Read the excerpt from Roll of Thunder, Hear My Cry.

The night whispered of distant thunder. It was muggy, hot, a miserable night for sleeping. Twice I had awakened hoping that it was time to be up, but each time the night had been total blackness with no hint of a graying dawn. On the front porch Mr. Morrison sat singing soft and low into the long night, chanting to the approaching thunder. He had been there since the house had darkened after church, watching and waiting as he had done every night since Papa had been injured. No one had ever explained why he watched and waited, but I knew. It had to do with the Wallaces.
HELP
What does Cassie most likely feel in the excerpt?

loneliness
happiness
restlessness
peacefulness

Answers

Answer 1

its restlessness

Explanation:

Answer 2

Answer:

tense

Explanation:

read the passage he's not relaxed or unkind and definitley not joyful


Related Questions

How does a story that is true story make it more interesting to read than a book or movie that is not based on a true story?

Answers

Answer:

cuz its like  a real life experience

Explanation:

What motivated Nelson Mandela to fight for freedom in South Africa?

Answers

Answer:

The unshakeable belief in the equality of all people and his determination to overthrow the system of apartheid in South Africa.

Explanation:

He believed in equality and wanted to stop apartheid in South Africa. He wanted people to be treated equally.

HOPE THIS HELPED

56:40
Read Shakespeare's "Sonnet 130."
What evidence supports the serious nature of the
sonnet? Select two options.
Albel
"My mistress' eyes are nothing like the sun
'If hairs be wires, black wires grow on her head."
"I have seen roses damask d, red and white
My mistress' eyes are nothing like the sun,
Coral is far more red, than her lips red:
If snow be white, why then her breasts are dun,
If hairs be wires, black wires grow on her head.
I have seen roses damask'd, red and white,
But no such roses see I in her cheeks,
And in some perfumes is there more delight
Than in the breath that from my mistress reeks.
I love to hear her speak, yet well I know
That music hath a far more pleasing sound:
I grant I never saw a goddess go,-
My mistress, when she walks, treads on the ground:
And yet by heaven, I think my love as rare,
As any she belied with false compare.
"I love to hear her speak
"And yet by heaven, I think my love as rare

Answers

Answer:

"I love to hear her speak ''"And yet by heaven, I think my love as rare''

Explanation:

Going by the utterances of the speaker in this sonnet, one can tell that the speaker's mistress is not overly attractive but he still loves to hear her speak and has a rare love for her.

This shows the seriousness of the sonnet because it shows that the speaker was able to look past physical features to like his mistress with a rare love that is not based on physical features and comparisons.

Describe the scene the animals see in the farmhouse at the end of the book.

(animal farm)

Answers

At the end of Animal Farm, Pilkington and other human farmers come to eat dinner with the pigs at the farmhouse. ... The pigs have started to dress and behave exactly like humans. The book's final image expresses the animals' realization that the pigs have become as cruel and oppressive as human farmers.
uwu

overcoming a challenge ​

Answers

Answer:overcoming a challenge is like achieving a goal you have set out or relieving stress and taking weight off your shoulders

Explanation:

Overcoming a challenge is always possible if you put In your all

The dog barked ______ as the girl _______ walked it. fill in the blanks with adverbs

Answers

Answer:

The dog barked frequently as the girl quickly walked it.

Explanation:

PLS ANSWER ASAP ill mark brainliest
What does it mean to say that something is "figurative?"

to say that its metaphorical

to say that it is literal

to say that its creative

to say that it isn't true

Answers

Answer:

to say that its metaphorical

when speech or writing is not literal, it is figurative, like when you say you have a ton of homework. You don’t really have a ton of homework but you have a lot.

so the answer is to say that it’s metaphorical

In paragraph 5 of Passage 1, the phrase awoke the seeds means which of the following?
1.planted the seeds


2.fertilized the seeds


3.crushed the seeds flat


4.made the seeds sprout

Answers

Answer:

Made the seed sprouts

Explanation:

Made the seeds sprout means in paragraph 5 of Passage 1, the phrase awoke the seeds. Hence, option D is correct.

What is sprouting of seeds called?

On a plant, a sprout is a little growth or new bud. For instance, since children are always sprouting, other things can as well. When trying to recollect the meaning of a sprout, growth is an important notion to bear in mind: a sprout is a new growth of a plant, and to sprout is to grow.

When a grain, bean, vegetable, nut, or seed is sprouted, the amount of nutrients in those foods tends to increase. Furthermore, sprouts have lower levels of antinutrients, which facilitates your body's ability to absorb all of the nutrients they contain.

To sprout and send out branches from seeds or spores, to grow new leaves or buds on old plants, or to change in any other way is a natural process.

Thus, option D is correct.

For more information about sprouting of seeds, click here

https://brainly.com/question/11806179

#SPJ6

How did geography influence the movement of people and goods across the continent in the 1800s?

Answers

Geography, U.S. History, Social Studies, Human Geography It promoted westward expansion, encouraged commerce between the Atlantic colonies and the West, and paved the way for an interstate highway system.

8. Breathalyzer examines the breath
exhaled from the
?
a. stomach
b. lungs
c. mouth
d. None of the above

Answers

It’s mouth or lungs most likely mouth

Fate: In Beowulf, he makes the statement, “Fate always goes as it must.” which means Beowulf believes in whatever happens that it was destined to be, whether he won or lost in battle. In Macbeth, fate is another important idea. He says, “If chance will have me, king, why, chance may crown me, Without my stir.” which references that he is fine with accepting the fate of him becoming King. In this essay, discuss the role fate plays in these two texts and how it influenced the actions of Beowulf and Macbeth. Please provide textual evidence to support your writing from the two texts Macbeth and Beowulf.

Answers

Answer:

True

Explanation:

Answer:

dddddddd

Explanation:

ddddddddd

What does the word "incident" mean and why do you think Cullen uses thisword to describe the event in this poem?

Answers

Answer:

he is looking back from his childhood

Explanation:

Answer:

incident

1.

an event or occurrence.

2.

likely to happen because of; resulting from.

3.

falling on or striking something

There is a park near my house with a brand-new baseball field.

What is the function of the word near in the sentence?


preposition

conjunction

adverb

interjection

Answers

Answer:

near is an adverb.  Adverbs tell how, when, or where.

Explanation:

Answer:

Explanation:

conjunction

What message about people does Douglass convey by
describing his interactions with these
boys?

Answers

if you’re talking about the boys who help him read then it shows that not all people are evil during the time of evil people having control. he shows that there are people who don’t believe that slavery was right and that there is hope

Douglas would demonstrate his tenacity and cunning to achieve the goals he had set for himself when he befriended and deceived the street boys into teaching him to read.

What is Douglas about?

Douglass argues in the Narrative that owning slaves hurts both the slave owners and the slaves themselves.

Slave owners' own moral well-being suffers as a result of the corrupt and abhorrent control they possess over their slaves.

The cruelty of slavery and the lack of knowledge provided to slaves are the two main issues that readers are exposed to.

In order to show what a horrible system slavery was, Frederick recounts the story as his own biography.

When Douglas befriended and tricked the street boys into teaching him to read, he would show his determination and ingenuity to accomplish the goals he had set for himself.

Thus, this message about people does Douglass conveyed.

For more details regarding Douglas, visit:

https://brainly.com/question/10409265

#SPJ5

1: What can the reader infer from textual evidence in the last paragraph?
A: All pets with allergies will exhibit irregular behavior.
OB: A check-up will ensure that your pet will remain allergy free.
C: Allergies can affect cats and dogs at any time, and at any age.
D: Humans are more likely to be affected by allergies than animals.

Answers

Answer:

OB: A check-up will ensure that your pet will remain allergy free.

Explanation:

This is true going by the suspicion by the person about the reaction of the pet being due to allergies. In order to resolve this issue, there is need to do a thorough medical check-up on the pet. This would help in the treatment of the allergies leading to it being allergy-free.

Editing is an important part of the journalistic process

Answers

Answer:

yes it is

Explanation:

Find the analogy
DYSFUNCTION : NORMAL 5
a) pretend : fake
b) organize : order
c) disease : healthy
d) hatred : disdain

Answers

Answer:

C

Explanation:

Disease is bad and not healthy meaning that

Disease : Healthy isnt correct

healthy means your good and no diseases

Why does the author use everyday items like a fisherman's basket to describe the appearance of the aliens?

Answers

Answer:

Because he wants the alien's image to be more familiar to the reader.

Explanation:

The author uses common everyday items to describe the appearance of the aliens, because he believed that all readers know the appearance of these items, promoting a familiarity with the appearance of the aliens. In this way, readers can create a mental image of what the aliens look like, being able to understand the story even more.

He is of average height and has a solid build owing to the years he spent as a construction worker. His face is not too wrinkled but his complexion is ruddy. He often keeps his white hair covered with a straw hat that protects him from the sun. He is usually casual dressed and he dislikes wearing a suit and a tie.

He is of average height and has a solid build owing to the years he spent as a construction worker. His face is not too wrinkled but his complexion is ruddy. He often keeps his white hair covered with a straw hat that protects him from the sun. He is usually casual dressed and he dislikes wearing a suit and a tie.

He is of average height and has a solid build owing to the years he spent as a construction worker. His face is not too wrinkled but his complexion is ruddy. He often keeps his white hair covered with a straw hat that protects him from the sun. He is usually casual dressed and he dislikes wearing a suit and a tie.

Round character
Flat characterization
All of these answers are correct.
Indirect characterization

Answers

Answer:

B flat

Explanation:

through process of elimination I think its flat, but not sure (this is direct characterization as the author directly describes, and the character does not change so is not round)

Correct the grammar!

him and i read a great artical in sports illustrated called the making of an icon

Answers

Answer:

Him and I read a great article in sports illustrated called "The Making of an Icon"

When a person lies more often...
A they feel less guilty about it.
B they feel more invincible.
C they feel guiltier.
D they feel more emotional.

Answers

Answer:

A.

Explanation: If a person is lying more and more, they might just have gotten over feeling guilty for lying.

A because they won’t have any feelings towards it and won’t care because they will believe you don’t know there lying.
(Also if you can pick too it would be A and B)

Which word could best be used in place of the word dock in this sentence? The sailor pulled his boat up to the dock and tied it to the post before getting off. quay barb vagabond clamor

Answers

Answer:  Quay

Explanation: A vagabond is a person who wanders from place to place, a clamor is a loud noise, and a barb is a sharp projection. Therefore "quay", would be the best fit, because it is a platform projecting into the water. So, "The sailor pulled his boat up to the quay and tied it to the post before getting off."

Answer:

Quay

Explanation:

A vagabond is someone who moves around from place to place, a clamor is a loud sound, and a barb is a sharp protrusion. As a result, "quay" is the best fit, as it is a platform that extends into the sea. "Before getting out, the sailor brought his boat up to the dock and secured it to the post."

Lord of the flies chapter 9 reflection.

Answers

That’s mad long you buggin

I need to write an email to cancel the IB test I registered for. Please help I am not good with emails

Answers

Answer:

Dear,  (Teacher or whoever)          

        Hello, I am (your name) and I am writing this to cancel the IB test I have registered for. I need to cancel because  (List your reasonings)

Explanation:

I am not the best either.

i dont know how to write an email and i dont even know what that test thing is  i just need some point things

Edwards' primary means of persuasion is a. Emotional words b.bandwagon c.repetition d.glittering generalities

Answers

Answer:

Explanation:Bandwagon is technique that can be used to persuade people by the speaker so that they also move in that direction in which the speaker is persuading.

In this example, the speaker of the sentence is persuading the listener to have a swimming pool for himself built like the rest of the people or like the majority of the people.

it BBBBBBBb

Answer: a. emotional words

How did the king keep from feeling guilty about this form of justice? *

a. He did not watch the festivities.

b. He made his daughter in charge of signaling judgement

c. He said the criminals made their own choices, not him.

d. He was barbaric and just did not feel guilty.

Answers

This question is incomplete. Here's the complete question.

Read The Lady Or The Tiger?, by Frank Stockton

How did the king keep from feeling guilty about this form of justice? *

a. He did not watch the festivities.

b. He made his daughter in charge of signaling judgement

c. He said the criminals made their own choices, not him.

d. He was barbaric and just did not feel guilty.

Answer: c. He said the criminals made their own choices, not him.

Explanation:

The arena of the king was meant as a device of poetic justice, where a crime was punished, or virtue rewarded, depending on what was thought to be an impartial test. Given the chance to choose one out of two doors, the criminal would face either the punishment of a tiger´s attack or the reward of a woman to get married to. Whether they would be punished or rewarded was established based on their own choice, making the King feel like has no responsibility for the result.

Imagine a company is selling running shoes. What speaker would have the most credible appeal?
Super model

Astronaut

Band director

Olympic sprinter

Answers

Olympic sprinter I think
An Olympic Sprinter.

In regards to ‘running’, aspiring athletes who are inspired to be like that sprinter will be more interested in the shoe.
In the context of ‘running’ shoes, the only representative is the sprinter as it’s the only person who has a major platform in sport. Therefore, his opinion of sport equipment etc is respected.

What is the effect of the sensory and figurative language in the following sentence??

The wind moaned a melancholy tune and the rain steamed in teardrops down my window.

A) Joyous

B) Terrifying

C) Angry

D) Apathetic

E) Gloomy

Answers

Answer:

Gloomy

Explanation:

I’m pretty sure that’s the answer goodluck

PART A: Which statement best describes how
the author develops her analysis?
A She uses the DSM-V to explore various
addictions and the consequences of
addictive behaviors.
B She provides examples of several teenagers
whose lives have been ruined by technology
addictions and how they're recovering.
C She references experts who have studied
the negative effects of an unhealthy
relationship with technology.
D She emphasizes how often the average
American spends staring at their screen or
using a device and the problems caused.

Answers

The answer is c) she references ....

The statement best describes how the author develops her analysis by referencing experts who have studied the negative effects of an unhealthy relationship with technology.

What do you mean by analysis?

Analysis refers to the careful examination of something complex so that nature can be understood.

In this statement, there is a thorough study by doing careful analysis that it negatively affects an unhealthy relationship.

Therefore, C is the correct option.

Learn more about Analysis here:

https://brainly.com/question/5040600

1. What is the theme of a literary selection?

its point of resolution

its main plot line

its central message

its major conflict

Answers

Answer:

its central message

Explanation:

The theme of a literary selection is the central message its trying to pass across.

For example, a book that talks about how greed ends up destroying a good relationship between two people, or how love heals all wounds is passing them off as the central message.

To identify the theme of a literary selection, there are important questions to ask such as, "what is the book about?", "what is the aim of the book?", etc.

Answer:

c

Explanation:

Other Questions
plzzzzzzzzz help me with this question. The question is The Incas used quipus to what ????? Which of the following is one of the greatest effects of the agricultural revolution 2 2/5 multiplied by 2 multiplied by 3 1/5 pls someone plsss help meeeee There once was a ship that put to seaThe name of the ship was the Billy of TeaThe winds blew up, her bow dipped downO blow, my bully boys, blowSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goShe had not been two weeks from shoreWhen down on her a right whale boreThe captain called all hands and sworeHe'd take that whale in towSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goBefore the boat had hit the waterThe whale's tail came up and caught herAll hands to the side, harpooned and fought herWhen she dived down lowSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goNo line was cut, no whale was freedThe Captain's mind was not of greedAnd he belonged to the whaleman's creedShe took that ship in towSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goFor forty days, or even moreThe line went slack, then tight once moreAll boats were lost, there were only fourBut still that whale did goSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goAs far as I've heard, the fight's still onThe line's not cut and the whale's not goneThe Wellerman makes his regular callTo encourage the Captain, crew, and allSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and go Please help Im stuck!!!! PLEASE HELP I NEED THE ANSWER QUICK!!! What is the Length/ value of N is 63 / 168 equivalent to 312 / 832 Which Pope wanted to liberate Jerusalem from Muslim control? A 14.0 tank contains 250 g of methane (CH4) gas at 27 atm at 298 K. Accidentally, 190 g of CO2 was added to the tank. What will be the resulting pressure of the mixture in the tank? Assume that no CH4 leaked out as the CO2 gas waa being added. Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) PLEASE HELP!! I'LL GIVE BRAINLEST!!Use the formula P = 2l + 2w. Find the perimeter of a rectangle with a length of 12.9 ft and a width of 19.3 ft. Show all of your work. (4) NH3+02- NO+H2Obalance the equation Find the slope intercept equation of the line Ryan buys a baseball bat. The original price is $20. Ryan has a coupon for a 20% discount. What is the sale price? Which can provide the most energy in an ecosystem?a mushroom ,a coyote, a pine tree ,a grassy meadow Please HELP what is the slope-intercept equation slope: -2 y-intercept: 3 Please help me with this question please!!!Look at the picture provided and answer the question >>Select one only.Q:An aromatic hydrocarbon is represented by which structural formula?>>Choose one answer from the picture below that answers the question above ABCD Angel and his 2 sisters shared 1/2 cup of baby carrots. How many cups did they each get?