PLS HELPPPPP (mark BRAINLIEST)

PLS HELPPPPP (mark BRAINLIEST)

Answers

Answer 1

Answer:

Alliteration (and maybe assonance?)

Explanation:


Related Questions

When you make an inference, you ________________.

Answers

Answer:

You are taking a guess based off of your knowledge of the material you are reading.

Answer:

Make an informed guess!

Explanation:

Making inferences is when you are guessing, but you've done a bit of research on the topic beforehand.

Identify the correct way to cite the careeronestop web page that lists the highest-paying occupations
careeronestop. us department of labor and the state of minnesota, 2013. "top 50 highest-paying occupations
by median hourly wages." web. 1 may 2013
"careeronestop." us department of labor and the state of minnesota, 2013. "top 50 highest-paying occupations
by median hourly wages." web. 1 may 2013
"top 50 highest-paying occupations by median hourly wages." careeronestop. us department of labor and the
state of minnesota, 2013. web. 1 may 2013
top 50 highest-paying occupations by median hourly wages. "careeronestop." us department of labor and the
state of minnesota, 2013. web. 1 may

Answers

The correct way citation of the careeronestop web page that lists the highest-paying occupations will be B. "Careeronestop." us department of labor and the state of Minnesota, 2013. "top 50 highest-paying occupations by median hourly wages." web. 1 may 2013

What is a citation?

It should be noted that citation simply means the way to cite a particular work when one copies someone else's work.

In this case, the correct way to cite the careeronestop web page that lists the highest-paying occupations is illustrated.

Learn more about citation on:

brainly.com/question/8130130

#SPJ1

Answer:

“Top 50 Fastest-Growing Occupations.” CareerOneStop. US Department of Labor and the State of Minnesota, 2013. Web. 1 May 2013.

Explanation:

Place a checkmark next to each piece of information about that story that the reader had to infer from the text (sleepy hollow)

Answers

Answer:

2. One reason Montresor is wearing a costume is to be sure no one recognizes him when he is walking back to his house with Fortunato.

3. Fortunato was a competitive person because he got jealous when he thought Luchesi was going to taste the Amontillado.  

7. No one ever found Fortunato, who Montresor buried alive down in the catacombs.

8. Montresor kept giving Fortunato wine because he knew he could not resist it and wanted Fortunato to keep following him.

Explanation:

Making an inference is when the author does not directly provide the events or tells us the story. The readers have to try to make out the events of the story through the hints or other information given in the story to understand the story.

Among the given inferences in the list, the correct inferences are the second, third, seventh, and eighth sentences. These statements are inferences that readers have to make themselves to understand the events and the whole story. Whereas, the other sentences are directly stated by the author in one way or another. therefore, they are not inferences.

Thus, the correct answers are the 2,3,7,8.

What is the main problem Kwan faces in the story?​

Answers

Answer:

Anyway, I was old enough to face my problems by myself now. ... Feeling desperate, I turned to Kwan-Yu Hsung, a new friend in the seventh grade.

Explanation:

from the book

This is for one hundred points
upload your presentation about the stem field containing the following: a title career inventory results from the career interest inventory you took in the lesson. be sure to state which test you took, the results of the test (what stem careers were revealed to be best suited to you), and your thoughts on these results (for example, were you surprised by any of the results?). stem careers discussion. select two careers from each of the stem fields (science, technology, engineering, and mathematics). provide a job description, the skills needed to perform the job, and the importance of the job. be sure to include the careers that were revealed from your career inventory assessment. your challenge discussion. reviewing the list of challenges we still face in the world, which one would you like to resolve, and why? identify what career would allow you to work on this problem. a reference page

Answers

The question wants to analyze your understanding of careers and your personal preferences in this regard. For that reason, I can't answer your question, but I'll show you how to answer it.

Response structureShow the career you want to pursue.Explain the reasons that make you choose this career.Show how you want to overcome one of humanity's challenges with this career.Explain how this career is relevant in today's world and compare it to another type of career.

You can take vocational tests to determine which career suits you best. If you take these tests, you must include them in your answer and explain whether or not you agree with their results.

Learn more about vocational tests at the link:

https://brainly.com/question/14644704

#SPJ1

An unexpected harsh dissonance coinciding with the word death is an example of.

Answers

Answer:

word-painting

Explanation:

An unexpected harsh dissonance coinciding with the word death is an example of auditory imagery.

An example of auditory imagery, a literary device that appeals to the sense of hearing, is an unexpected harsh dissonance that coincides with the word "death." It is employed to establish a particular tone or atmosphere in the text. The dissonance in this case may signify a startling or unsettling moment, highlighting the importance of the word "death" in the story.

By evoking strong feelings in the reader, auditory imagery can enhance the impact and memorability of a scene. The author can fully engross the reader in the narrative by expertly utilizing this literary device, heightening their sensory experience and strengthening their connection to the characters and events.

learn more about auditory imagery here

brainly.com/question/14318959

#SPJ3

20 POINTS
Think of a short story, a tv show or film where forbidden love is a major theme. Describe the characters and the situation where their relationship (romantic or friendly) is forbidden by family or society. Provide the name of the story or film and explain how family or society restrict or forbid their relationship and the outcome.

Answers

Answer:

Titanic

Explanation:

Titanic is a good example of forbidden love, where Jack and Rose are being stopped by the other guys, keeping them from meeting each others. However, in the end with their undying love, Jack sacrificed himself to save Rose when the ship sank

What is the most likely reason for the poet to oppose the phrases “tolling the Bell” and “sings” in these lines

Answers

The most likely reason for the poet to oppose the phrases tolling the Bell” and “sings” in these lines is that the second option is far more natural and better than the first one.


Who is a poet?

A poet is a person who understands and  is able to properly write poetry.

It is correct to state that the most likely reason for the poet to oppose the phrases tolling the Bell” and “sings” in these lines is that the second option is far more natural and better than the first one.

Learn more about poetic lines at:
https://brainly.com/question/9861
#SPJ1

What should I put here?

Answers

Answer:

An opening sentence.

Explanation:

Hope this helps!

Sir malcolm campbell set a land-speed record on september 3 1935 when he drove more
than three hundred miles per hour.


where do i put 2 commas

Answers

Answer:

Sir Malcolm Campbell set a land-speed record on September 3, 1935, when he drove more than three hundred miles per hour.

Explanation:

The commas go around the year, 1935.

N
Micah is writing an argumentative text about social media. Read his introductory paragraph below.
Which statement best serves as Micah's claim?
Select the correct statement.
The Toxicity of Social Media
For decades, many teenagers shaped their understanding of reality based on magazines, movies, and television. Now, we add the raise of social
media to this list. Parents blame the popularity of social media for changes in their children's understanding of themselves and societal concepts
such as beauty, health, success, and culture. For the last decade or so educators have argued that social media is a huge threat to not only
academic success, but students' identities and self-esteem. As more social media platforms sprout up, the more issues teenagers face and the
more problems we must scramble to find solutions for. Others will argue that educators and parents much understand how to navigate this
new world and teach teens the rules of digital engagement. While these platform founders will tell us that their created these avenues to
engage us in networking and exploring the world through the lens of different cultures, research will prove otherwise in that social media is
extremely toxic.

Answers

The statement that best serves as Micah's claim is "the beauty of art is no mere accident of human life" but "an absolute necessity"

What is a claim?

A claim can be regarded as an assertions about something which might not entails a complete proof.

Therefore, from the excerpt we can see that the claims were based on the beauty of art and how it is important in the life of human.

Learn more about claim at;

https://brainly.com/question/20971909

#SPJ1

Answer:last one

Explanation:

Jared came down with a cold. the doctor said that jared should rest for a few days to let the cold run its course. unfortunately, jared had to miss his school's musical. question what is the meaning of the idiom ,begin emphasis,run its course,end emphasis,? answer options with 4 options 1. miss out 2. follow a path 3. have no energy 4. continue until finished

Answers

Answer:

4 continue until finished

I need help asap
from "the lottery ticket"
which best expresses a theme of the story?
a. goals sustain us in difficult times.
b. with hope and hard work, anything is possible.
c. thwarted dreams breed frustration and bitterness.
d. it is better to choose true love over money.

Answers

When one actually looks at the question, one will actually discover that the best option that one can actually see as the best option and which can be chosen since it expresses a theme of the story is: Option D.

What can you say about the theme of a story?

Theme can be defined as the important idea or lesson that can be seen in a story or even a poem. It actually shows what the author or writer is trying to pass across to the audience.

We can actually see here in "The Lottery Ticket" written by Anton Chekhov that lottery win made Ivan and Masha to begin to hate themselves. The money bred hatred and suspicion and not true love.

Learn more about theme of a story on https://brainly.com/question/11600913

#SPJ4

Which two poetic devices are present in the following line from "The Raven"? (Choose two correct answers.)

"For the rare and radiant maiden whom the angels name Lenore --"
A
Assonance
B
Internal Rhyme
C
Alliteration
D
Repetition
E
Consonance

Answers

The two poetic devices that are existing in the given line from “The Raven” are the internal rhyme, and repetition.

What is the poetic device?

Poetic device is defined as written material devices that are employed in poetry. Poems are made up of a variety of poetic methods, including grammatical, structural, metrical, rhythmic, visual, and verbal aspects.

They're necessary instruments for a poet to generate rhythm, enhance the meaning of a poem, or amplify a mood or sensation. Internal rhyme and repetition are two poetry elements that appear in the following passage from “The Raven.”

Therefore, option B, C, and D are correct.

Learn more about the poetic device, refer to:

https://brainly.com/question/1762582

#SPJ1

What are the three types of family.​

Answers

Types of families
are: nuclear family, single-parent family and extended family. A nuclear families is made up of parents and one or more children living together.

Answer:

Single parent family , nuclear family , joint family

Explanation:

Single parent family is family with one parent , nuclear family has two parents and 1 or more childrens , joint family is family living together with relatives Please mark as brainlist

You recently participated in a ‘Science Fair Exhibition’

organized by your school. Participants from as many as 30

schools in the city took part in the event. Write about the

event in 100 -120 words describing, how was the program

and who was awarded the best prize etc.
pls reply

Answers

The event of Science Fair Exhibition’ took place in my school on 09/06/2022, where we talk about importance of science in our society, And I won a prize.

What is an event?

Event can be referred to as a planned occasion which can be social or academic with an importance.

'Science Fair Exhibition’ serves as the one which is a competition among schoolchildren about science.

About 30 students participated, but I was the winner with best performance after I presented that science has brought about development of drugs for diseases that were not curable before.

Learn more about event at;

https://brainly.com/question/25821071

#SPJ1


Who every answers the questions first will get brainless please help ASAP

Answers

Answer:

a) When I feel that the Instant gratification monkey takes over my brain, I take a break from my devices and go outside. I do some exercise or play some sports, to get my mind off whatever device I was on. Then, when I come back home, I find myself focused and not thinking about the next time I check my phone.

b) I am procrastinating on my online school homework. Some things I can do is to have a parent be accountable for me and make sure they keep me in check. I can work with friends as it motivates me to finish my work. I can also go take a break and get my mind off social media.

During the revision process, whichtype of wording should a writer delete in a narrative essay

Answers

Answer:

Weak wording(e.g words that could easily be improved to a stronger meaning to ensure quality in your essay).

PLEASE ANSWER THIS ASAP !!
What can we infer about Marcus when, after a long interrogation, he ends up giving DHS
his passwords?

A) Marcus was scared of authority.

B) Marcus was easily persuaded.

C) Marcus was tricked into giving in.

D) Marcus was weak.

Answers

Answer:

A) Marcus was easily persuaded

Explanation:

Which sentence uses humor in this excerpt from Charles Farrar Browne's "Interview with President Lincoln"? 1."Mr. Linkin, who do you spect I air?" sed I. 2."A orfice-seeker, to be sure," sed he. 3. "Wall, sir," sed I, "you's never more mistaken in your life. 5.I'm the father of Twins, and they look like me--BOTH OF THEM. 6.Repose in Abraham's Buzzum!" sed one of the orfice seekers (there are 3 qs?

Answers

I'm the father of Twins, and they look like me--BOTH OF THEM is the  sentence uses humor in this excerpt from Charles Farrar Browne's "Interview with President Lincoln.

What are 3 things Abraham Lincoln is famous for?

Abraham Lincoln is famous for many things like -

He was mostly self-taught.Lincoln served four consecutive terms in the Illinois state legislature before entering national politics.Lincoln's wife was born into a wealthy slave-owning family.Lincoln did not support abolition.

Thus, option 5 is correct.

For more details about Abraham Lincoln, click here:

https://brainly.com/question/11825047

#SPJ1

Which of the following sentences uses capitalization and punctuation correctly?
If you want to go with Sara in July you will need to get good grades in April May and June.
Raphael, planned to go to town on tuesday; that would give him enough time, to get everything ready.
Hoping he would not forget anything important, Micah set out the following items: test booklet, pencils, erasers, calculator, and scratch paper.
Jamison: had the goal of earning enough money to buy a car by the time, he was eighteen.

Answers

Answer: Hoping he would not forget anything important, Micah set out the following items: test booklet, pencils, erasers, calculator, and scratch paper.

This sentence is correct

Read the passage from "Fierce Eyes."

It was only my father, brother, and I who left. My mother stayed behind with my two teenage sisters for fear that the journey by boat to Thailand would be too dangerous for them. Toua and I were small (he was only three and I was nearly five), so the pirates would leave us alone. To be safe, my father cut off my hair and dressed me as a boy.

Which statement best describes this passage?

The author presents a problem the characters face and its solution.
The author compares and contrasts two settings within the story.
The author uses dialogue to introduce descriptive details to the reader.
The author uses descriptive details to introduce a setting in the story.

Answers

The statement that best describes this passage is The author uses dialogue to introduce descriptive details to the reader.

What is a passage?

A comprehension passage refers to writings words in which questions are given to help in understanding the write up well.

Therefore, The statement that best describes this passage is The author uses dialogue to introduce descriptive details to the reader.

Learn more about passage now.

https://brainly.com/question/24912155

#SPJ1

Answer:

option C

Explanation:

hope this helps :)

Which sentence from the paragraph contains the best use of domain-specific vocabulary?

Shakespeare’s writing style reveals information about attitudes toward the landscape.
His precise word choice provides detailed descriptions of the outdoors.
In Titus Andronicus, he uses words like “ruthless,” “vast,” and “gloomy” to describe forests.
Although he is known as the “playwright’s playwright,” Shakespeare could have been a travel guide.

Answers

The sentence from the paragraph contains the best use of domain-specific vocabulary is In Titus Andronicus, he uses words like “ruthless,” “vast,” and “gloomy” to describe forests.

What is a sentence?

A sentence refer to group of words which contain a subject and also predicate that has meaning and comprises of noun and verb.

Therefore, The sentence from the paragraph contains the best use of domain-specific vocabulary is In Titus Andronicus, he uses words like “ruthless,” “vast,” and “gloomy” to describe forests.

Learn more about sentence below.

https://brainly.com/question/25841954

#SPJ1

Answer:

the answer is C

Explanation:

In Titus Andronicus, he uses words like “ruthless,” “vast,” and “gloomy” to describe forests.

What is the difference between sensory details and abstract statements?
A. Sensory details appeal to only a few people, whereas abstract
statements appeal to everyone.
B. Sensory details are appropriate in poetry, whereas abstract
statements are appropriate in prose.
C. Sensory details appeal to the intellect, whereas abstract
statements appeal to physical experiences.
D. Sensory details are vivid and specific, whereas abstract
statements are broad and general.

Answers

Answer:

option d is the answer

What is the most likely definition of "duplicity"? counterfeiting cunning determination dishonesty

Answers

Answer:

I would say dishonesty.

Explanation:

Duplicity is typically refers to someone who is deceitful (often associated with being two-faced). Thus, the answer would be dishonesty.

However, that's not to say a duplicitous person can't be cunning, determined or counterfeit money.

Answer: D (dishonesty)

Explanation:

Duplicity means contradictory doubleness of thought, speech, or action//the simplicity and openness of their lives brought out for him the ''duplicity'' that lay at the bottom of ours.

Dishonesty is a synonym of Duplicity

Which detail from this excerpt highlights that Gus is a loyal, caring friend?

[5] "Look at the monkey on a mule!"

[6] Gus cared nothing for taunts and slurs against himself, but he deeply resented any suggestion of insult aimed at his crippled friend. However, although Bill could not defend his reputation with his fists, a method which most appealed to Gus, the lame boy had often proved that he had a native wit and a tongue that could give as good as was ever given him.

[7] "Here we are, Gus, and how can I ever get square with you?" Bill said, his crutch and loot thumping the steps as the boys gained the doorway.

[8] In answer to the bell, a sweet-faced lady opened the door, greeted the boys by name and ushered them into a book-lined study where already several other boys and girls of about the same age were gathered about their school teacher.

Answers

Answer:

This sentence in the 6th paragraph, Gus cared nothing for taunts and slurs against himself, but he deeply resented any suggestion of insult aimed at his crippled friend," shows that Gus is a loyal, caring friend. He only cares for his friend and not himself.

Answer:

took the test

Explanation:


2. based on the information in "earth's eye," walden pond has been influenced by

Answers

We need more context to see what it's been influenced by!

How many Stanzas does the poem “Where My Books Go” Have?

Answers

Answer:

4

Explanation:

All the words that I utter,

And all the words that I write,

Must spread out their wings untiring,

And never rest in their flight,

Till they come where your sad, sad heart is,

And sing to you in the night,

Beyond where the waters are moving,

Storm-darken’d or starry bright.

Which sentence from the text best shows that thurgood marshall believed prejudice against race was never acceptable?

Answers

Answer:

"For Marshall, fighting for civil rights followed a different avenue than the nonviolent protests led by Dr. Martin Luther King or the more militant demands of Malcolm X."

Explanation:

"For Marshall, fighting for civil rights followed a different avenue than the nonviolent protests led by Dr. Martin Luther King or the more militant demands of Malcolm X": best shows that Thurgood Marshall believed prejudice against race was never acceptable.

What was Thurgood Marshall best known for?

As a civil rights attorney, Thurgood Marshall utilized the legal system to combat Jim Crow and end segregation in the United States. Marshall was a huge personality who was appointed as the first Black justice of the US Supreme Court. The Supreme Court deemed "separate but equal" in public schools to be unconstitutional in the famous 1954 Brown v. Board of Education decision, for which he is best known as the lead attorney.

One of the top lawyers in the country, Marshall attained success. He presented 32 cases before the US Supreme Court and prevailed in 29 of them. In 1961, Marshall received a nomination from President John F. Kennedy to serve on the Second Circuit U.S. Court of Appeals. On August 30, 1967, President Lyndon B. Johnson appointed Marshall as the nation's solicitor general.

Learn more about Thurgood Marshall here:

https://brainly.com/question/1150183

#SPJ2

Which sentence BEST states the central idea of "Picture
Yourself a Winner"?

Answers

The central idea of story could be winner which other element of the story is attached to.

What is Central Idea?

Stories, write up contains central idea and this is the main stem or pillar on which other idea of the story is joined to.

The idea brings with itself other element that are present in the write up to give a meaning.

Therefore, The central idea of story could be a winner which other element of the story is attached to.

Learn more on central idea below

https://brainly.com/question/1914191

#SPJ1

Other Questions
HELP ME CJDUCIF PLEASE I WILL MARK BRAINLIST You and your family are going on afamily cruise this summer! WOO HOO!Your parents had to put down a $250deposit. Then, the cruise costs $500per person on top of that. There are 5people in your family. How much willthe entire cruise cost? Okay our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? Evaluate the following for the given values. 7xy - y + x - 1 for x = -2 and y = -1 Which term matches the picture? What hint does the author of how to jump start a battery give for remembering that you should connect the positive clamp onto the battery before the negative clamp Who created the Universal Declaration of Human Rights?Select one:a.Pierre Elliot Trudeaub.UN General Assemblyc.Lester B. Pearsond.Amnesty International Which associations best describe the scatter plot?Select each correct answer.Positive associationNegative associationLinear associationNonlinear association Escribe canciones originales. PLEASE HELP!!!! Which of the following scenarios is related to ethical issues?O A. A client confides to a nurse aide that her parents physically abuse her.O B.A nurse aide notices cigarette burn marks on a client when helping her dress.O C.A nurse aide sees her colleague stealing drugs from the healthcare facility.OD. A nurse aide does not properly sterilize medical equipment so she can leave early.OE. A nurse aide avoids attending to clients from a particular socio-economic background.UndoNext The quarks that compose a baryon may have charges of:. If f(x) = x - 2x, find:f(5) = [?] Given f(x) = x^4. if the function is transformed so that the inflection point is (-2, 1). write the new function. Imagine that you're reading about the different roles the president of the United States plays, including the commander in chief of the armed forces, chief diplomat (which involves setting foreign policy and dealing with foreign governments), and chief of state (which involves serving as the main representative of the country). What mental image could help you remember these three roles? Select the correct answer from each drop-down menu. which sector dominates developed economies such as the united states? in developed economies such as the united states, the sector dominates the economy. examples include legal firms, , and so on. Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence ccgg. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA LLFC95D2x+3EWhat is the value of x and the length of segment DE?1 5992x + 32. 10x+15=9(9)Length of DE=units Read paragraphs 36. Which main techniques does the author use in all three paragraphs to develop the idea that Zitkla- 's mother has negative feelings about the paleface? a rectangle mural measure 234 inches by 245 inches, rihanna created a mural 33 inches longer Lisa is a high school student who went to see her guidance counselor. she was given a questionnaire that contained these questions: what activities do you enjoy the most? the least? which things would your job need to include in order to make you feel satisfied? what things are you especially good at? what values, beliefs, or principles are most important to you? what issues or causes do you care about? which best explains why lisas guidance counselor asked her these questions? so she could see her personal vision and plan achievable goals. so she could set her priorities and adjust her goals. so she could visualize her future and plan achievable goals. so she could identify her milestones and adjust her goals.