Sam scored 10 points. This was double the number of points he scored in the first game. Which equation can be used to find, x, the number of points Sam scored in the first game?
a.x−2=10
b.2x = 10
c.x + 2 = 10
d.x/2=10

Answers

Answer 1

Answer:

b is the answer of this puestion


Related Questions

Jen and Brandy are studying soil. They each collected a sample of soil from the front yard of the school and then analyzed its components. Finally, they compared their results and found that they were very different. Their findings are recorded in the chart below.

How should Jen and Brandy proceed?

A.They should discuss their results and try to figure out why they are different.

B. They should ignore the differences in their results and complete their lab report.

C. They should argue about which student is right.

D. They should ask their teacher which set of results are more accurate.

Answers

Answer:

c.

Step-by-step explanation:

:)

Answer:

A

Step-by-step explanation:

i did the quiz and got a 96%

Stephanie started selling earrings online at a handmade shop. She makes a profit of $8.50 on each pair of earrings. If she wants to make a profit of no less than $765 this month, how many pairs of earrings does she need to sell? Write and solve an inequality to model this solution.

Answers

Answer:

90 pairs

Step-by-step explanation:

We can use clues from the problem in order to set up our inequality.

First, we know that a pair of earrings, [tex]p[/tex], costs $8.50. So, we can say that [tex]8.5p=[/tex] total profit.

That's a function we could use, but we need an inequality. Well, it says that Stephanie wants to make no less, or at least $765. This indicates that we need the 'greater than or equal to' symbol. Just replace the equal sign:

[tex]8.5p\geq 765[/tex]

Now we can isolate [tex]p[/tex] to find how many earrings she needs to sell to make a profit of at least $765.

[tex]8.5p\geq 765\\\\p\geq \frac{765}{8.5}\\\\p\geq 90[/tex]

Stephanie needs to sell at least 90 pairs of earrings.

Hope this helps!

q is the midpoint of segment pr. pq=2x+1 and qr= 3x-5. what is the length of segment pr​

Answers

I’m not positive this is right but try 26. I set 2x+1 and 3x-5 equal to each other and solved for x. I got x=6 then plugged it into both of the equations then added the equations together.

What value of x satisfies the equation below? Explain
how you know
- 6x=
36

Answers

Answer:

-6 because -6 times -6 is a positive 36 negative times negative is positive

Step-by-step explanation:

Answer:

x = -6

Step-by-step explanation:

Okay so basically. The "-6" and the fact that the answer is a positive number shows that X must be a negative number. So let us set "-6" as a positive number. Divide 36 by 6 and the answer is = 6. Add a negative sign and X is -6.

Perform the indicated operations:
-1
4
-4
4
-4
-1
6
-7
-4
-7
-4
2R2 + R3 R3
-4
6
2
-4
8
2
6
-4
30

Answers

Answer:

Step-by-step explanation:

The solution is, resulting matrix:[tex]\left[\begin{array}{ccc}4&-1&-4\\-4&6&2\\0&8&10\end{array}\right][/tex][tex]\left[\begin{array}{ccc}-7\\-4\\22\end{array}\right][/tex].

What is Matrix?

In mathematics, a matrix is a rectangular array or table of numbers, symbols, or expressions, arranged in rows and columns, which is used to represent a mathematical object or a property of such an object. For example, is a matrix with two rows and three columns.

here, we have,

given that,

We are given a matrix,

Let A=[tex]\left[\begin{array}{ccc}4&-1&-4\\-4&6&2\\8&-4&6\end{array}\right][/tex]

and B=[tex]\left[\begin{array}{ccc}-7\\-4\\30\end{array}\right][/tex]

We have to find the resulting matrix after performing given row operations

2R2 +R3 ⇒ R3

Apply

we get,

:A=[tex]\left[\begin{array}{ccc}4&-1&-4\\-4&6&2\\0&8&10\end{array}\right][/tex]

and, B=[tex]\left[\begin{array}{ccc}-7\\-4\\22\end{array}\right][/tex]

Hence, resulting matrix

[tex]\left[\begin{array}{ccc}4&-1&-4\\-4&6&2\\0&8&10\end{array}\right][/tex][tex]\left[\begin{array}{ccc}-7\\-4\\22\end{array}\right][/tex]

To learn more on matrix click:

brainly.com/question/30646566

#SPJ7

Una limusina cuesta $ 85 para alquilar por 3 horas más un 7% de impuesto sobre las ventas. Cúal es el costo total
alquilar una limusina por 6 horas?

Answers

Answer:

$181.9

Step-by-step explanation:

Si cuesta 85 dólares por 3 horas, queremos duplicarlo para obtener la cantidad por 6 horas, que es 170 dólares. Esto es antes del impuesto a las ventas. Puede encontrar la cantidad después del impuesto a las ventas multiplicando 170 por 1.07. Hace esto porque el 100 por ciento del costo sería 170 por 1 y el 7 por ciento es .07, por lo que si desea el 107 por ciento del costo, debe hacerlo 170 por 1.07. Esto funciona porque toma el 7 por ciento de 170 y lo agrega al costo total. También puede hacer esto 170 veces .07. Luego suma el producto a 170. 181,9 es la respuesta final.

English- If it costs 85 dollars for 3 hours we want to double that to get the amount for 6 hours which is 170 dollars. This is before sales tax. You can find the amount after sales tax by multiplying 170 by 1.07. You do this because 100 percent of the cost would be 170 times 1, and 7 percent is .07, so if you want 107 percent of the cost you want to do 170 times 1.07. This works because it takes 7 percent of 170 and adds it to the total cost. You could also do this by 170 times .07. Then add the product to 170. 181.9 is the final answer.

Please help its7to10 I be waiting like two hours

Answers

Answer:

Please check the explanation!

Step-by-step explanation:

Important factors to remember regarding the like terms:

'Like terms' are terms whose variables such as 2x and 6x are the same. Also if the variables contain the exponents such as 4 in x⁴, they must be the same too.Since the coefficient doesn't affect likeness, therefore we can say that all constant terms would be treated as the like terms.

Question 7

Given the terms

2b     b⁶     b     x⁴     3b⁶     2x²

From the list of terms, there are two groups of like terms which are:

2b     b       (Like terms containing the variable b)

b⁶      3b⁶    (Like terms containing the variable b with the same exponents)

The remaining two x⁴  and 2x² terms are different from each other and the rest of the terms

Question 8

Given the terms

6     2n     3n²     3m²     n/4     7

From the list of terms, there is one group of like terms which are:

6     7       (Constants Like terms)

2n    n/4   (The terms with the same variable n)

All the remaining terms such as 3n², 3m² are all different from each other and the rest of the terms.

Question 9

Given the terms

10k²      m     3³     p/6     2m

From the list of terms, there are there is one group of like terms which are:

m     2m     (The terms withe same variable m)

All the remaining terms such as 10k², 3³, p/6  are all different from each other and the rest of the terms.

Question 10

Given the terms

6³      y³     3y²     6²     y      5y³

From the list of terms, there are two groups of like terms which are:

y³    5y³     (The terms withe same variable m and exponent)

6³     6²      (Constant like terms. Plz don't confuse the power as all are the same constant terms)

All the remaining terms such as y and 3y² are all different from each other and the rest of the terms.

plz I need help!!! will give brainlyyyyy

Answers

Y= 4.5 because the length is less than 6=x.

Find 6,650/35. please help me i tried using calculator but it put 0.19

Answers

Answer:

113

i did it in the caculater and this is what showed.

Answer:

That's odd, the actual answer is 6650 / 35 = 190

Good luck! Hope this helped :)

Is 3 x 1/2 greater than 5?

Answers

No it is not greater than 5

When ever you are multiply a number by 1/2 you are halving the number. So in the us case 3 x 1/2 is 1.5.

And 1.5 is not greater than 5

So the answer is no



Can you please mark brainleist

PLEASE HELP ILL GIVE YOU DA BRAINLIESTTTTT

Answers

Answer:

x=2, And i think the 2nd one is reflexive

Step-by-step explanation:

6x+14=26
-14 -14
6x=12
6 6
X=2

And the other answer i think is C.

find the area of the circle round your answer to the nearest hundred ​

Answers

Answer:

what are the numbers shown?

To find the area of a circle you do pi times radius squared

In this polygon, which angle is an interior angle?
pls answer 20 points
A. c°
B. a°
C. b°
D. d°

Answers

Answer:

Step-by-step explanation:

D

Answer:

C

Step-by-step explanation:

I took the quiz and got it correct

HELP For each triangle, find x and the measure of each side.
△FGH is an equilateral triangle with FG = x +5, GH = 3x – 9, and FH = 2x –2.
I DID ALGEBRA LAST YEAR HOW AM I SUPPOSED TO REMEMBER THIS AHHH

Answers

Answer:

5

Step-by-step explanation:

A __________ names part of a whole, part of a set,
or a location on a number line.

A: decimal
B: fraction

Answers

Answer:

Fraction

Step-by-step explanation:

Tell me if im wrong

Answer

in this case its a fraction

Step-by-step explanation:

the give away in this question is that it says part of a whole. this just means what amount of the whole. for example 1/2

pls mark brainleist

HELP ME PLZZ SOMEONE DONT JUST ANSWER RANOMELLY I REALLY NEED HELP !!!!

Frankenstein is definitely a classic and he can still manage to get a few scares, but the also classic Werewolf has seen better days. The Werewolf is often the target of scares and has an equation perpendicular to Frankenstein's. Frankenstein's equation is`y=x+5` and the Werewolf's equation passes through the point `\left(-1,-2\right).` What is the Werewolf's equation?

Answers

Answer:

y = - x - 3

Step-by-step explanation:

Given

Equation y = x + 5Perpendicular line that passes through the point (-1, -2)

Perpendicular line has negative reciprocal slope, so the slope is -1

The line in slope-intercept form is:

y = -x + b

Using the given point, finding the y-intercept:

-2 = -(-1) + b-2 = 1 + bb = -2 - 1b = -3

So the Werewolf's equation is:

y = - x - 3

Pls help me on 21 , 22 , and 23

Answers

Find the slope of each of the two lines using the formula

y1-y2/x1-x2

Then if the slopes are the same, they’re parallel, and if they are the opposite reciprocal they are perpendicular. If they aren’t either of those options then it’s neither

Let me know if this helped!

9514 1404 393

Answer:

  21.  perpendicular

  22.  neither

  23.  parallel

Step-by-step explanation:

It can help to plot the points on a graph and draw lines through them. This can also let you count grid squares, which can make it easier to find the slope.

21. See attachment 1. The lines are perpendicular.

QR has a slope of -3/2. ST has a slope of 2/3, the opposite reciprocal.

__

22. See attachment 2. The lines are neither parallel nor perpendicular.

__

23. The x-coordinates of Q and R are the same, so this is a vertical line at x=-1. The x-coordinates of S and T are also the same, so it is a vertical line at x=11. The two vertical lines are parallel to each other.

_____

Additional comment

When you have a number of problems that all require similar arithmetic, it can be useful to embed that arithmetic in a spreadsheet. You have to enter the numbers somewhere to "show work" or perform a calculation, so you may as well enter them into a spreadsheet that does the calculation for you.

Of course, the slope formula is ...

  m = (y2 -y1)/(x2 -x1)

If you simply show the values of m for each pair of points, you can see if they are equal (lines are parallel). You can also have the spreadsheet compute their product to see if it is -1 (lines are perpendicular). If you get a #DIV/0! error, it means the line is vertical (and the product will also give an error). You can avoid error messages by making the spreadsheet more sophisticated, but that isn't necessary for the purpose here.

If QS and TV are parallel lines and m<QRU=127, what is m<TUW? HELP ASAP​

Answers

Based on the corresponding angles theorem, m<TUW = 127°.

What is the Corresponding Angles Theorem?

If two angles on two parallel lines that are cut across by a transversal are corresponding to each other, the corresponding angles theorem states that they are congruent to each other.

Given:

m<QRU = 127

Angles QRU and TUW are corresponding angles. Therefore:

m<TUW = m<QRU = 127° [corresponding angles theorem]

m<TUW = 127°

Learn more about the corresponding angles theorem on:

https://brainly.com/question/5221905

#SPJ1

Austin makes $7.75 per hour at his job at the car wash. How many full hours does Austin need
to work to make $100?

Answers

Answer:

13 full hours

Step-by-step explanation:

Divide.

100 / 7.75 ≈ 12.9

He needs to work FULL hours, so round up.

12.9 -> 13

Best of Luck!

Answer:

He would need to work 13 hours.

Explanation:

If you divide 7.75 from 100 you will get a decimal of 12.9032258065 but if we round then it would be 13 meaning that the answer is 13 hours.

A pile of 100 $5coins is 150 mm high. One coin is______mm thick​

Answers

Answer:

1.5mm

Step-by-step explanation:

100x = 150. x = height is one $5 coin

x = 150/100

x = 1.5

4 movie tickets cost $48. At this rate, what is the cost of 8 movie tickets?

Answers

Answer:

$60

Step-by-step explanation:

48/4=12

12*8=60.

So you'd pay 60 dollars for 8 movie tickets. ^^

When the weight is greater than 15 pounds, the cost will be greater than $10.

Answers

Answer:

muy bien ami si me funciono la pregunta

I need help please ​

Answers

The correct answer is false:) Parallel lines don’t have a solution because they don’t intersect.

The weather forecast calls for a total of 16 inches of snow over the next week. If it is estimated that 2.8 inches of snow will fall on Monday, 3.4 inches of snow will fall on Tuesday, 1.6 inches of snow will fall on Wednesday, 2.1 inches of snow will fall on Thursday, 1.7 inches of snow will fall on Friday, and 2.9 inches of snow will fall on Saturday. How much snow should fall on Sunday?
A.
3.2 inches
B.
3.6 inches
C.
1.5 inches
D.
0.5 inches

Answers

c c c c c c c c c c
The answer is C and you get this by subtracting all the inches of snowfall over the week from 16 total inches and you should get 1.5 inches.

twice the sum of k and 9 is 4

Answers

Answer:

2(k + 9) = 4

Step-by-step explanation:

Use distributive property.

2 x k = 2k

2 x 9 = 18

Equation:

2k + 18 = 4

Subtract 18 from both sides

2k = -14

Divide both sides by 2

k = -7

Answer:

-7

Step-by-step explanation:

First, we need to write this an equation

2(k+9)=4

2k+18=4

-18       -18

2k=-14

/2      /2

k=-7

HELP PLS
What is the slope of the line that passes through (1, 4) and (-3, -3)?

Answers

Answer:

y=7/4x+9/4

Step-by-step explanation:

You want to find the equation for a line that passes through the two points:

(1,4) and (-3,-3).

First of all, remember what the equation of a line is:

y = mx+b

Where:

m is the slope, and

b is the y-intercept

First, let's find what m is, the slope of the line...

The slope of a line is a measure of how fast the line "goes up" or "goes down". A large slope means the line goes up or down really fast (a very steep line). Small slopes means the line isn't very steep. A slope of zero means the line has no steepness at all; it is perfectly horizontal.

For lines like these, the slope is always defined as "the change in y over the change in x" or, in equation form:

So what we need now are the two points you gave that the line passes through. Let's call the first point you gave, (1, 4), point #1, so the x and y numbers given will be called [tex]x_1[/tex] and [tex]y_1[/tex]. Or,

Also, let's call the second point you gave, (-3,-3), point #2, so the x and y numbers here will be called [tex]x_2[/tex] and [tex]y_2[/tex]. Or,

Now, just plug the numbers into the formula for m above, like this:

m=  

[tex]\frac{-3-4}{-3-1}[/tex]

m= 7/4

So, we have the first piece to finding the equation of this line, and we can fill it into y=mx+b like this:

y=7/4x+b

Now, what about b, the y-intercept?

To find b, think about what your (x,y) points mean:

(1,4). When x of the line is 1, y of the line must be 4.

(-3,-3). When x of the line is -3, y of the line must be -3.

Because you said the line passes through each one of these two points, right?

Now, look at our line's equation so far: y=7/4x+b. b is what we want, the 7/4 is already set and x and y are just two "free variables" sitting there. We can plug anything we want in for x and y here, but we want the equation for the line that specifically passes through the two points (1,4) and (-3,-3).

So, why not plug in for x and y from one of our (x,y) points that we know the line passes through? This will allow us to solve for b for the particular line that passes through the two points you gave!.

You can use either (x,y) point you want..the answer will be the same:

(1,4). y=mx+b or 4=7/4 × 1+b, or solving for b: b=4-(7/4)(1). b=9/4.

(-3,-3). y=mx+b or -3=7/4 × -3+b, or solving for b: b=-3-(7/4)(-3). b=9/4.

See! In both cases we got the same value for b. And this completes our problem.

The equation of the line that passes through the points

(1,4) and (-3,-3)

is

y=7/4x+9/4

A swim coach wants to test whether practicing with swim paddles improves swimmers' breaststroke times in the 100-

meter relay race. He asks the first member of the relay team to continue swimming without paddles. He asks the other

three members of the relay team to swim with paddles for two weeks. He records the swim times of the relay teams with

and without paddles. Which group of an experiment are the other three members of the relay team part of?

-single-blind

-confounding

-control

-experimental

Answers

Answer: experimental

Step-by-step explanation:

In a research design such as the one described in the scenario above, participants are separated into two distinct groups. The hypothesis (if swimming with paddles is faster than without paddles) being tested is applied on one of the two groups while the other group remains as before. Hence, the group which receives the treatment which is to be tested (those who swim with paddles) are called the experimental group. The other group of participants who continue to swim without paddles are the control group.

Hence, the other group of three member who were asked to swim with paddles for two weeks are the experimental group because they are the ones who received the actual treatment in the experiment.

A is what percent of B?
A = 2 qt, B = 2 gal

Answers

Step-by-step explanation:

4qt=1gal

8qt=2gal

percent of b=a

x%times b=a

x%=a/b

x%=2/8

x%=1/4=25%

answer" 25%.

is this relation a function? justify your answer.
please help!​

Answers

Answer:

C

Step-by-step explanation:

No, because you can not use the same X more than once. It has to pass the vertical line test.  So it'll be option C

A relay race is 1 3 4 miles long. Each relay team has 4 runners. If each runner runs the same distance in the race, how far will each runner run? Choose the correct answer.

Answers

Answer: 7/16

Step-by-step explanation:

Distance of the relay race = 1 3/4 miles

Number of runners for the relay team = 4 runners

Distance to be run by each runner will be:

= Distance of the relay race / Number of runners

= 1 3/4 ÷ 4

= 7/4 ÷ 4

= 7/4 × 1/4

= 7/16

Each runner will run 7/16 miles

Other Questions
Identify the independent variable (domain). 5x+2y= 150 I WILL GIVE A LOT OF EXTRA POINTS. PLEASE ANSWER ALL OF THEM The manufacturers of can of salted mixed nuts state that the ratio of peanuts to other nuts is 6 to 5 . If 414 peanuts are in a can how many other nuts should also be in the can (8,9), X + 8y = 9Help me please What is 15% of 140? A.2,100 B.30 C.21 D.119 What was a vassal required to pay to their lord? crops money land tares Helppp ASAP. Emma wants to enlarge a square photo and print it to a square canvas. The sidelength of the canvas is 12 in. The scale from the canvas to the photo is 4 in. to 1 in.What is the side length of Emma's photo? Show your work. What other story element is most affected by the narrator's point of view?A) the story's titleB) the story's settingC) the story's theme Express the recurring decimal 0.56 (Just the 6 is recurring) in its simplest form. What should you ask yourself before you post a photo, video, or other information about another person online? 1. la seora Trevio tiene el doble de edad que suhijo hace 9 aos la suma de su edades era 30cual es su edad actual? ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut Philosophies born out of ancient China include____.A. BuddhismB. DaoismC. JainismD. Hinduism On a map, the distance between NY and Washington D.C. is 3.6 inches. The scale is 1 inch: 55 miles. What is the actual distance between the two cities? 31. The observed regularities in the properties ofthe elements are periodic functions of their(1) atomic numbers(2) mass numbers(3) oxidation states(4) nonvalence electrons Which describes an altocumulus cloud?a.high, feathery cloudc.low storm cloudb.puffy mid-level cloudd.high cloud made of ice crystalsPlease select the best answer from the choices providedABCD PLZZ ANSWER THE QUESTION What point of view is the poem "The Song of the Storm -- Spirits" written in? The top of the saturated zone is known as A. the aquifer B. the water table C. the unsaturated zone D. spring rock How could you explain why soap is able to clean the oil and dirt off your bodies?