Should we consider human induced climate change as a form of
violence? Please be sure to explain your answer.

Answers

Answer 1

Yes, human induced climate change can be considered a form of violence. Climate change not only has a direct and destructive impact on the environment, but it also has an indirect impact on human lives.

Climate change has a disproportionate impact on marginalized and vulnerable communities, including indigenous peoples, women, and people living in poverty. These communities often lack the resources and resilience to cope with the impacts of climate change, and their basic human rights are frequently violated as a result. For example, climate change can lead to displacement, food insecurity, and the loss of livelihoods. All of these impacts can be seen as forms of violence that are perpetuated by human activity. It is therefore important to view climate change as a social justice issue, as well as an environmental one.

In order to address climate change and its impacts, it is necessary to address the root causes of inequality and injustice that make some communities more vulnerable to its effects than others. This requires collective action, policy change, and a commitment to equity and justice. Ultimately, treating climate change as a form of violence can help to raise awareness about the urgent need to act and the importance of ensuring that climate action is rooted in social justice.

know more about climate change click here:

https://brainly.com/question/32532670

#SPJ11


Related Questions

Which kingdoms contain organisms that have cell walls?

Answers

The plantae,Protista, eubacteria kingdom. I think it’s just the 3.

The function of cell wall is to provide protection. The kingdoms which have cell walls are  fungi and plantae.

What is the function of cell wall ?

The cell wall provides the protection against the  mechanical stress and the pressure that a cell membrane can not handle.

Cell wall is majorly present for the purpose of protection to the species and these species tend to be delicate and tend to be in more danger.

Cell wall of fungi is made up of chitin and it is polysaccharide having the amino glycosidic linkages.

Cell wall of plants is made up of polysaccharides as well where the cellulose is present in chains.

Cellulose provides the tensile strength and this amino  glycosidic linkages tend to provide strong skeletal structures in order to provide protection to the specimen.

Therefore only plantae and fungi have the cell walls.

https://brainly.com/question/965751

#SPJ6

I need help not sure

Answers

Answer:

The answer is 2

Explanation:

D,H,J are closely related because they are sharing traits, and it is the most relevant answer

How many chambers does a dog's heart
have?

Answers

Answer:

There are four chambers in the dog's heart: two top chambers (the atria) and two bottom chambers (the ventricles).

Explanation:

Answer:

It has 4 chambers

Explanation:

sorry if im wrong

in addition to providing structural support and mediating transport, membrane proteins are important for allowing bacteria to sense and respond to changes in their environment. for example, the toxr protein is found in the plasma membrane of vibrio cholerae cells. it responds to ph and temperatures characteristic of the human gut environment by choose one: a. serving as a channel for export of the cholera toxin. b. releasing antimicrobial agents to kill members of the normal microbiota. c. transmitting signals to communicate with other v. cholerae. d. binding to the promoters of genes involved in virulence. e. injecting effectors directly into the cells of the intestinal epithelium.

Answers

In addition to providing structural support and mediating transport, membrane proteins are important for allowing bacteria to sense and respond to changes in their environment. for example, the toxr protein is found in the plasma membrane of vibrio cholerae cells. it responds to ph and temperatures characteristic of the human gut environment by c. transmitting signals to communicate with other v. cholerae

Membrane proteins not only provide structural support and mediate transport but are also important for allowing bacteria to sense and respond to changes in their environment. The toxR protein is found in the plasma membrane of Vibrio cholerae cells. It responds to pH and temperatures characteristic of the human gut environment by transmitting signals to communicate with other V. cholerae. The ToxR protein is a transmembrane protein that is vital for the pathogenesis of Vibrio cholerae, the causative agent of cholera.

It functions as a transcription factor and regulates the expression of many virulence genes. ToxR, ToxS, and TcpP are three regulatory proteins that are essential for the transcription of virulence genes in Vibrio cholerae. They function as a complex to activate or repress transcription of genes that are important for the virulence of this bacterium. Therefore, option C, transmitting signals to communicate with other V. cholerae is the correct answer.

Learn more about transcription at

https://brainly.com/question/13673064

#SPJ11

ECOTOXICOLOGY
6. Discuss the differences between dysfunction and destruction of target molecules as commonly used in ecotoxicology 7. Suggest detailed reasons why dysregulation can lead adverse effects

Answers

Ecotoxicology is a branch of environmental toxicology that investigates the effect of toxicants on organisms in the ecosystem. The differences between dysfunction and destruction of target molecules as commonly used in ecotoxicology.

6. The differences between dysfunction and destruction of target molecules as commonly used in ecotoxicology.

Dysfunction in ecotoxicology is a type of effect that results from the change in the normal physiological activity of a cell, tissue, or organ. It occurs when the toxicant alters the normal functioning of the target molecule. For example, when a pesticide such as DDT is ingested by an organism, it binds to the sodium ion channels in the nervous system, resulting in the impairment of the nervous system.The destruction of target molecules, on the other hand, is a type of effect that results from the direct alteration of a molecule's structure. It occurs when the toxicant physically alters the chemical structure of the molecule. For example, lead adversely affects organisms by binding to proteins and altering their structure.

7. Reasons why dysregulation can lead to adverse effects

Dysregulation can lead to adverse effects in several ways, including: It affects the normal functioning of the organism and can lead to death.It can result in the accumulation of toxic substances, causing long-term damage to the organism's health.It can lead to the overproduction of certain substances that cause harm to the organism.It can disrupt normal physiological processes, leading to disease and other health problems. Therefore, dysregulation has the potential to lead to serious adverse effects on an organism's health. In conclusion, the understanding of the difference between the destruction and dysfunction of target molecules in ecotoxicology and the knowledge of how dysregulation can lead to adverse effects are crucial for understanding the impact of toxic substances on organisms.

To know more about ecotoxicology visit:

https://brainly.com/question/32533210

#SPJ11

wykonaj tabele w której porównasz funkcje wszystkich rodzajów elementów morfotycznych krwi

Answers

Is this a question or just a prank?

Which claim about reproduction in dogs can best be supported using a valid argument?
A. Offspring produced by sexual reproduction are genetically identical.
B. Gametes from both dogs are needed to maintain the correct number of chromosomes in the offspring
C. Phenotypic variation will occur in the offspring as a result of mitosis in the gametes.
D. Binary fission is required for sexual and asexual reproduction in dogs.

Answers

Answer:

b

Explanation:

A simple guideline to follow for deloading is to train at less than intensity and less than volume of what is used during a standard training session. A. 40%, 40% B. 50%, 50% C. 70%, 70% D. 80%, 80%

Answers

The guideline recommends using 50% of the intensity and 50% of the volume of what is typically used during a standard training session. Therefore, option B is correct.

When deloading, it is recommended to train at a lower intensity and lower volume compared to a standard training session. The recommendation is to employ 50% of the volume and 50% of the intensity that is generally used during a typical training session.

This technique enables to provide a period of reduced stress on the body. It allows for recovery and adaptation to occur.

Learn more about intensity, here:

https://brainly.com/question/17583145

#SPJ4

Some scientists claim recent evidence suggests birds should be reclassified to share more taxonomic groups with dinosaurs. What type of evidence would provide the best support for this claim?
A.evidence showing birds shared similar habitats with dinosaurs
B.evidence showing birds shared similar nutritional requirements as dinosaurs
C.evidence showing birds shared similar behaviors with dinosaurs
D. evidence showing birds shared a common genetic history with dinosaurs

Answers

Answer: D.

Explanation: I don’t really know how to explain it, I just know it’s right

Some scientists claim recent evidence suggests birds should be reclassified to share more taxonomic groups with dinosaurs. The liable options seems evidence showing birds shared a common genetic history with dinosaurs. The correct answer is option D.

What is the class of birds ?

It is the class aves that belong to the kingdom Animalia.

The birds and the dinosaurs have the same genetic history that is the phylogenetic relationship of both the species is almost same and they both show a similar set of characteristics.

They had multiple set of characteristics that were similar to both and they shared the common characteristics. The points are written as following :

1.Egg Laying

2.Scales

3.Feathers

4.Beaks

5.Diets

6.Reptilian Relations

7.Three-Toed Limbs

8.Claws.

These were the common characters that were present in both the categories.

Learn more about birds at :

https://brainly.com/question/25120645

#SPJ2

what is membrane potential of a cardiac intrinsic conduction system cell?

Answers

A gradient of electrochemical potential exists across cellular membranes, allowing cardiac cells to exclusively propagate action potentials. An average cardiac cell's resting membrane potential is 90 mV.

The Goldman-Hodgkin-Katz equation, which considers permeability (P) as well as the concentration of ions both within and outside of cells ([X]), can be used to characterise this resting potential. The network of intracardiac ganglia and connecting neurons makes up the intrinsic cardiac neural system (ICNS), sometimes known as the heart's own nervous system. As a local hub that combines the inputs from the ICNS and extrinsic innervation, the cardiac ganglia function as a contributor to the tight control of cardiac electrophysiology.

To know more about electrochemical, click here:

https://brainly.com/question/31606417

#SPJ4

How does erosion and deposition shape the landscape?

Answers

Answer:

The material moved by erosion is sediment. Deposition occurs when the agents (wind or water) of erosion lay down sediment. Deposition changes the shape of the land. Water's movements (both on land and underground) cause weathering and erosion, which change the land's surface features and create underground formations.

Explanation:

have a good day/night

may i please have a branlliest

2 Lin sulks during the first week of rehearsals because she is – A tired from working on the set B bored with her duties as a designer C confused about the directions given to her D disappointed with the assignment she received​

Answers

Answer:

skull tropper

Explanation:

I got it from the guy from fortnite

what story is that from

Which of the following describes a mechanism by which microtubules are known to be statſilized? a) Shortening of the GTP cap. b) Increasing the proportion of alpha-tubulin subunits relative to beta-tubulin subunits. c) Binding of microtubule binding proteins, such as Tau. d) Conformational changes undertaken by beta-tubulin as it bhydrolyzes GTP.

Answers

Microtubule stabilisation is known to occur through the interaction of microtubule-binding proteins like Tau. Hence (c) is the correct opton.

Cell division, ciliogenesis, and intracellular trafficking are three crucial eukaryotic processes that are mediated by microtubules, which are cytoskeletal elements. They come together from -tubulin heterodimers and separate through a process known as dynamic instability that is triggered by GTP hydrolysis. They have a role in a number of cell motions, including as some types of cell motility, the intracellular movement of organelles, and the division of the chromosomes during mitosis, in addition to determining the shape of the cell. These findings imply that GTP functions in microtubule assembly by first giving tubulin a conformation that is conducive to polymerization, and then by hydrolyzing GTP bound to tubulin to irreversibly change the balance in favour of polymerization.

To know more about Microtubule, click here:

https://brainly.com/question/31670866

#SPJ4

why is correct measurement important​

Answers

Explanation:

help in giving accurate information

Which of the following is the correct binomial format? O Genus species O Phylum class O Species O Order family

Answers

The correct option is A, The correct binomial format is "Genus species."

Genus species is a scientific naming convention used in taxonomy to classify and categorize living organisms. It represents the two main levels of classification below the higher taxonomic ranks of family, order, class, phylum, and kingdom. The genus refers to a group of closely related species that share common characteristics and ancestry. It is always capitalized and italicized when written in scientific literature.

The species name, on the other hand, is a specific epithet that further distinguishes individual organisms within a genus. It is written in lowercase and also italicized. The combination of the genus and species names provides a unique binomial nomenclature for each organism, enabling scientists to communicate and identify species consistently. For example, Homo sapiens represents the genus Homo (including humans and their close relatives) and the species sapiens, which is specific to modern humans.

To learn more about Genus species visit here

brainly.com/question/30346312

#SPJ4

Which of the following would be considered adaptations for a predator? Select ALL that apply.
A. Thorns on a plant
B. Sharp Claws
C. Aposematism (Warning Coloration)
D. Strong sense of smell
E. Ability to run quickly

Answers

The adaptations of a predator from the given options would be sharp claws, aposematism (warning coloration), a strong sense of smell, and the ability to run quickly. Here options B, C, D, and E are the correct answer.

B. Sharp Claws: Sharp claws enable a predator to grasp and immobilize prey, providing an advantage in capturing and subduing prey efficiently.

C. Aposematism (Warning Coloration): Aposematism refers to the display of vibrant, contrasting colors or patterns that warn potential prey of the predator's toxicity or dangerous nature. This adaptation deters potential prey from approaching or attacking the predator, allowing it to avoid unnecessary conflict and conserve energy.

D. Strong sense of smell: A predator with a keen sense of smell can detect the scent trails left by prey, increasing its ability to locate and track potential targets. This adaptation provides an advantage in locating prey and improving hunting success.

E. Ability to run quickly: The ability to run swiftly is advantageous for predators as it enables them to chase down prey, close the distance, and launch an attack. This adaptation improves their chances of capturing fleeing prey.

To learn more about predators

https://brainly.com/question/28871161

#SPJ4

What percent of energy is transferred between the levels indicated by the blue arrows?

A. 50

B. 90

C. 100

D. 10

Answers

The answer to the given question is that more than 100 percent of energy is transferred between the levels indicated by the blue arrows.

This is because the blue arrows show the flow of energy between trophic levels in an ecosystem and there is always a loss of energy in each transfer due to metabolic processes like respiration and incomplete digestion.The transfer of energy between trophic levels of an ecosystem is known as the energy pyramid. In general, only 10% of the energy at one level is available to the next level. For example, if the primary producers contain 10,000 units of energy, then only 1,000 units of energy will be transferred to the primary consumers.

However, some energy can be lost due to factors such as heat loss from the body of organisms, incomplete digestion, and inefficiencies in energy transfer mechanisms. Therefore, it is possible for more than 100% of energy to be transferred between the levels indicated by the blue arrows. Therefore, the correct answer is not given in the option, it is more than 100 percent.

To know more about percent visit:

https://brainly.com/question/14809038

#SPJ11

nad is directly involved a) only glycolysis b) only ppp c) both pathways d) neither pathway

Answers

NAD (Nicotinamide adenine dinucleotide) is directly involved in (C) both glycolysis and the pentose phosphate pathway (PPP).

In glycolysis, NAD acts as a coenzyme and plays a crucial role in the redox reactions of the pathway. During the conversion of glyceraldehyde-3-phosphate to 1,3-bisphosphoglycerate, [tex]NAD^{+}[/tex] is reduced to NADH. This reduction reaction allows NADH to carry high-energy electrons to the electron transport chain for ATP production.

In the pentose phosphate pathway, [tex]NADP^{+}[/tex] (a phosphorylated form of NAD) serves as a coenzyme. [tex]NADP^{+}[/tex]is utilized in the oxidative phase of the pathway to facilitate the oxidation of glucose-6-phosphate to generate NADPH. NADPH is an important reducing agent used in biosynthetic processes, antioxidant defense, and reductive reactions within the cell.

Therefore, NAD is directly involved in both glycolysis (in the form of NADH) and the pentose phosphate pathway (in the form of [tex]NADP^{+}[/tex] and NADPH). The correct answer is option C) both pathways.

Learn more about NAD (Nicotinamide adenine dinucleotide):

https://brainly.com/question/30323008

#SPJ11

Which kingdom contains the first eukaryotes?

Answers

Fungi hope this helps

In the photo of the house; What is happening to the foundation of
the house?

Answers

Answer:

errosion is causing it to crumble and become unstable

what factor may contribute to the higher food insecurity on the african continent,in the middle east,and in asia?

Answers

Answer:

The most common causes of food insecurity in Africa,middle east and asia: population growth, drought, extreme weather events and other agricultural problems.

Explanation:

what does it mean to be purebread ?

Answers

Answer:

If you meant purebred, it means that the species had not been bred with any other species than it`s own.

Ex: a purebred dog bred with another purebred dog produced a purebred offspring

a purebred dog bred with either another species of dog, or a crossbred dog will produce a crossbred offspring

Explanation:

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC

HELP ME

Explain how physical variation is expressed in human beings and how it relates to cultural groups and ethnicity?!??

Answers

Be careful with those links there hackers

Match the following world's countries with the plate boundary they are located Ethiopia, Kenya, Tanzania region Continent-Continent Div [选择] Ocean-Ocean Convegent Japan ✓ Ocean-Continent Convergent Continent-Continent Transform Ocean-Ocean Divergent Continent-Continent Divergent Iceland Continent-Continent Convergent Ecuador/Western South America Continent-Continent Co USA/Southern California Ocean-Continent Conve v Nepal/Tibet/China region Continent-Continent Co

Answers

Here is the matching of the countries with the corresponding plate boundary:

Ethiopia, Kenya, Tanzania region: Continent-Continent Divergent

Japan: Ocean-Ocean Convergent

Iceland: Continent-Continent Divergent

Ecuador/Western South America: Continent-Continent Convergent

USA/Southern California: Ocean-Continent Convergent

Nepal/Tibet/China region: Continent-Continent Convergent

Let's explain the reasoning behind each match:

Ethiopia, Kenya, Tanzania region:

This region is located along the East African Rift System, which is a classic example of a continent-continent divergent boundary.

It is where the African Plate and the Somali Plate are moving away from each other, causing the formation of a rift valley.

Japan: Japan is situated along the Pacific Ring of Fire, which is characterized by subduction zones where oceanic plates converge with continental plates.

Therefore, Japan is located at an ocean-ocean convergent boundary.

Iceland: Iceland is located on the Mid-Atlantic Ridge, which is a divergent boundary between the Eurasian Plate and the North American Plate.

As the plates move apart, magma rises to the surface, creating new crust and causing volcanic activity.

Thus, Iceland is at a continent-continent divergent boundary.

Ecuador/Western South America:

This region lies along the boundary between the Nazca Plate and the South American Plate.

The Nazca Plate is subducting beneath the South American Plate, resulting in the formation of the Andes Mountains.

Hence, Ecuador and Western South America are located at a continent-continent convergent boundary.

USA/Southern California: Southern California is located along the boundary between the Pacific Plate and the North American Plate.

The Pacific Plate is moving northwestward relative to the North American Plate, resulting in a transform boundary.

Therefore, the plate boundary in this region is a continent-continent transform boundary.

Nepal/Tibet/China region:

This region is part of the Himalayan mountain range, formed by the collision of the Indian Plate with the Eurasian Plate.

It is a classic example of a continent-continent convergent boundary.

It's important to note that plate boundaries can be complex and may have variations within a particular region.

The matches provided here represent simplified classifications for each country's general plate boundary.

For similar question on Eurasian Plate.

https://brainly.com/question/16939139

#SPJ8

This plant is used to treat liver ailments during the medieval times
Liverworts
Hornworts
Mosses
Ferns

Answers

Answer:

liverworts

Explanation:

Answer:

liverworts

Explanation:

that's were it got its name because of it healing properties

Can someone plz help me out. I don’t really understand this.

Answers

7. b and 8. c i attached the photo for u to see how i did it

the step of translation in which release factors bind to a stop codon is

Answers

The step of translation in which release factors bind to a stop codon is termination. During this step, the ribosome recognizes the stop codon and triggers the release of the newly synthesized polypeptide chain along with the dissociation of the mRNA and ribosome.

Translation is the process of converting genetic information stored in mRNA into a sequence of amino acids that make up a protein. It is divided into three stages: initiation, elongation, and termination. During termination, the ribosome recognizes the stop codon (UAA, UAG, or UGA) in the mRNA, and a protein called a release factor binds to the A site of the ribosome. This causes the polypeptide chain to be released from the ribosome and folded into its final shape. Finally, the mRNA and the ribosome dissociate from each other. The newly synthesized protein can then undergo further modifications before being transported to its final destination in the cell.

Know more about stop codon, here:

https://brainly.com/question/30104870

#SPJ11

Describe why food needs to be digested from large to small molecules.

Answers

Answer:

Food must be broken down into nutrients for the body to use for energy, development, and cell repair. Before the blood absorbs and transports nutrients to cells in the body, food and drink must be broken down into smaller nutrient molecules.

_____ in carbon dioxide in your red blood cells, which causes _____ in pH, causes your breathing to speed up. See Concept 42.6 (Page) View Available Hint(s) _____ in carbon dioxide in your red blood cells, which causes _____ in pH, causes your breathing to speed up. See Concept 42.6 (Page) A decrease ... a drop An increase ... a rise An increase ... a drop A decrease ... a rise Actually, it is the rise and fall of oxygen, not carbon dioxide, that controls breathing.

Answers

Answer:

1 An increase

2 A drop

Explanation:

Other Questions
Angel is a high school basketball player. In a particular game, he made some free throws (worth one point each) and some two point shots. Angel made a total of 12 shots altogether and scored a total of 16 points. Graphically solve a system of equations in order to determine the number of free throws made, x,x, and the number of two point shots made, yy. Which of the following conditions is/are necessary to justify the use of t procedures in a significance test for the slope of a regression line? (4 points)I. For each given value of x, the values of the response variable y are Normally distributed.II. For each given value of x, the values of the response variable y are independent.III. For each given value of x, the standard deviation of y is the same.A. I onlyB. II onlyC. III onlyD. I and II onlyE. I, II, and III PLEASE PLEASE HELP (DUE ASAP)! I was struggling a lot with this and I was hoping for an accurate answer! Name the correct angle using the given diagram The following table contains information based on analysts' forecasts for three stocks. Analysts expect for example that Stock A's share price will be $27 one year from now, and its dividend to be paid 1 year from today is expected at $1 per share. Assume a risk-free rate of 7% and a market return of 15%. Use this table for questions 1 to 5. 1. (Using the table above) Compute the return on stock B over the next year? OA. - 2.5% O B. + 2.5% O C. + 5.7% OD. + 17.5% L C LL F PLS HELP! (Picture included)A slice is made parallel to the base of a right rectangular pyramid, as shown.What is the area of the resulting two-dimensional cross-section?Enter your answer in the box. cmRectangular pyramid intersected horizontally by a rectangle. The front edge of the base of the pyramid is labeled 2 centimeters, and the right edge is labeled 4 centimeters. The height of the pyramid is labeled 8 centimeters. The part of the larger rectangle that intersects the pyramid is a smaller gray rectangle. The front side of the smaller rectangle is labeled 1 centimeter, and the right side is labeled 2 centimeters. Table salt is an example of a(n) ____________that is made up of two or more elements. When a high operating kilovoltage is used, (low/high) subject contrast and (many shades of gray/areas of black and white) are seen on the dental image.a. Low subject contrast; many shades of gray b. Low subject contrast; areas of black and whitec. High subject contrast; many shades of gray d. High subject contrast; areas of black and white Tap the detail that "the experience" refers to.Someone pls help Let X be a random variable with Poisson distribution ofparameter Lamda: CalculateE (cos (\thetaX)) 3. Define the following:a. electromagnetic radiationb. wavelengthc. frequencyd. quantume. photon a hunter went with a group of 4 people in the forest to hunt an antelope. the first person saw the antelope, the second one ran after it, the third one shot it and the fourth one carried it. As a student of S. 1 ,use the knowledge in measurements in Physics to help the hunter to equally share the meat. If Supreme Court Justice Elena Kagan votes with the majority of Supreme Court justiceson a particular case, yet her reasoning differs from the others, she may choose to expressher reasons in a what is 2 divided by 1/2 PLEASE HELP :) THANK YOU Geologic processes change Earth's surface on varying scales of space and time. They range from rapid to very slow; from large to microscopic. How does the time scale of slow geologic processes affect human perception of landforms on Earth? Provide details to support your answer. The examination of radial and tangential fracture lines on glass that has been struck by two projectiles in sequence can provide the following information:a. The refractive index of the glassb. The sequence by which the projectiles struck the glassc. Both a and c The number of requests for assistance received by a towing service is a Poisson process with = 4 rate per hour.a. Compute the probability that exactly ten requests are received during a particular 2-hour period. England was attacked many times in the early middle ages by warriors from scandinavia called:________ Wendy bought a silver necklace online. It cost $23.15 plus 20% shipping and handling. What was the total cost? IF IT IS GOOD THEN I WILL GIVE BRAINLIEST!!! Please help question in the picture