Psychologists use a variety of research methods to study behavior. Three of the main research methods used are:
a) case study
b) correlational study
c) experiment. Discuss one advantage of each research method listed above.

Answers

Answer 1

The advantages of different types of research methods used by psychologists, include,

Case Study – Detailed analysis Correlational study – Expression of relation between two similar topicsExperiment – Trial on a subject to derive successful interpretations

A research method can be referred to or considered as a method used by an individual with regard to conducting a study related to a particular topic or a subject. A research can be done in the form of a case study, a correlational study, or an experiment, and their advantages have been mentioned above.

Learn more about research methods here:

https://brainly.com/question/29243049

#SPJ4


Related Questions

Which character has a letter saying that Brutus and Cassius are not to be trusted?

Answers

D is the answer okay okay

. To make something on a large scale- which word below matches the definition? *
a. industry
b. manufacturing
c. factories
d. enterprise economy

Answers

B. Manufacturing- make (something) on a large scale using machinery


HURRY PLEASE !
Which of the following was not a
characteristic of trench warfare?
a. quick recovery of wounded
b. mud, filth, and insects
c. poisonous gas
d. bayonet fights

Answers

Answer: quick recovery of the wounded

Explanation:

its so self explanatory

After gathering information, a student using the problem-solving process should next

consider options.
implement a solution.
weigh disadvantages.
evaluate a solution.

Answers

Answer:

a

Explanation:

edg

After gathering information, a student using the problem-solving process should next consider options.

What is the meaning of Students?

A person who is enrolled in a school or other educational institution is called a student. A "student" is someone who attends secondary school or above in the United Kingdom and the majority of commonwealth nations; "pupils" are those who attend primary or elementary schools.

Student Participants in Research. Students serve a crucial role as research subjects in academic institutions, such as when studying teaching strategies, curriculum, and other topics linked to the scholarship of teaching and learning.

A good student can be described in a variety of ways. Working diligently, turning in assignments on time, engaging fully in class, and receiving good grades are a few examples of typical expressions.

Students of the World is dedicated to giving each student individual attention and promoting cross-cultural interaction, language learning, and global education.

Hence, option A is appropriate.

Learn more about the Student here:

https://brainly.com/question/17332524

#SPJ7

In one paragraph, describe how leaders in Southeast Asia can work to protect their people from natural disasters.

Answers

Answer:

perhaps the main reason why southeast Asia in particular is prone to such natural disasters is due to its location. The region sits on the Pacific Ring of Fire, a geologically and volcanically active area that stretches in a horseshoe like basin across the Pacific.

But the Leaders in Southeast Asia can work together in unity giving awareness, education, preparedness, and prediction and warning systems they can reduce the disruptive impacts of natural disasters on communities. Migration measures such as adoption fo zoning,land-use practices,and building codes are needed, however to prevent or reduce actual damage from hazards.

Egypt religion


Yaaaa I dunoo

Answers

Answer: Islam

Explanation:

The religion of Egypt is mostly Islam owning to the fact that they are Arabs and close to the Middle East. Historically, the Egyptians had their own religion which had gods such as Ra and Osiris but as Egypt was conquered by various empires, their religion changed.

When the Muslims conquered and annexed Egypt completely from the Christian Byzantine empire in 646, Arabs flooded into the country over the next centuries and made the country's religion, Islam. There exists a very small minority of Christians however known as the Coptic Christians.

What moth will survive its environment better?

1. moths with black wings.
2. moth with speckled (peppered) wings.

Answers

Answer:

Moths with black wings

Explanation:

Hope it helps

Moths with black wings can blend into the environment easily in mostly black trees and hide from predatory insects,amphibians or animals.
This proves that moths with black wings have a higher survival rate.

Hope this helped : )
Hv a nice day.

June's cat runs to the kitchen at the sound of the electric can opener, which she has learned is used to open her food when her dinner is about to be served. The cat does not run when a blender is used, although it sounds similar. June's cat is demonstrating stimulus: control discrimination generalization

Answers

Answer:

discrimination

Explanation:

The correct option is - discrimination

Reason -

June's cat runs to the kitchen at the sound of the electric can opener, which she has learned is used to open her food when her dinner is about to be served. The cat does not run when a blender is used, although it sounds similar. June's cat is demonstrating stimulus discrimination.

Why has Lake Chad changed in size over time?

Answers

Answer:

It has changed in size due climate change, population growth and irrigation. It had shrunk by 90%

hypothesis how an injury to the spinal cord might affect the ability of the nervous system to sense and respond to a change in the envoriment

Answers

The brain and spinal cord are your body's central nervous system. The brain is the command center for your body, and the spinal cord is the pathway for messages sent by the brain to the body and from the body to the brain.

what does legalism mean in a vocab sentence

Answers

Answer:

strict, literal, or excessive conformity to the law or to a religious or moral code.

Explanation:

i found this at https://useenglishwords.com/legalism

Answer:

1 : strict, literal, or excessive conformity to the law or to a religious or moral code the institutionalized legalism that restricts free choice. 2 : a legal term or rule

True/False. St. Augustine, Spanish
controlled, is the oldest continuously
occupied European settlement in this
part of the world.

Answers

Answer:

True

Explanation:

in your own opinion, discuss the housekeeping job task.​

Answers

Answer:

Housekeeping could be considered maid work or janitorial in a way, just for a more private employer. A house keepers job is, as the name states, to keep the house kept. This means clean top to bottom, cooking, catering to the employers and their needs. You must always be on call and ready to work. you could look at it was a glorified nanny for adults or wealthy/ large families.

Answer:

Dusting and polishing furniture and fixtures. Cleaning and sanitising toilets, showers/bathtubs, countertops, and sinks. Maintaining a clean and sanitary kitchen area. Making beds and changing linens. Washing windows.

Explanation:

Hope it helps u

FOLLOW MY ACCOUNT PLS PLS

Select the correct locations on the map.
It is the fourteenth century. The Ming Dynasty rules China. The emperor doesn’t want western European influence on his land and people. He drastically reduces trade between China and Europe. However, some European merchants still secretly come to China to trade. The Silk Road is unavailable. Mark the places on the route that European traders will have to take to and from China instead.

Answers

Answer:

the answer is the last four boxes

Explanation:

just took the test

hope this helps

mark me pls

Answer:

ya dude above me is right

Explanation:

Why did southern states secede from the union

Answers

Answer:its b

Explanation:

How does the color of fur relate to helping animals survive?

The color of their fur indicates which animal is the strongest.
The colors help animals be able to see other animals while hunting.
The colors help animals blend in with their environment.
The color of the fur helps animals run, swim, and walk.

Answers

Answer:

The color helps animals blend in with their environment.

who contributed to and helped improve race relation A. William B Hartsfield B. Ivan allen jr.

Answers

Answer:

B. Ivan allen jr.

Explanation:

Which tribe was not affected by the Indian Removal Act?

Answers

The correct answer is: The Seminoles and other tribes did not leave peacefully, as they resisted the removal along with fugitive slaves. The Second Seminole War lasted from 1835 to 1842 and resulted in the government allowing them to remain in the south Florida swamplands.




Write any one advantage of Veto Power.​

Answers

No one can cast more than one vote

Answer:

The ‘veto’ allows the P5 to reject any resolutions that do not benefit their country, or their country’s allies, economically or politically.

The ‘veto’ can be used regardless of the vote of the majority, and regardless of how important the resolution may be in de-escalating a conflict.

sorry that it's two advantage, just choose one

what us counterculture

Answers

Answer:

A counterculture is a culture whose values and norms of behavior differ substantially from those of mainstream society.

Answer: a way of life and set of attitudes opposed to or at variance with the prevailing social norm.

Examples of countercultures in the U.S. could include the hippie movement of the 1960s, the green movement, polygamists, and feminist groups.

How was Sultan Suleiman a bad leader? (Ottoman Empire leader)

Answers

Answer:

How did Suleyman improve the Ottoman Empire? With his vast knowledge he helped improve the Ottoman empire by expanding to the east and west, built bridges and mosques, reformed taxes and systems, and during his rule, he was considered to have made many cultural achievements creating the height of this empire.

Explanation:

Why is it important to be safe even after a storm passes ??

Someone help
Plsss

Answers

stay inside, stay away from windows, etc.

CAN YOU HELP ME PLZZZZZZ I NEED YOU TO MAKE A ONE SENTENCE SUMMARY OF THIS POEM PLZZZZ I WILL GIVE ALL POINTS AND BRAINLIEST

Answers

This one starts off quite gaily with poet and Nature in happy and friendly accord, but not all is well in Paradise;The poet finds herself a bit weepy because sometimes all the glories of a summer day are not enough to overcome grief.

please helo me with these two i dont know them please go​

Answers

Answer:

Question 1 - The US Constitution, acts of congress and treaties, state statues. local laws

Question 2 - The power to declare war.

Question 1: Second choice or B

Question 2: Third choice or C


I had these same questions and got an 100% so these are right

Who became president after the 1876 presidential election?
Ulysses S. Grant
Rutherford B. Hayes
Thaddeus Stevens
Samuel J. Tilden

Answers

Answer:

Rutherford B. Hayes

Explanation:

Answer: On this date, a Joint Session of the 44th Congress (1875–1877) met for the first time to count the electoral votes in the 1876 presidential election. Democrat Samuel Tilden had emerged from the close election leading Republican Rutherford B. Hayes of Ohio, just one vote shy of the 185 needed to win.

According to the Social Contract of
Rousseau, if the government does not
fulfill its' role to protect life, liberty, and
property, what can the people do?

Answers

Answer:

According to the Social Contract of Rousseau, if the government does not fulfill its' role to protect life, liberty, and property, the people can dissolve the government and form a new one. This is because, according to Rousseau, it is the citizens themselves (and not the government) who have sovereignty and therefore the power to determine the destiny of the nation, the government being a mere instrument for this.

Thus, Rousseau adheres to ideas of a libertarian tinge, advocating a limited government and leaving in the citizens a good amount of power destined to control the activity of the government itself.

The table below describes the federal government. Government Branch Member
Executive Branch President
Legislative Branch Congress
Judicial Branch ?
Which of the following belongs in the box with the question mark?
A. Senate
B. Cabinet
C. Supreme Court
D. House of Representatives

Answers

Answer:

B

Explanation:

hent You to be look point López nent the gent for can

Option (C) will replace the question mark in the question. Option (C) Supreme Court, will be the right answer. The Judicial Branch consists of the Supreme court and other courts.

What are the three branches of the government?

The U.S. Constitution grants Congress, the President, and the Federal courts, respectively, the authority to act as the legislative, executive, and judicial departments of the federal government.

The Executive Branch of our government is run by the President of the United States. The Legislative Branch (Congress) passes laws, which are then enforced by the President.

Congress is the legislative branch of the US government. The laws are made by Congress. There are two chambers of Congress. The Senate is a name for one section. There are 100 Senators, with two from each state. House of Representatives is the name of another section.

The Supreme Court and its nine Justices are part of our federal government's judicial branch. They are special judges who apply the Constitution to the interpretation of laws. Only cases involving constitutional problems are heard by these justices. They are the nation's highest court.

Thus, Option (C) will be the correct one.

Learn more about the Supreme Court, from:

brainly.com/question/13375489

#SPJ2

how many air conditioning units can Germany produce if it builds 6,000 railroad engines

Answers

Answer:

160,000

Explanation:

Who was assigned the duty of actually
writing the Declaration of Independence?
A. Richard Henry Lee
B. John Adams
C. Thomas Jefferson
D. Ben Franklin

Answers

C.Thomas Jefferson
Hope this helps
Thomas Jefferson , C HOPE THIS HELPS LUV

why does andrew jackson justify the native american removal policy​

Answers

Answer:

to stop hackers?

Explanation:

Other Questions
Please write in the correct adjective.1. Mi hermano es __________(fat).2. Mis abuelos son _______(strong). 3. La hija es muy _______ (pretty).4. Mi esposo y yo somos ___________ (smart).5. Yo soy ______________ (burnette).6. Yo estoy ____________(busy).7. Nosotras estamos __________(sad). In the figure below, R is between Q and S, and S is between R and T. If QS = 12, RT=9, and QT=17, find RS. Name the main layers of a tropical rain forest. What kinds of plants grow in eachlayer? Please select the word from the list that best fits the definitionIllegitimate power that is achieved by force or the threat of force. Describe and correct the error in solving the equation This bar chart shows the numbers of pets owned by peoplequestioned in a survey. Note that the scale on the verticalaxis is missing.The total number of petsowned by the respondentsis 92.How many people ownedexactly 2 pets? Why did many americans lose faith in president ford's leadership during his first months in office? How empathy can be used to build positive relationships? CALLIn this cartoon, how are the eastern and western sections of the United Statesdivided?OA. They are divided between states that allowed women to vote andthose that did not.B. They are divided between states that voted Democratic andRepublican.OC. They are divided between slave and free states.OD. They are divided between states that passed the ThirteenthAmendment and those that rejected it. What is the meaning of vadya? Multiply. State the product in simplest form..p-4p-1218p6p+12 p-9p+18, p - 2,3,6 How many years should I pay for SSS? What were the 3 Populist Party beliefs? The five-factor model of personality:is supported by the results of projective tests.is supported by genetic markers.has proven useful across the life span in many cultures.is not well supported. Using the following chart, which chain of amino acids would be produced by the sequence of this very short, complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA? 0.000 $20.000 530 000 S40 Task Instructions x Honolulu Denver Add the alternative text Cost forecast for three years and four cities to the chart. 1:35 AM 4 4U 325/2020 100% ^ (1) ENG 1:35 AM 11/30/2020 AUSWADUI LUULEL Attempts Remaining 7 Submit PB Forecast Excel Sign in File Home Insert Page Layout Formulas Data Review View Tell me what you want to do Askar Com General 28 O IU Insert Delete Format 14 29 Wrap Test B.O.A. s E Merge Center Alge > Cost Forecasts by City - Kitchens $ . % 4 Conditional Formatas Call Formatting Tata Styles Norber - Autocom - COR Sortid Clear Filter Set Editing board Font H M O Precision Building Cost Forecast by City Cost Forecasts by City - Kitchens City Year 2020 Year 2021 Year 2022 $43.000 $44000 $45,000 550.000 $65.000 $67.000 $38.000 $40 000 $43.000 $5.500 $55.000$$7.500 Atlanta, GA Boston, MA Denver CO Fionolulu, HI 2011 Based on 150 sq. ft. Kitchen S. . 50 Honolulu Denver Task Instructions Forecasts Add the alternative text Cost forecast for three yem and four cities to the chant. Type here to search i 1252 O DI How can I get my SSS verification slip online? What were the goals of the US in Afghanistan? What are 3 interesting facts about the Taj Mahal? identify the conclusions that can be drawn from the given premises using existential generalization. (check all that apply.)Check All That Apply a. There exists a non-six-legged creature that eats a six-legged creature. b. There does not exist a non-six-legged creature that eats a six-legged creature. c. There exists a noninsect that eats an insect d. There does not exist a noninsect that eats an insect.