

Answers

Answer:

Answer down below!

Explanation:

People "tell the tale" of the Holocaust because history often repeats itself. People need to know these kinds of things because they dont want history to repeat. They also tell because if the people don't know, it will be forgotten, and the people whose lives were lost are forgotten as well.

Answer:

please give me brainiest

Explanation:

Elie Wiesel’s Acceptance Speech, on the occasion of the award of the Nobel Peace Prize in Oslo, December 10, 1986

It is with a profound sense of humility that I accept the honor you have chosen to bestow upon me. I know: your choice transcends me. This both frightens and pleases me.

It frightens me because I wonder: do I have the right to represent the multitudes who have perished? Do I have the right to accept this great honor on their behalf? … I do not. That would be presumptuous. No one may speak for the dead, no one may interpret their mutilated dreams and visions.

It pleases me because I may say that this honor belongs to all the survivors and their children, and through us, to the Jewish people with whose destiny I have always identified.

I remember: it happened yesterday or eternities ago. A young Jewish boy discovered the kingdom of night. I remember his bewilderment, I remember his anguish. It all happened so fast. The ghetto. The deportation. The sealed cattle car. The fiery altar upon which the history of our people and the future of mankind were meant to be sacrificed.

I remember: he asked his father: “Can this be true?” This is the twentieth century, not the Middle Ages. Who would allow such crimes to be committed? How could the world remain silent?

And now the boy is turning to me: “Tell me,” he asks. “What have you done with my future? What have you done with your life?”

And I tell him that I have tried. That I have tried to keep memory alive, that I have tried to fight those who would forget. Because if we forget, we are guilty, we are accomplices.

And then I explained to him how naive we were, that the world did know and remain silent. And that is why I swore never to be silent whenever and wherever human beings endure suffering and humiliation. We must always take sides. Neutrality helps the oppressor, never the victim. Silence encourages the tormentor, never the tormented. Sometimes we must interfere. When human lives are endangered, when human dignity is in jeopardy, national borders and sensitivities become irrelevant. Wherever men or women are persecuted because of their race, religion, or political views, that place must – at that moment – become the center of the universe.

Of course, since I am a Jew profoundly rooted in my peoples’ memory and tradition, my first response is to Jewish fears, Jewish needs, Jewish crises. For I belong to a traumatized generation, one that experienced the abandonment and solitude of our people. It would be unnatural for me not to make Jewish priorities my own: Israel, Soviet Jewry, Jews in Arab lands … But there are others as important to me. Apartheid is, in my view, as abhorrent as anti-Semitism. To me, Andrei Sakharov‘s isolation is as much of a disgrace as Josef Biegun’s imprisonment. As is the denial of Solidarity and its leader Lech Walesa‘s right to dissent. And Nelson Mandela‘s interminable imprisonment.

There is so much injustice and suffering crying out for our attention: victims of hunger, of racism, and political persecution, writers and poets, prisoners in so many lands governed by the Left and by the Right. Human rights are being violated on every continent. More people are oppressed than free. And then, too, there are the Palestinians to whose plight I am sensitive but whose methods I deplore. Violence and terrorism are not the answer. Something must be done about their suffering, and soon. I trust Israel, for I have faith in the Jewish people. Let Israel be given a chance, let hatred and danger be removed from her horizons, and there will be peace in and around the Holy Land.

Yes, I have faith. Faith in God and even in His creation. Without it no action would be possible. And action is the only remedy to indifference: the most insidious danger of all. Isn’t this the meaning of Alfred Nobel’s legacy? Wasn’t his fear of war a shield against war?

There is much to be done, there is much that can be done. One person – a Raoul Wallenberg, an Albert Schweitzer, one person of integrity, can make a difference, a difference of life and death. As long as one dissident is in prison, our freedom will not be true. As long as one child is hungry, our lives will be filled with anguish and shame. What all these victims need above all is to know that they are not alone; that we are not forgetting them, that when their voices are stifled we shall lend them ours, that while their freedom depends on ours, the quality of our freedom depends on theirs.

This is what I say to the young Jewish boy wondering what I have done with his years. It is in his name that I speak to you and that I express to you my deepest gratitude. No one is as capable of gratitude as one who has emerged from the kingdom of night. We know that every moment is a moment of grace, every hour an offering; not to share them.

 

WILL MARK BRAINLIST !

Create an editorial that uses loaded language to persuade readers of an opinion or belief. This option requires a strong, sensationalistic vocabulary. Though your editorial doesn’t need to be factually accurate, it can’t be so ridiculous that it feels like parody!

Answers

Answer:

Written Below.

Explanation:

The word Fascism has now no meaning except in so far as it signifies 'something not desirable.' The words democracy, socialism, freedom, patriotic, realistic, and justice have several different meanings which cannot be reconciled with one another. In the case of a word like democracy, not only is there no agreed definition, but the attempt to make one is resisted from all sides. It is almost universally felt that when we call a country democratic we are praising it: consequently, the defenders of every kind of regime claim that it is a democracy, and fear that they might have to stop using that word if it were tied down to any one meaning.

Sidenote: Hope this helps! If you like it, please mark Brainliest!

Answer:

Here's another answer

Explanation:

So you can give the other person brainliest. :)

I need help!

Consider the impressions you have of Joseph Plumb Martin and Sybil Ludington after reading their biographies. Reflect on their similarities and differences as well as their accomplishments. Write a one-paragraph essay to explain which person you admire more and why. Provide text evidence and quotations to support your ideas. Make sure to include transition words in your article. Use bold text when typing each transition word.

Answers

esson 15: Compare and Contrast with the Biography "We Were There, Too!"

The Target Skill in this lesson is Compare and Contrast

Concept Question: Are the details in my Venn Diagram important for the story or the characters in it, or are they just trivia (true, but not important to the story or characters)?

Lesson 15 Grab-And-Go Resources

From Journeys:

Compare and Contrast The selection "We Were There, Too!" allows readers to compare and contrast the experiences of two young people involved in the American Revolution.  As you read, look for text evidence that helps you think about how the situations, motives, and traits of the two subjects are alike and different.  Use a graphic organizer like this one to record similarities and differences between the two patriots.

Ne demek istoyusun anlamadım derslerinde başarılar dilerim eminim derslerinde başarılar dilerim ben de seni çok seviyorum seni çok teşekkür ederim öğretmenim ben de seni çok seviyorum seni çok teşekkür

Fill in the following.

A sentence fragment is like a _________,
but a run-on sentence is a ________.

** when you submit your answer, type out your full sentence.

Ex: a sentence fragment is like a half baked cake, but a run on sentence is being forced to eat after you are already full.

Answers

A sentence fragment is like a peanut butter and jelly sandwich without bread but a run on sentence is trying to stuff a book in an already full backpack.

Poetry has been defined as, “putting the best possible words in the best possible order.” Explain what this means and apply this theory to a specific poem.

Answers

Stop at a redlight and stop at a stop sign and than stop a five way stop

Poetry is words from the heart that express so many emotions by using very strong emotions

Please help with my English, I'll mark brainliest

Answers

Answer:

im pretty sure it would be A

Explanation:

the eagle landing on the moon is a symbol

and a is talking about something symbolic

hope this helps!

sorry if im incorrect

~brianna/edgumacation

Other Questions
There once was a ship that put to seaThe name of the ship was the Billy of TeaThe winds blew up, her bow dipped downO blow, my bully boys, blowSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goShe had not been two weeks from shoreWhen down on her a right whale boreThe captain called all hands and sworeHe'd take that whale in towSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goBefore the boat had hit the waterThe whale's tail came up and caught herAll hands to the side, harpooned and fought herWhen she dived down lowSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goNo line was cut, no whale was freedThe Captain's mind was not of greedAnd he belonged to the whaleman's creedShe took that ship in towSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goFor forty days, or even moreThe line went slack, then tight once moreAll boats were lost, there were only fourBut still that whale did goSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goAs far as I've heard, the fight's still onThe line's not cut and the whale's not goneThe Wellerman makes his regular callTo encourage the Captain, crew, and allSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and go Please help Im stuck!!!! PLEASE HELP I NEED THE ANSWER QUICK!!! What is the Length/ value of N is 63 / 168 equivalent to 312 / 832 Which Pope wanted to liberate Jerusalem from Muslim control? A 14.0 tank contains 250 g of methane (CH4) gas at 27 atm at 298 K. Accidentally, 190 g of CO2 was added to the tank. What will be the resulting pressure of the mixture in the tank? Assume that no CH4 leaked out as the CO2 gas waa being added. Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) PLEASE HELP!! I'LL GIVE BRAINLEST!!Use the formula P = 2l + 2w. Find the perimeter of a rectangle with a length of 12.9 ft and a width of 19.3 ft. Show all of your work. (4) NH3+02- NO+H2Obalance the equation Find the slope intercept equation of the line Ryan buys a baseball bat. The original price is $20. Ryan has a coupon for a 20% discount. What is the sale price? Which can provide the most energy in an ecosystem?a mushroom ,a coyote, a pine tree ,a grassy meadow Please HELP what is the slope-intercept equation slope: -2 y-intercept: 3 Please help me with this question please!!!Look at the picture provided and answer the question >>Select one only.Q:An aromatic hydrocarbon is represented by which structural formula?>>Choose one answer from the picture below that answers the question above ABCD Angel and his 2 sisters shared 1/2 cup of baby carrots. How many cups did they each get? How does biology affect behavior? tell whether each question is true or false.a. [tex] \sqrt[3]{60} = 20 \: true \: or \: false[/tex]b.[tex] \sqrt[3]{64} = \sqrt{16 \:} true \: or \: false[/tex]c. [tex]25 = \sqrt[3]{125} \: true \: or \: false[/tex]d.[tex]12 = \sqrt[]{144} \: true \: or \: false[/tex]e.[tex] \sqrt{ \frac{4}{9} } = \sqrt[ 3]{ \frac{8}{27} } \: true \: or \: false[/tex] If a wagon train traveled 12.5 miles each day, how many days would it takethem to get to Independence Rock which is 900 miles from their startingpoint? Find the value of c x 8 when c=9.