someone Please help!! I'm not good at this stuff. I'll give brailniest

Answers

Answer 1

Answer:

What do you need help with?

Explanation:


Related Questions

All substances are built from
compound
oxygen
metals
atoms

Answers

Answer: All substances are built from

compound

oxygen

Explanation:

All substances are built from atoms as atoms are the basic building blocks of matter and are the smallest units of a chemical element. The correct option is D.

Atoms form the basis of all compounds. The fundamental building blocks of matter, atoms are the smallest units of a chemical element that nonetheless retain that element's chemical characteristics.

Atoms from various elements combine chemically to produce compounds, however compounds themselves are not the basic building blocks.

Although oxygen is an element that is present in several substances, it is untrue to say that oxygen is the primary component of all substances.

Although metals are a specific kind of element, not all substances are made of metals. Thus, the most correct response is that all substances are composed of atoms.

Thus, the correct option is D.

For more details regarding atoms visit:

https://brainly.com/question/13654549

#SPJ6

Your question seems incomplete, the probable complete question is:

All substances are built from

A. compound

B. oxygen

C. metals

D. atoms

which of the following cells shows the process of a nucleus? a. prokaryotic b. eukaryotic c. both

Answers

Answer:

b. eukaryotic

Explanation:

"Eukaryotic" means to have a nucleus.
eukaryotic because the other one lacks a nucleus

According to the graph below, at which point is the plant preforming the most photosynthesis?

A. Point D.
B. Point B.
C. Point C.
D. Point A.

Answers

Answer: C

Explanation:

Point c would be the answer to your question

describe some of destructive action of microbes ​

Answers

Answer:

A microbe is a small living thing too tiny to be seen by the naked eye and includes bacteria, fungi and viruses. Among their destructive actions is causing diseases in human beings and their livestock or plants, destruction of food by causing decomposition which might lead to hunger and other related calamities. Despite this destructive consequences, microbes are also known to have advantageous actions like helping in sewerage treatment, microbes found in the gastro-intestinal tract help in maintaining a good environment for digestion to take place. Microbes also help in ecological balance by causing decomposition of dead matter hence conserve the environment.

Explanation:

Answer:

see the attached photo

Which are different forms of the same gene?
A.genotypes
B.phenotypes
C.alleles
D.traits

Answers

Answer:

alleles

Explanation:

An allele is a variant form of a gene. Some genes have a variety of different forms, which are located at the same position, or genetic locus, on a chromosome. Humans are called diploid organisms because they have two alleles at each genetic locus, with one allele inherited from each parent.

Answer:

C. alleles

Explanation:

edge 2021

Who is the inventor of the modern classification system?

Answers

Answer:

Carolus Linnaeus

Explanation:

Answer:

Carolus Linnaeus

Explanation:

Why must an organism be able to adjust to changing environments?

Answers

Answer:

blabkkbkkbcqcwwcqwqwwq

Explanation:

All organisms need to adapt to their habitat to be able to survive. This means adapting to be able to survive the climatic conditions of the ecosystem, predators, and other species that compete for the same food and space.

How is the DNA code itself a homology?

Answers

Answer:

Explanation:

These fundamental similarities are most easily explained by evolutionary theory: life shares a common ancestor. ... In fact, the DNA code itself is a homology that links all life on Earth to a common ancestor. DNA and RNA possess a simple four-base code that provides the recipe for all living things.

Answer:

the DNA code itself is a homology that links all life on Earth to a common ancestor. DNA and RNA possess a simple four-base code that provides the recipe for all living things.

The plates include the lithosphere under the oceans true or false

Answers

Answer:

A tectonic plate (also called lithospheric plate) is a massive, irregularly shaped slab of solid rock, generally composed of both continental and oceanic lithosphere. So i think its True

what is this pls help these are finals

Answers

Answer:

wowzerrrrrrs

Explanation:

how would you classify the bloody fingerprint found in the pedro ramon velasquez case?
patent
latent
delta
plastic

Answers

Answer:

patent

Explanation:

Which one is the correct answer?? The lined squares in the Punnett square represent____.

Answers

They represent the parent's genotypes.

what was the problem with reusing contaminated water from other parts of the mill to extinguish the coke fires? From the book ‘When smoke ran like water’

Answers

Answer:

1. The problem with that was that the already poisonous water was made worse after using it to quench the flames from coke production.

2. It contaminated the soil, making it difficult for plants to grow.

Explanation:

As the author described the last stages of coke production, she explained that water was needed to quench the very hot flames from coke production. A 'bright fellow' suggested using dirty water from other parts of the mill to quench the flames from the coke production. The problems with this were;

1. The already contaminated water was made worse after it was used to quench the flames from coke.

2. Mrs. LaMendola noted that she was unable to grow her tomatoes in the path where the plumes from the oven ran. So the contaminated water negatively affected the soil.

The problem that should be already poisonous water is also made worse when it quenches the flames at the time when the production of the coke should be done.

Also, it contaminated the soil also it is difficult for growing the plants.

The problem of reusing contaminated water:

Since the author explained the last coke production stage so here the water required to quench that it should be very hot flames arise from the coke production. Also, the contaminated water should be worse whenever it is used for quenching the flames. Also, the contaminated water does not positively impact the soil.

Learn more about water here: https://brainly.com/question/18850280

What are the two categories that Igneous Rocks can be classified into?
How do you tell them apart?

Answers

Igneous rocks are divided into two groups, which penetrate or expand, depending on the strength of the molten rock.

Intrusive Igneous Rocks: Intrusive, or plutonic, is an empty rock that occurs when magma is trapped in the depths of the Earth.Extrusive, or volcanic, igneous rock is produced when magma exits and cools above the Earth's surface.

hope it helps!

What happens if oranisms fall to adjust and respond to changes in their environment?

Answers

Answer:

they would probably go extinct

Explanation:

I’m assuming the whole environmental system would collapse animals would die off including humans

Paragraph about Photosynthesis

Answers

Answer:

Photosynthesis is the process of making food by green plants in the presence of sunlight.

Explanation:

During Day, sunlight enters through stomata and carbon dioxide from air and water forms glucose and oxygen. This process is photosynthesis.

The last universal common ancestor (LUCA) probably multiplied by duplicating all of its cellular contents, followed by cellular division .

Answers

Answer: true

Explanation:

i guessed and got it right

Joseph and Molly each have coin collections. Joseph starts with 15 coins in his collection and adds 25 coins each month. Molly starts with 25 coins in her collection and adds 25 coins each month. If Joseph and Molly continue to collect in this way, how many coins will each person have after 10 months? Enter your answers in the boxes. After 10 months, Joseph will have coins in his collection, and Molly will have coins in her collection.

Answers

Answer:

Joseph will have 265 coins and Molly will have 275 coins after ten months.

Explanation:

Joseph already has 15 coins and adds 25 coins after each month. So after ten months the total number of coins Joseph will have is [tex]15+25\times 10=265[/tex] coins.

Molly already has 25 coins and adds 25 coins after each month. So after ten months the total number of coins Joseph will have is [tex]25+25\times 10=275[/tex] coins.

So, Joseph will have 265 coins and Molly will have 275 coins after ten months.

Describe some of the properties of water and explain how the structure of water is responsible for these properties.

Answers

Answer:

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.

Explanation:

Write a summary statement for saturated fats including whether they are solids or liquids at room temperature and weather they have all single carbon-to-carbon or at least one carbon-to-carbon bond

Answers

Answer:

A saturated fat is a type of fat in which the fatty acid chains have all or predominantly single bonds. A fat is made of two kinds of smaller molecules: glycerol and fatty acids. Fats are made of long chains of carbon atoms. Some carbon atoms are linked by single bonds and others are linked by double bonds. Double bonds can react with hydrogen to form single bonds. They are called saturated because the second bond is broken and each half of the bond is attached to a hydrogen atom.

Explanation:

Answer:

saturated fats consists of single covalent bond and they are solid at room temperature and their melting point increases with increasing chain length

hope it helps

Explanation:

Who were the representatives
sent to work on the deal?

Answers

Answer:

Peace Negotiations

After Yorktown, the Continental Congress appointed a small group of statesmen to travel to Europe and negotiate a peace treaty with the British: John Adams, Benjamin Franklin, John Jay, Thomas Jefferson and Henry Laurens.

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

Which American Indian group was allied with the British as the French and Indian War began?
A)the Huron
B)the Ottawa
C)the Iroquois Confederacy
D)the Algonquin

Answers

Answer:

The Iroquois Confederacy would be your answer.

hope it helps!

Describe how energy flows through an energy pyramid? Write your answer in the space provided below.

Answers

Answer:

Depending on the food pyramid, on the side there may be something that says decomposers. These eat from all of the sections of the pyramid.

Energy flows from the bottom to the top, and then to the side with the decomposer.

Please I beg someone to help me
Which most likely accounts for the increase in the number of male butterflies in the five years after the initial parasite problem?

Answers

Idk for sure but the first one seems like the best choice :)


Which type of energy
does respiration release?
chemical
thermal
potential
kinetic

Answers

Answer:

Respiration releases energy it is an exothermic process. The energy is stored in molecules of ATP . ATP can be broken down in other processes in cells to release the stored energy.

chemical

which factor would increase the production of glucose by photosynthesis

Please help!!!

Answers

Answer:

freezing temperatures

The amount of sun it’s getting

NEED HELP ASAP!!!! Explain why the fact that invasive species did not co-evolve with the native species unbalances an ecosystem.

Answers

Answer: The invasive species unbalance an ecosystem because it takes over an ecosystem and does not let the other native species thrive while it takes over. There are many invasive species around the world even in your own town or state there is a type of fish suppose that is an invasive species to Michigan called a sea lamprey which kills fish native  to the great lakes and is taking over there are also zebra muscles if you need another example

BRAINLIEST PLZ

            Invasive species lack native species' population controls, such as predators, because they did not co-evolve with the other species in the ecosystem. As a result, the population of an invasive species may spread unchecked and eventually throw an ecosystem out of balance.

Unbalances in ecosystem :

                 A natural or human-caused disruption that throws off an ecosystem's natural balance is known as an ecological imbalance. Both natural and man-made disturbances have the potential to upset an ecosystem's delicate balance. A species' extinction or the introduction of a new species may cause an ecosystem to become ecologically unbalanced.

                 All the organisms and the physical setting they interact with make up an ecosystem. The nutrition cycles and energy flows connect these biotic and abiotic elements. Photosynthesis is how energy enters the system and is absorbed by plant tissue. Both internal and external influences influence ecosystems. External variables that do not directly affect an ecosystem, such as topography, parent material that creates the soil, and climate, control the ecosystem's general structure. For instance, decomposition, root competition, shade, disturbance, succession, and the kinds of species present all regulate internal variables. While the availability of these resources within the ecosystem is normally governed by internal factors, the resource inputs are often controlled by external activities. As a result, interior variables influence ecological processes as well as being influenced by them.

To learn more about ecosystem refer :

https://brainly.com/question/842527

#SPJ2

struggling in bio h e l p

Answers

Answer:

d maybe but im still figuring it  out

Explanation:

Answer:

D

Explanation:

Which process is best illustrated by the diagram?

Answers

Answer:

Photosynthesis

Explanation:

The formula shown is the one for photosynthesis.  6CO2 + 6H2O → C6H12O6 + 6O2. (please tell me if i am correct) :)

Other Questions
what type of national government did the articles of confederation create Triangle JKL, shown below, is translated 7 units to the rightthen reflected across the x-axis.+6K+514JVL*3*21-6 -5 -4 -3 -2 -1 0*1 2 3 4 5 612.35 6What will be the new coordinates of point J, after thetriangle has been transformed? If you get this right, I'll teach you how to out pizza the hut :) A third friend offers you a flat $20 to watch his dog during the same time. Tell whether you would choose this job over either of the other two and explain why. Who benefits from digital technology? Is the mesosphere temperature high or low and what is the temperature France won the Hundred Years' War because of the efforts ofa. Pope Leo IX.C. Queen Isabella.b. King John.d. Joan of Arc.Please select the best answer from the choices providedAB0 Determine mA, mB, and mC. Solve the Equation:3x-4=10 what is x PLEASE HELP ME! IM TIMED 1. About how long ago did Confucius live? *1,000 years ago2,000 years ago3,000 year ago4,000 years ago A clothing store is selling T-shirts at 2 for $15. If Michael purchases 8 T-shirts, how much money will he spend? 39 which statement about the process of dissolving is TRUEA. Dissolving releases energy in the form of heat.B. Solvent can be dissolved faster when stirring is applied.C. Applying heat often speeds up the process of dissolving particles.D. Once a solute, such as salt crystal is dissolved in a solvent such aswater, it can never return to its original crystal state. Piedmont-Sardinia was Italys largest independent State. Therefore, there were a strong .... Find the slope and y-intercept (solve for y) -4y+2x= -20 Aldo made a shirt using 1/5 meters of yellow fabric and 2/3 meters of red fabric. How many meters of fabric did he use in all? Write your answer as a fraction in simplest form. 6. At a game, there were 24 adults and 10 children. Keeping the same ratio,if there were 50 children, how many adults would be at the game? * Please help meee (*^*)/ please help im really stuck What number go in each circle ? What number go in both circle?