Ted gave Bill a pencil, which Bill thought was kind. Ted didn't mind getting another one.

First person

Second person


Third person limited

Third person omniscient

Answers

Answer 1

Answer:

third person omniscient

Explanation:

This is a common form of third-person narration in which the teller of the tale, who often appears to speak with the voice of the author himself, assumes an omniscient (all-knowing) perspective on the story being told: diving into private thoughts, narrating secret or hidden events


Related Questions

How does the structure help Garrison to meet his purpose of effectivity

Answers

n 1833, he met with delegates from around the nation to form the American Anti-Slavery Society. Garrison saw his cause as worldwide. With the aid of his ... William Lloyd Garrison the radical abolitionist was described as. ... William attended school infrequently, often working odd jobs to help his mother support ... That year would bring other important changes for Garrison.

What are the four parts
of a paragraph

Answers

The introduction, body, body 2 and than your conclusion. I’m pretty sure

in the diary of anne frank, what does anne say she does and does not want from people?

Answers

Answer:

That she doesnt want followers she wants friends.

Explanation:

Point A is the point of concurrency of the angle bisectors of ΔDEF.

Point A is the point of concurrency of triangle D E F. Lines are drawn from each point of the triangle to point A. Lines are drawn from point A to the sides of the triangle to form right angles and line segments A X, A Y, and A Z. The length of F A is 6 centimeters, the length of A D is 5 centimeters, the length of A X is 3 centimeters, and the length of Y D is 4 centimeters.
What is the length of ZA?

ZA = 3cm
ZA = 4cm
ZA = 5cm
ZA = 6cm

MORE MEMES

Answers

Answer:

Answer is A.

Explanation:

I will ban you from mememes

Answer:

its a

Explanation:

did the test edge 2022

HELP WILL 10 POINTS AND BRAINIEST ANSWER! IF YOU ANSWER SILLY I WILL REPORT! HERE IS THE QUESTION,
WHY DO YOU THINK IT TAKES COURAGE TO BE A FOLLOWER OF JESUS IN OUT CURRENT TIMES? WRITE ABOUT A PARAGRAPH ( 5-8 SENTENCE)
please give a good answer

Answers

It takes courage to be a follower of Jesus in current times for many reasons. First off, believing in something that cannot be seen takes a lot of strength. Secondly, you face more judgment from others than ever before. There is more temptations in today’s world than before, more opportunity to sin. There is more talk about other religions so you may feel pressured to believe in a different creator.

please answer questions number 4, 14,15 and 19​
change into passive voice

Answers

4. Should the tiger be preserved?

14. weren't you told to be here by 6 O'Clock?

15. were any questions asked about me?

19. Why were I not informed the change of plan by anyone?

Okay I've finished ur work!!

Answer:

question no.. 4: yes we should..!


1. Lines 12–16: What sound or word does Szymborska emphasize?
Describe its impact

Answers

Answer:

I do not know the answer unfortunatley. Have you gotten it yet? if so, can you plz tell me?

Explanation:

What is an internal conflict in literature?
A.
a fight between two people in a family
B.
the struggle with an outside force
C.
the psychological struggle in one’s mind
D.
an argument between work partners

Answers

Answer:

c the phychological struggle of ones mind how do i know simple its in the mind so its internal

Answer:

C

Explanation:

"The magician added more ____ to the trick when he pulled the white bunny out of the hat."

1. pizzazz
2. grunge
3. fun
4. aestheticism

Answers

Answer:

fun

Explanation:

he addad more fun to make them laugh

Answer:

pizzazz is the correct choice

She knew that she would weep again when she saw the kind, tender hands folded in death; the face that had never looked save with love upon her, fixed and gray and dead. But she saw beyond that bitter moment a long procession of years to come that would belong to her absolutely. And she opened and spread her arms out to them in welcome.
There would be no one to live for during those coming years; she would live for herself.
Which of Chopin’s readers in 1894 likely reacted most favorably to the theme in “The Story of an Hour”?
readers who preferred Chopin’s keen sense of humor
readers who cherished Chopin’s vivid regional style and Southern insight
readers who embraced the “new woman” and evolving gender roles
readers who celebrated the domestic responsibilities of “true womanhood”

Answers

Answer:

readers who embraced the “new woman” and evolving gender roles

Augustus compares his cancer to a battle and to war but the metaphor doesn’t quite work, especially when he says, “My cancer is me.” Explain what he means by this statement and his later statement about dying with glory

Answers

Answer:

cancer is a strange mutation of cells. it is a killer that was not stopped in the age of the Roman Empire, and Augustus may have been close in a medical standpoint. The cancer was his cells, and it most certainly was a battle. Dying by cancer meant dying without honor or bravery. Men would rather die of battle scars or wounds than die sitting on a couch sick. Augustus was an honorable caesar, so he would not want to die for dishonorable reasons like a disease.

Explanation:

Select the correct text in the passage.
Which sentence in this excerpt from Theodore Roosevelt's "Citizenship In a Republic speech conveys his central claim about cynical people?
But with you and us the case is different. With you here, and with us in my own home, in the long run, success or failure will be conditioned
upon the way in which the average man, the average women, does his or her duty, first in the ordinary, every-day affairs of life, and next in those
great occasional cries which call for heroic virtues. The average citizen must be a good citizen if our republics are to succeed. The stream will not
permanently rise higher than the main source; and the main source of national power and national greatness is found in the average citizenship
of the nation. Therefore it behooves us to do our best to see that the standard of the average citizen is kept high; and the average cannot be
kept high unless the standard of the leaders is very much higher.
Let the man of learning, the man of lettered leisure, beware of that queer and cheap temptation to pose to himself and to others as a cynic, as
the man who has outgrown emotions and beliefs, the man to whom good and evil are as one. The poorest way to face life is to face it with a
sneer. There are many men who feel a kind of twister pride in cynicism, there are many who confine themselves to criticism of the way others do
what they themselves dare not even attempt. There is no more unhealthy being, no man less worthy of respect, than he who either really holds,
or feigns to hold, an attitude of sneering disbelief toward all that is great and lofty, whether in achievement or in that noble effort which, even if
it fails, comes to second achievement. A cynical habit of thought and speech, a readiness to criticise work which the critic himself never tries to
perform, an Intellectual aloofness which will not accept contact with life's realities - all these are marks, not as the possessor would fain to think,
of superiority but of weakness. They mark the men unfit to bear their part painfully in the stern strife of living, who seek, in the affection of
contempt for the achievements of others, to hide from others and from themselves in their own weakness. The role is easy; there is none easler,
save only the role of the man who sneers alike at both criticism and performance.

Answers

Answer:

There is no more unhealthy being, no man less worthy of respect, than he who either really holds,  or feigns to hold, an attitude of sneering disbelief toward all that is great and lofty, whether in achievement or in that noble effort which, even if  it fails, comes to second achievement.

Explanation:

This may be wrong, but I'm certain this is the answer because it describes a cynic from a very opinionated point of view.

There is no more unhealthy being------------------------------comes to second achievement is the sentence in this excerpt from Theodore Roosevelt's "Citizenship In a Republic speech conveys his central claim about cynical people. Thus, option (d) is correct.

Who is Theodore Roosevelt's?

President Theodore Roosevelt was the most effective “conservationist.” October 27, 1858, marked Theodore Roosevelt's birth. In addition to conservation, Roosevelt's top priorities changed. A total of 230 million acres of public land were protected under Theodore Roosevelt.

In the preceding clause, Roosevelt starts to address cynical people, Beware of the strange and cheap desire to present oneself and others as a cynic, a man who has outgrown feelings and beliefs, and a person to whom good and evil are synonymous. This applies to both men and women of study and lettered leisure.

As a result, the Theodore Roosevelt's "Citizenship In a Republic speech conveys his central claim about cynical people are the aforementioned. Therefore, option (d) is correct.

Learn more about on Theodore Roosevelt's, here:

https://brainly.com/question/29359038

#SPJ2

PART B: Which TWO details from the passage best support the answers to Part A?
A. "So there sat old Woodifield, smoking a cigar and staring almost greedily at the
boss..." (Paragraph 1)
B. "Poor old chap, he's on his last pins, thought the boss. And, feeling kindly, he
winked at the old man, and said jokingly, 'I tell you what. I've got a little drop of
something here that'll do you good'" (Paragraph 10)
C. "Although over six years had passed away, the boss never thought of the boy
except as lying unchanged, unblemished in his uniform, asleep for ever."
(Paragraph 26)
D "Over and under, over and under, went a leg along a wing, as the stone goes
over and under the scythe." (Paragraph 30)
"there was something timid and weak about its efforts now, and the boss
decided that this time should be the last, as he dipped the pen deep into the
inkpot" (Paragraph 32)
F "And while the old dog padded away he fell to wondering what it was he had
been thinking about before." (Paragraph 36)
E.

Answers

Answer:

A,B

Explanation:


How would readers most likely connect this excerpt to
their own lives

Answers

Answer

Readers would most likely connect this excerpt to their lives by relating to wanting to make their parents proud.

What does the word theory mean?

Answers

a supposition or a system of ideas intended to explain something, especially one based on general principles independent of the thing to be explained.

Answer: a idea that is not the official answer but makes sense watch the film thereost

Explanation:

How did people predict the experiment would go?
(From “The Perils of Obedience)

Answers

Answer:

If an authority figure ordered you to deliver a 400-volt electrical shock to another person, would you follow orders? Most people would answer with an adamant "no." However, the Milgram obedience experiment aimed to prove otherwise.

During the 1960s, Yale University psychologist Stanley Milgram conducted a series of obedience experiments that led to some surprising results. These results offer a compelling and disturbing look at the power of authority and obedience.

what type of tooth paste do you prefer colgate or crest?

Answers

Answer:

Crest ever since I had braces.

Explanation:

What mode of persuasion does Antony use when he says, "Then make a ring around the corpse of Caesar, and let me show you him that made the will"?


a

Ethos because he’s uniting with his audience to surround Caesar’s body.


b

Pathos because he’s going to show the people how much Caesar loved them.


c

Logos because he will read facts from the will to the people.

Answers

Answer:

a. Ethos because he’s uniting with his audience to surround Caesar’s body.

Explanation:

We can say that Antony made full use of ethos, which reinforces the sense of ethics in a speech. This is because in calling the people to gather around the body of Caesar, he joins the people and asks them to see for themselves, without intermediaries, the man they are causing death, but who made a beneficial will and advantageous.

IM BEGGING YOU PLEASE PLEASE PLEASE HELPP
Read the following excerpt from Kennedy's inaugural address and answer the question:

I do not believe that any of us would exchange places with any other people or any other generation. The energy, the faith, the devotion which we bring to this endeavor will light our country and all who serve it—and the glow from that fire can truly light the world.

Which of the following is an effective use of summary of this passage?

The energy, the faith, the devotion that we bring to this effort will help our country, anyone who serves it, and the world.
Kennedy believes that the people of that generation have special qualities that will make a difference not only in the country, but also in the world.
I believe we are uniquely able to change our country and the world with our determination, beliefs, and dedication.
This excerpt is from Kennedy's inaugural address, which is the speech to the nation when a president takes office.

Answers

Answer:the answer is speech 34 of the law

Explanation:

Answer:

It's B

Explanation:

Good luck :D

4. How does faulty parallelism weaken your writing?
- by sounding too repetitive

- by causing the reader to doubt your facts

- by making writing seem illogical

-by creating unbalanced sentences

Answers

Answer:

By creating unbalanced sentences

Explanation:

I just took the test, enjoy

The faulty parallelism weakens your writing by creating unbalanced sentences. The correct option is d.

What is parallelism?

Parallelism refers to using similar words, clauses, phrases, sentence structure, or other grammatical elements to emphasize similar ideas in a sentence. It makes the sentence concise, clear, and easy to read.

Parallel structure is important, especially in items in a series, paired items, and items in an outline or list. We use parallelism for aesthetic purposes as well as to demonstrate that the ideas under discussion have the same level of importance. A sentence with parallel construction makes your writing effective, classy, and certain to impress anyone who reads your work. Parallelism can make your writing more forceful, interesting, and clear. It helps to link related ideas and to emphasize the relationships between them.

Once a grammatical pattern has been established, the reader doesn’t have to strain to understand your meaning and ideas.

Learn more about parallelism, here:

https://brainly.com/question/14288776

#SPJ1

Which sentence correctly uses an adverbial phrase?
A. Davion greeted us with a big smile.
B. Davion greeted us kindly.
C. Kind, smiling, Davion greeted us.
D. Although he greeted us, Davion smiled.

Answers

Answer:

A

Explanation:

it uses the word "with"

hope this helps <3

Lauren Tarshis writes, "Ballard scoured historical records until finally settling on a 100-square-mile area to search." In this sentence, scour is used to mean

Answers

I think this was the question you were referring too:

Lauren Tarshis writes, “Ballard scoured historical records until finally settling on a 100-square-mile area to search.” In this sentence, "scour" is used to mean  

A. to rub something hard in order to clean it.

B. to search through or examine something closely in order to find something.

C. to discover something surprising or unexpected.

D. to permit someone or something to enter.

answer would be B. to search through or examine something closely in order to find something.

In this sentence, scour is used to mean to search through or examine something closely in order to find something. Thus, option B is correct.

Who is a historian?

A historian is a person who does study into antiquated books, manuscripts, and other sources in order to examine historical events and create historically accurate knowledge about past developments.

In the following sentence which is reached enter as the word music to search for something or examine something that is very close. As Ballard wants to know about some kind of historical research she will have to search for it.

And the search will be formal and all of this will be in-depth and thorough. It also that how the historical document will enhance the way things will be represented.

Therefore, option B is the correct option.

Learn more about historian, here:

https://brainly.com/question/8426126

#SPJ5

The question is incomplete, the complete question will be

Lauren Tarshis writes, “Ballard scoured historical records until finally settling on a 100-square-mile area to search.” In this sentence, "scour" is used to mean  

A. to rub something hard in order to clean it.

B. to search through or examine something closely in order to find something.

C. to discover something surprising or unexpected.

D. o permit someone or something to enter.

ASAP PLEASE HELP ME!!!!!

How do you feel about this reading Pro-Trump Mob storms US Capitol?

What question do you have after reading Pro-Trump Mob storms US Capitol?

Answers

Why didn’t the the cops treat it like they did the BLM protest

What are two features of expository text?

Answers

Informative. Expository text is meant to deposit information.
Clarity. Using words that clearly show what the author is talking about.

Which is a true statement about inference?

It is another term for the main idea. It is based on information not directly stated. It describes an assumption that is illogical or makes no sense.

Answers

Answer:

it is based on information not directly stated.

Explanation:

I'm pretty sure

Answer:

B hope this helps

Explanation:

Michael Jordan is the greatest basketball player of all time. fact or opinion and example

Answers

Answer:

Opinion

Explanation:

The key words are "greatest" and "of all time". These words indicate that the statement is an opinion because they are absolutes and objective, in other words, cannot be proven.

it’s an opinion

not everyone thinks that he’s the greatest player of all time
it also uses the word greatest which is a sign that the sentence is an opinion

why did people think the titanic ship couldnt sink



WILL MARK BRAINLIST IF RIGHT

Answers

Answer:

They thought it couldnt sink because everyone said it is unsinkuble making people beleive that!

Explanation:

How much knowledge should a person or society have?When, if ever, should our pursuit of knowledge be limited?

Answers

. As is often said, knowledge is power, and power in the wrong hands can be dangerous. ... If you yourself are faced with an opportunity to gain knowledge and later apply it, you must decide whether the potential benefits are worth any harm that may be done as a result.

please answer right will give brainliest ​

Answers

Answer:

2. Write your own definition of opportunity cost.

    the opportunity cost is the advantage you sacrifice when you choose to do something.

Let me explain better. Imagine you were practicing violin for 40 hours. The opportunity cost is the 40 hours you could have been spending your free time on, but lost because you decided to practice.

3. List 2 reasons you should pay yourself first.

    Reason 1 - because it feels good

    Reason 2 - because it increases savings & investment

4. Explain the difference between savings and investing.

    well saving is like when you put your money aside into your bank account, and not spending it. investing is when you USE some of your money to buy assets, hoping it will help make money for you in the future. investing is for long-term goals.

I didnt really look into it long 'nough, hope it helps anyway. good day~

2. Which statement best describes the relationship between
Dr. Martin Luther King, Jr. and Mahalia Jackson?

Answers

Answer: D

Explanation:

Because her grandfather was enslaved, Mahalia Jackson became committed to the Civil Rights Movement (CRM) much like Martin Luther King, Jr. in Her statement, she said that she hoped that her singing will break down some fo the hate and feat that divided people of different colour and ethnic orientation. Because of her prominence and influence in and through gospel music, Dr. Martin Luther King, Jr. invited her to perform at some of the CRM events.

Thus, the correct answer is D.

What is the Civil Rights Movement?

The Civil Rights Movement was a campaign for social justice that was prevalent in the 1950s and the 1960s, canvassing for colored Americans to be granted equal rights under the Law of the United States of America.

Read more about the Civil Rights Movement here:

https://brainly.com/question/131269

Other Questions
Tell about a time in your life when you were very scared. It can be an event or something you were worried about. 2 sentences.Please put something I have nothing- 2.92 x 10^-15/(5.6 x 10^-3) (4.16 x 10^9) Find the volume of the following figure Nate needs at least 15 pounds of chocolate to make his chocolate fountain work. He already has 8 pounds of chocolate. What is the smallest amount that he can get to make the chocolate fountain work? Write an inequality and solve. Let c represent the amount of chocolate Nate needs to get. Pls pls help I dont have time HELP ASAP. It also detects if its right or wrong. Part i)Which of the following is the best abbreviation for the word Government?a.) GOVMTb.) GVRNTc.) GOVd.) GOV'TPart ii)In 100 words or less, describe what the U.S Government is/does and why it is/isn't so important. Briefly state your beliefs/views and facts about the U.S Government. You may use any and all online resources to answer this question. Include as much detail as possible in your short answer. Which number is irrational? . Complete the quotation:"I am ...with him in this world" From jekyll and Hyde The function of a retail of purchasing cooperative or "co-op" is toCorrect answer A. obtain lower prices for members.Incorrect answer B. work to improve the image and working conditions of members.Incorrect answer C. save income taxes for members.Incorrect answer D. sell the goods or services produced by members. What does it mean to "Psych yourself up?" How does this term affect the meaning of the text Find three ratlos equivalent to the ratio described in the situationThe ratio of cups of water to cups of milk in a recipe is 1 to 4Three equivalent ratlos are 2 to3 to4 to When a cricket ball is thrown vertically upwards, it reaches a maximum height of 15 metres. (a) What was the initial speed of the ball ? (b) How much time is taken by the ball to reach the highest point ? (g=10 ms -2 What caused president roosevelt to sign into law meat Inspection act? who is a better band1:One direction2: 5 seconds of summer 3: BTS4:Little mix5: other Which of the following describes hetereogeneous mixture... 1)A mixture that is easily separated, the components are different sixes and unevenly mixed. 2) A mixture that is very difficult to separate, the contents are evenly mixed and the mixture looks like a substance Light rays from the sun are called: solar energy heat energy chemical energy a circle has a center at (-2,7). if a point on the circle has coordinates (3,-1) then which of the following would be the length of the radius of the circle write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC if you answer some of them ill appreciate it ( you don't have to answer all of them ) What can cause a significant change in someones life