Question:
In a laboratory demonstration, a balloon filled with methane and oxygen was exposed to a
flame. The result was a brief, large flame. The students were asked to formulate an equation for
the reaction. One answer is below.
CH, + 0 = CO,
This equation is incorrect.
A. Explain how and why it is incorrect
B. What would the correct equation be, and how do you know that?

Question:In A Laboratory Demonstration, A Balloon Filled With Methane And Oxygen Was Exposed To Aflame.

Answers

Answer 1

Answer:

The laboratory demonstration consists of the following;

The compounds present in the combustion reaction = Methane, CH₄ and Oxygen, O₂

The chemical equation for the combustion reaction is given as follows;

CH₄ + 2O₂ → CO₂ + 2H₂O

Therefore;

A. The equation given as CH₄ + O → CO₂ is not correct because;

1) Oxygen gas exist as diatomic molecules, O₂, and given that the experiment involves the mixture of gases, the oxygen gas present which can exist as a separate compound, should be represented as O₂

2) The number of oxygen molecules in the reaction is two rather than one

3) The product also includes two molecules of water (vapor) H₂O

B. The correct equation for the reaction should be given as follows;

CH₄ + 2O₂ → CO₂ + 2H₂O

B i) The constituents of the equation is obtained by the knowledge of the fact that the combustion reaction of an organic substance such as methane in the presence of oxygen yields, carbon dioxide and water (vapor)

The equation showing the relative amounts the reacting compounds is by balancing the basic equation of the combustion of methane in the presence of oxygen

Explanation:


Related Questions

the force that holds paticles together in the atomic nuecleaus?

Answers

Explanation:

i believe you meant particles*

Help me please:(:(:( with my bellwork
for brainiest

Answers

Answer:

Elements are made of only one kind of atom

Compounds are made of 2 or more elements chemically bonded together

Explanation:

Its right there????

DRAW A PEDIGREE

Read the following information and ON NOTEBOOK PAPER, construct a pedigree using the symbols we went over Tuesday: Scott is married to Christa. They have 3 children, Blake (a son), Peyton (a daughter), and Ashton (a daughter). Blake is married to Allie and they have 2 children, Henry (a son) and Harper (a daughter).

When you have completed your pedigree drawing, take a picture and attach it to this assignment and submit.

Answers

Answer:

Here you go

Explanation:

5. Which of the following elements will have a charge of 4+ or 4- as an ion?

Answers

Answer:

The answer would either be Carbon or Silicon.

Explanation:

A sound wave moves from a solid material into a liquid. What would happen to the frequency of the sound?

Answers

The frequency of the sound waves travel faster and more effectively in liquids than in air and travel even more effectively in solids.

If you start with 14.0 grams of diatomic nitrogen (N2) how many grams of diatomic hydrogen (H2) will react with it?

Answers

Answer:

I just need points

Explanation:

whegehhwjwjwhehebebejeuhebehejejbebe

how to find the electron in an atom/element

Answers

Answer:

to find the number of electrons an element has locate it on the periodic table of elements find the atomic number and note the number of protons because they are naturally electrically neutral

Answer:

M-A=N

Explanation:

M-A=N

Here is an example.

The equation above means that the atomic number (A) subtracted from the average atomic mass (M) equals the combined amount of neutrons and protons. Since we know that 35 17Cl is Chlorine (this is because Chlorine (Cl) is the 17th number on the periodic table and has the average atomic mass of 35), we can insert our data into the equation and end up with the following:

35-17=18.

From here, we can tell that we have a mix of neutrons and protons, with the total being 18. Since the atomic number is 17, we can reasonably assume that there are 17 protons and 1 neutron.

But we still need to find the number of electrons. Fortunately, the number of electrons is always equivilant to the number of protons and the atomic mass, so we know that the number of electrons is 17.

So, we have;

17 Protons

1 Neutron

17 Electrons

How many grams are in 7.5 moles of C6H12?



Group of answer choices

0.09g

630g

11.2

84g

Answers

Answer:

630gC₆H₁₂

Explanation:

How many grams are in 7.5 moles of C₆H₁₂?

C₆:12.011×6=72.066

H₁₂:1.008×12=12.096

72.066+12.096=84.162

84.162g/mol C₆H₁₂

7.5 molC₆H₁₂ ×84.162g/molC₆H₁₂= 631.215gC₆H₁₂

help with this question

Answers

Complementary DNA strand have the letters switched from each other. That would be:

A -> T OR T -> A
And
C -> G OR G -> C

As well as the direction of the strand:
5’ -> 3’ to 3’ -> 5’


For the first set:

DNA: 5’ - ATTATCGCGTAGCTAGCAGT - 3’
Comp: 3’ - TAATAGCGCATCGATCGTCA - 5’

As you can see the strands are the opposite from one another.

Try out the second set of strands and if you’re still having struggles let me know in the comments (:

Are the atoms really "sharing" electrons

Answers

No they are donating them

Susan is investigating physical changes. To do this, she places some ice into a large bowl and seals it with a lid. She leaves the bowl on the counter for several hours until all of the ice has melted. Using a balance, Susan determines that the mass of both the water and the ice are equal. Why is the mass of the ice and the water the same? (SC.8.P.9.1)

Answers

Answer:

No mass loss

Explanation:

The mass of ice and the water in the different state are equal because the same of quantity of matter is present in both state of matter of matter.

In essence, the mass of the physical change process is conserved. When mass is conserved, matter is neither created nor destroyed but can be changed from one form to the other. This is in compliance with the law of conservation of matter. So, no mass was lost in the physical change process and the mass will remain the same.

Which of the following samples of water will contain the most heat?

А-1 KL of water at 20°C
B- 1 kL of water at 70°C
C- 1 mL of water at 50°C
D- 1 mL of water at 80°C

Answers

Answer:

The answer is D- make sure you give good rate

why is a rise in sea level significant?

Answers

Answer:

I honestly dont know but its cool problably from water fill or from the waves going to much

Explanation:

the answer I can think of is it might be the way the water has waves and it moves a lot

How can magnetic force be exerted on objects?

1)Over a distance and anytime an object is in a magnet's field of influence.

2)Only through objects.

3)Only by touching an object.

Answers

I think the answer is : 1

How much oxygen (O) is in 5.41 × 106 atoms of oxygen

Answers

Answer:

They show you  how to do it sweetie

Explanation:

123456789 Common math

explain how to separate sugar from supersaturated sugar solution
guys pls help

Answers

A “supersaturated” solution contains more dissolved material. supersaturated solutions lies in the temperature of the water. more sugar will dissolve in hot water than in cold. Meaning that by separating the 2, only the supersaturated sugar would dissolve leaving the regular sugar untouched.

If you have 2.0 moles of sodium chloride (NaCl), what is its mass in grams?

Answers

Answer:

117g

Explanation:

Given parameters:

Number of moles = 2moles

Unknown:

Mass of NaCl  = ?

Solution:

To solve the problem, we need to use the expression below;

    Mass of NaCl  = number of moles x molar mass

Molar mass of NaCl  = 23 + 35.5  = 58.5g/mol

 

So;

Insert the parameters and solve;

     Mass of NaCl  = 2 x 58.5  = 117g

Which of the following is an intensive property?

Mass
Magnetism
Shape
Volume

Answers

Answer:

I believe its A. Mass

Explanation:

An intensive property is a property of matter that depends only on the type of matter in a sample and not on the amount. For example, the electrical conductivity of a pure substance is a property that depends only on the type of substance. Silver, gold, and copper are excellent conductors of electricity, while glass and plastic are poor conductors.. Other intensive properties include color, temperature, density, and solubility.

Answer:

B. Magnetism

Explanation:

Hope this helps! :))
Sorry for late answer

What is a mixture of sugar and water?

a solution

molecule

a compound

a precipitate

Answers

Explanation:

I think its a solution just me tell me in comments if right

Answer:

A solution

Explanation:

Sugar is soluble in water and would dissolve into the water to form a solution.

a flask of 0.30 L was weighted after it had been evacuated.It was then filled with a gas of unknown molecular mass at 760 mm of Hg and temperature of 300 K. The increase in mass of flask was found to be 0.997 g. Determine the molecular mass​

Answers

The molecular mass​ : 81.72 g/mol

Further explanation

In general, the gas equation can be written  

[tex]\large {\boxed {\bold {PV = nRT}}}[/tex]

where  

P = pressure, atm , N/m²

V = volume, liter  

n = number of moles  

R = gas constant = 0.082 l.atm / mol K (P= atm, v= liter),or 8,314 J/mol K (P=Pa or N/m2, v= m³)

T = temperature, Kelvin  

P = 760 mmHg=1 atm

T = 300 K

V = 0.3 L

Number of moles :

[tex]\tt n=\dfrac{PV}{RT}\\\\n=\dfrac{1\times 0.3}{0.082\times 300}\\\\n=0.0122[/tex]

The molecular mass (MW) :

[tex]\tt MW=\dfrac{mass}{n}\\\\MW=\dfrac{0.997~g}{0.0122}\\\\MW=81.72~g/mol[/tex]

How to we measure energy?

Answers

Answer:

The official measurement unit for energy is the Joule (J). Among the most common units measuring energy mention should be made of the kilowatt/hour (kWh), used especially for electric energy (in fact it is used to calculate electricity bills).

With joules hope I helped

The chemical equation describing the burning of hydrogen gas is: 2H2 + O2 ---> 2H2O.
Why is this both a synthesis and a combustion reaction?

Answers

Answer:

"A combustion reaction is a reaction in which a substance reacts with oxygen gas, releasing energy in the form of light and heat. Combustion reactions must involve O2 as one reactant. The combustion of hydrogen gas produces water vapor." and "A synthesis reaction occurs when two or more reactants combine to form a single product. ... In a double replacement reaction, two compounds exchange elements. A combustion reaction occurs when a substance reacts quickly with oxygen. Combustion is commonly called burning"

Explanation:

I tried

How many molecules are equal to 3.25 moles of carbon dioxide?

Answers

Answer:

1.957 × 10²⁴ molecules

Explanation:

The number of carbon dioxide molecules can be found by using the formula

N = n × L

where n is the number of moles

N is the number of entities

L is the Avogadro's constant which is

6.02 × 10²³ entities

From the question we have

N = 3.25 × 6.02 × 10²³

We have the final answer as

1.957 × 10²⁴ molecules

Hope this helps you

HELPPPPPPPPPPPPPPPPPPP

Answers

Answer:

not sure about the first one, but i know SDS provides information about the last 3.

Explanation:

You have discovered an element that is a poor conductor of electricity, has a low melting point, and is a gas at room temperature. How would you classify this element?


A.metal

B.metalloid

C.actinoid

D.nonmetal

Answers

AHHH ITS B SORRY I ACTUALLY KNOE THIS

Explain why the electron configuration of 2-3-1 represents an atom in an excited state?

Answers

Answer:

See explanation

Explanation:

If we look at the electron configuration closely, we will discover that the element must have had a ground state electron configuration of 2,4.

This is because, the innermost shell usually holds two electrons while the outer shells hold eight electrons each. The four electrons must be accommodated in the second shell in the ground state configuration of the compound.

However, when the atom is excited, one electron from this shell may move to the third shell to give the excited state configuration 2-3-1 as shown in the question.

Someone please help will mark as brainliest

Answers

1. solute is the substance that is being dissolve,while solvent is dissolving medium

2.saturated is solution that contain maximum amount of solut that capable of being dissolve and supersaturated is solution that contain less amount or medium of solut that capable being dissolve : example vinger

3. is a number placed in front of a chemical symbol or formula. It shows how many atoms or molecules of the substance are involved in the reaction. For example, two molecules of hydrogen would be written as 2 H2, and two molecules of water would be written 2 H2O . yes it's can be change only in caseWhen you balance an equation you can only change the coefficients

A nitrogen molecule (N2) has one triple bond. How many electrons do the nitrogen atoms share?

A. 1
B. 3
C. 4
D. 6

Answers

Answer:

3 electrons

Explanation:

Given a balanced chemical equation it is always possible to determine
A)
the physical state of the products and reactants
B)
whether a reaction will or will not take place
C)
the relative number of moles taking part in the reaction
D)
the conditions necessary for the reaction to take place

Answers

Answer:

C)  the relative number of moles taking part in the reaction

Explanation:

From a balanced chemical equation, it is always possible to determine the relative number of moles taking part in a chemical reaction.

The number of moles is the amount of the reacting specie that makes up a chemical reaction.

In balanced chemical equation, the number of moles of reactants and products must be the same. From this understanding, we can determine the amount of reactants and products needed for a chemical reaction to take place.

What does the salinity of sea water represent?
the concentration of salt dissolved in the ocean
A.the concentration of all

B. dissolved chemicals in the ocean

C. the volume of salt in the ocean

D.the mass of salt in the ocean

PLEASE GIVE ME THE RIGHT ANSWER!

Answers

Answer:

the answer is b

Explanation:

Other Questions
can somebody please help out Why would students most likely need to collect data? Check all that apply.to answer a questionto purchase an item onlineto support a positionto understand a problemto sort documents 1. For what purpose were submersibles originally designed? a. Transporting passengers underwater without the threat of storms b. Exploring under the sea c. Smuggling weapons and outlawed materials d. Attacking ships on the surface of the water2. Why was the Sub Marine Explorer originally created? a. To assist the North in the Civil War b. To harvest pearls c. To explore undersea d. To experiment with decompression sickness3. Which is MOST LIKELY to limit the how long a modern submarine can remain submerged? a. The amount of fuel in the submarine b. The air supply in the submarine c. The amount of food and water aboard the submarine d. There is no limit to the amount of time a modern submarine can remain submerged4. How were U-Boats powered? a. Hand crank b. Diesel c. Battery d. Both B & C. e. None of these f. All of these5. Which of the following statements best describes the Turtle according to the text? a. The Turtle was the first submarine used during war to destroy another ship. b. The Turtle was the first submersible used during war to attack another ship. c. The Turtle was the first submersible used during war to destroy another ship. d. The Turtle was the first submarine used during the war to attack another ship. e. The Turtle is the biggest and fastest watercraft in all of human history.6. Which of the following best describes why the author most likely wrote this text? a. To entertain his audience with stories about submarines b. To educate his readers about how submarines work c. To inform his readers about the evolution of submarines d. To convince his audience to purchase a submarine7. Which is the most likely reason why the author wrote the FIRST paragraph? a. To explain a concept that would be referenced throughout the text b. To introduce the main idea of the text c. To get the reader's attention with startling information d. To amuse the reader with an interesting historical anecdote8. Which does NOT describe a way in which the submersibles are different from submarines? a. Submersibles are usually smaller than submarines. b. Submersibles are not capable of independent operation. c. Submersibles can usually spend more time underwater than submarines. d. Submersibles cannot independently renew their air and power supplies.9. Which of the following BEST describes how the text is structured in the first paragraph? a. Compare and Contrast. b. Chronological. c. Problem and Solution. d. Sequence/Process. e. Order of Importance10. Which of these events happened first? a. The Turtle was destroyed. b. Bishop John Wilkins recognized the military potential of submersibles. c. The Sub Marine Explorer was used to harvest pearls. d. Radar and Sonar were invented.11. Which MOST LIKELY explains why U.S. submarines survived the attack on Pearl Harbor? a. Because the Japanese did not value the submarines as worthy targets b. Because the submarines were much smaller that all of the other boats in the U.S. Navy c. Because the Japanese were targeting U.S. submersibles instead d. Because the submarines were submerged and difficult to strike12. Which of the following statements is entirely TRUE? a. Sgt. Ezra Lee invented the Turtle; Cornelius Drebbel invented the first submersible b. Bishop John Wilkins invented the first submersible; David Bushnell invented the Turtle c. David Bushnell invented the Turtle; Julius H. Kroehl invented the Sub Marine Explorer d. Julius H. Kroehl invented the Sub Marine Explorer; John Wilkins invented the U-Boat13. Which of these events happened LAST? a. U.S. submarines survived the attack on Pearl Harbor. b. Sgt. Ezra Lee attempted to blow up a British flagship using a submarine c. U-Boats sank the Lusitania d. Julius H. Kroehl's developed the Sub Marine Explorer14. Which of the following would be the BEST title for this reading passage? a. How Submarines Work b. A Short History of Submarines c. Turtle: The FIrst Combat Submarine d. The Differences Between Submarines and Submersiblesarticle- submarines please help ill give brainliest! Write an expression that is equivalent to three over four (5z+ 16). 15 over four z + 16 15 over four z + 12 three over four z + 16 three over four z + 12 Fill the blanks plz Louis XIII had control and peace in France during his reign. True or false You have $500, sale price is $435. How much change will you get I WILL GIVE BRAINLIEST!!!!!!!!Which choice should be placed in the blank to create the most negative connotation?Certain environmental groups hope to convince the public that it is ____to keep pets. Abusive Unfair Wrong Extravagant what is the essay on macbeth? answer the following questions please TS is an angle bisector. If mRTS=x+10 and mUTS=2x+5, find mRTU.answer choices below 3030 degrees1515 degrees8080 degrees5 ______________ is a printing process in which an image is photographed through a screen on to a sensitized printing plate that after development is etched. Simplify the following expression: -4(-4d - 5) (Use Solving Systems by Graphing to find a solution for this question)One cellphone provider DU charges AED10 per month plus an activation fee of AED20. A second cellphone provider ETISALAT charges AED11 per month plus an activation fee of AED15. For what number of months is the cost of either cellphone provider the same? During basketball practice, Mai attended 40 free trows and was successfully on 70% of them. How many successfully trows did she make? PLEASE I NEED HELP RIGHT NOW! THANK YOU!For each equation, tell whether it is always, sometimes, or never true. Explain your reasoning in words. Rewrite each sentence using the appropriate singular or plural form. Abraham es serio someone please help me. show your work for brainliest.find the center and radius of the circle represented by the equation x^2 + y^2 - 4y - 8 = 0 What was Brahes dilemma?Ap euro What is depicted as the yellow arrows in the following image? (Using a scientific vocabulary word we learned in class and provide its definition) Which makes a bigger current- faster moving electrons or slower moving electrons?