The cell membrane is made up of a lipid bilayer as shown in the model. Which of the following describes the structure and function of the cell membrane?
56 points!!!!!!

The Cell Membrane Is Made Up Of A Lipid Bilayer As Shown In The Model. Which Of The Following Describes

Answers

Answer 1

Answer:

The hydrophilic head groups of the lipid molecules are exposed to the outside of the cell and the cytoplasm, which is a water-like environment. The hydrophobic tails form an oily layer inside the membrane that keeps water out of the cell

Explanation:

Answer 2

Cell membrane is selectively permeable in nature. The hydrophilic head groups of the lipid molecules are exposed to the outside of the cell, which is a water-like environment and hydrophobic tails form an oily layer inside the membrane. Thus, correct option is A.

What is Plasma Membrane?

Plasma membrane is also known as the cell membrane. It is found in all types of cells that separates the interior of the cell from the outside environment. In bacterial and plant cells, a cell wall is also found which covers the cell membrane.

The cell membrane consists of three classes of amphipathic lipids: phospholipids, glycolipids, and sterols. Plasma membrane is selectively permeable in nature, it allows only some material to pass through it while blocks other material from entering through it.

The portions of the integral membrane protein found inside membrane are hydrophobic, while portions which are exposed to the cytoplasm or extracellular fluid tend to be hydrophilic in nature. Molecules that are hydrophobic can easily pass through the plasma membrane while hydrophilic particles cannot pass through the membrane easily.

Therefore, correct option is A.

Learn more about Plasma membrane here:

https://brainly.com/question/24588191

#SPJ5


Related Questions

Identify the advantages and disadvantages of internal and external fertilization

Answers

When a sperm fertilizes an egg within the female, it is known as internal fertilization. The advantages of internal fertilization are that the fertilized egg is protected from predators and harsh environments, thus ending in higher chances of survival. Also, there is a lesser chance of desiccation of gametes. Disadvantages of internal fertilization are that there are lesser number of offspring produced at a given time because it is sometimes difficult for the male and female to come into intimate contact. Additionally, the risk of sexually transmitted diseases also increases.

You should be on the lookout for tornadoes
during___
because the two often occur
together.
х
thunderstorms
winter storms
blizzards
hurricanes

Answers

The answer would be A.thunderstorms

Hope this helps

Have a great day/night

True or False: Epinephrine enters
the cell after it binds to the receptor.

Answers

i believe it’s true ...

Epinephrine enters the cell after it binds to the receptor. Yes, this statement is true.

What are the functions of epinephrine?

Adrenaline, also known as epinephrine, is a hormone and medication which is involved in regulating visceral functions. It appears as a white microcrystalline granule.

Epinephrine injection is used for emergency treatment of severe allergic reactions (including anaphylaxis) to insect bites or stings, medicines, foods, or other substances.

Through its action on alpha-1 receptors, epinephrine induces increased vascular smooth muscle contraction, pupillary dilator muscle contraction, and intestinal sphincter muscle contraction.

Learn more about epinephrine:

https://brainly.com/question/3882731

#SPJ2

Eukaryotic cells can be specialized for specific tasks in multicellular organisms

true
false

Answers

It is true from my looking

Match each underlined word to its correct meaning based on the context of the sentence. Tom had long been picking his way cautiously through this treacherous forest; stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors. He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering, but what it was she forbore to say. At this propitious time of public distress did Tom Walker set up as a usurer in Boston.

Answers

Answer:

A. Tom had long been picking his way cautiously through this treacherous forest;  stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs.  - 3.dangerous.

B. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors. - 4.bleak.

C. He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering,  but what it was she forbore to say. - 2.conciliatory.

D. At this propitious time of public distress did Tom Walker set up as a usurer in Boston. - 1.favorable .

Explanation:

The given underlined words in each sentence are-

1. "Precarious" refers to something unstable, unconfirmed, dangerous, uncertain, unreliable. So, when used in the given sentence, it suggests the dangerousness of the foothold that Tom had to depend on.

2. The word "dreary" is also used for something dull, uninteresting, bleak. It is used to describe the banal, cheerless memento of the fight the Indian warriors had given.

3. "Propitiatory" is another word used to describe something that is like a conciliatory offering, a token of appeasement, or trying to please someone or something. In the given sentence, it is used to describe how she will be offering a conciliatory act to him.

4. The word "propitious" is synonymous with something favorable, advantageous, presenting a promising idea. And in its use, the sentence presents how the public distress is favorable for Tom Walker to set up his office.

Answer:

- 3.dangerous. Tom had long been picking his way cautiously through this treacherous forest;  stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs.

- 4.bleak. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors.

- 2.conciliatory.

He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering,  but what it was she forbore to say.

- 1.favorable . At this propitious time of public distress did Tom Walker set up as a usurer in Boston.

Explanation:

Advantages of using tidal power include O no alr pollution
Otides are predictable
O low environmental Impact
O all of these​

Answers

Answer:

all of these :)

Explanation:

i think

Answer:

Yes The Correct answer is ( All Of These)

explanation:

The diagram shows the moving molecules in a beaker of liquid. What will happen if the molecules increase their speed?

A.
the liquid will become a solid

B.
the temperature of the liquid will increase

C.
the temperature of the liquid will decrease

D.
the molecules will gain mass

Answers

Answer:

I believe the answer to this question is B

I’m not sure if anyone knows this or not, can someone try and help me with this question!

Answers

Answer:

it gives them a mental picture of where they need to plant and pick the cotton

Explanation:

Hope this helps

The electrons that travel through electron transport chain #1 (and that have been excited off of the chlorophyll molecules on photosystem #2) are used to

Answers

Answer:

energy released in these electron transfers is used to form an electrochemical gradient. In chemiosmosis, the energy stored in the gradient is used to make ATP.

Explanation:

Hope this helps :)

Which belongs in each place

Answers

Answer:

1=e, 2=b, 3=c, 4=d, 5=a

Explanation:

.

Anaerobes carry on whereas aerobes carry on cellular respiration

Answers

Answer:

Anaerobes carry on cellular respiration in the absence of oxygen, whereas aerobes carry on cellular respiration in the presence of oxygen.        

Explanation:

Many of the cell processes needed need some energy to occur. Cellular respiration is the process by which cells degrade organic compounds and turn them into energy. Cellular respiration follows two ways, which depend on the presence or absence of oxygen, and both of them begin with the process of glycolysis, which occurs in the cytoplasm and does not need oxygen to occur.

Aerobic Respiration

Occurs in the presence of free oxygen.Series of reactions by which pyruvic acid (product of glycolysis) turns into CO₂ and H₂O, producing many ATP molecules. Respiration occurs in the mitochondria.Takes place in two steps or stages: Krebs cycle and electron transporter chain. Glycolysis and Krebs cycle produce electrons, which then travel along the electron transporter chain while releasing energy, and ATP is produced.

Anaerobic Respiration

Occurs in the absence of free oxygenSeries of reactions by which using pyruvate (product of glycolysis) 2 ATP molecules van be produced. There are two ways in which anaerobic respiration can be produced: lactic fermentation and alcoholic fermentation. Lactic fermentation produces lactic acid and 2 ATPAlcoholic fermentation occurs in two steps, and the final products are ethylic alcohol, 2ATP, and 2 CO₂The whole anaerobic process occurs outside the mitochondria.

Mitosis is responsible for growth, repair, and maintenance in an organism because

a. it occurs at a faster rate than meiosis.
b. the chromosome number is reduced by half.
c. exact duplicates of each mother cell are produced.
d. it is the only process that involves replication of genetic material.

Answers

Answer:

The correct answer is c

Explanation:

USA test prep

Through scientific research, genetic technologies have advanced the study of gene sequences. Which is a main benefit of gene therapy technology?
a. The ability to cure genetic diseases by replacing defective genes
b. The ability to genetically design organisms that have never existed
c. Understanding how human genes turn on and off to make carbohydrates
d. Making genetically superior plants and animals to benefit the entire world.​

Answers

Answer:

a. The ability to cure genetic diseases by replacing defective genes

Explanation:

1. What Does DNA stand for?​

Answers

Answer:

deoxyribonucleic acid

DNA stands for deoxyribonucleic acid.

construct a flowchart (using “->”) (or explain) that depicts all the energy transfers that occur from the sun to the milk of your cereal

Answers

Answer:

dragon warrior or whatever it is called I don't maybe I am right

Write a sentence about tissues. (ITS FOR SCIENCE SO PLS)

Answers

Answer: There are 4 basic types of tissue: connective tissue, epithelial tissue, muscle tissue, and nervous tissue. Connective tissue supports other tissues and binds them together (bone, blood, and lymph tissues). Epithelial tissue provides a covering (skin, the linings of the various passages inside the body)

(GIVING BRAINLIEST!!)
Which common characteristic of planets do Saturn and Earth share?

A) They have rings.
B) They have moons.
C) They are made of rock.
D) They have thick atmospheres.

Answers

Answer:

THEY HAVE MOOOONNNNSSSSS

Explanation:

The answer is C. Earth doesn’t have rings. Saturn has way more moons then earths

If an organism is heterozygous for a particular trait, the organism
A.
has the same allele on both chromosomes in a chromosome pair.
B.
is missing alleles on the chromosomes in a chromosome pair.
C.
has different alleles on the chromosomes in a chromosome pair.
D.
has extra alleles on both chromosomes in a chromosome pair.

Answers

Answer: C.

has different alleles on the chromosomes in a chromosome pair

Explanation:

Hetero means different.

A heterozygous condition is one in which the child inherits various eye-color genes from both biological parents. For that particular gene, a heterozygous genotype exists when there are two distinct versions. Thus, option C is correct.

What is the particular trait for heterozygous organism?

When two distinct alleles of a gene (one mutant allele and one wild-type allele) are present in a diploid organism's cells, that organism is said to be heterozygous at that particular gene locus.

Heterozygosity describes a particular genotype, since the cell or organism is referred to be a heterozygote just for the particular allele in question.

The heterozygote may, however, occasionally have a phenotype that is somewhere between the phenotypes of both homozygous parents.

Therefore, has different alleles on the chromosomes in a chromosome pair.

Learn more about heterozygous here:

https://brainly.com/question/29327683

#SPJ2

True or false the main source of energy and water cycle is gravity

Answers

Answer:

False please mark me brainlest.

Explanation:

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

In a series of rock layers, where do you find the oldest layers? Explain why?
Your answer
Please helppp meh!!

Answers

Answer:bottom

Explanation:

Why do the cells used for reproduction only have half (½) of the DNA that other cells have?

Answers

Answer:

Because each chromosome has a pair, these cells are called "diploid" cells. On the other hand, human sperm and egg cells have only 23 chromosomes, or half the chromosomes of a diploid cell.

Explanation:

What abiotic factors might affect a population of fish? Check ALL that apply.

clear water
light
temperature
food

Answers

Answer:

Clear water, light, and tempature.

Explanation:

A plant or animal that carries a disease or parasite during part of its life cycle is called a(n):

Answers

Answer:

it could probably be host

Answer:

A plant or animal that carries disease or parasite during part of its life cycle is called a host

I HOPE IT HELPS ❤❤

The energy related to the motion of an object is called ___.

Answers

Answer:

The answer is  kinetic energy

Explanation:

Kinetic energy is the correct answer

Which natural resource is nonrenewable?

sunlight


sugarcane


oil or petroleum


corn​

Answers

Answer:

There are four major types of nonrenewable resources: oil, natural gas, coal, and nuclear energy. Oil, natural gas, and coal are collectively called fossil fuels.

The natural resource is nonrenewable oil or petroleum is a carbon primarily based totally gasoline .

What are nonrenewable resources?

There are 4 essential varieties of nonrenewable resources: oil, herbal gas, coal, and nuclear energy.

Oil is a carbon primarily based totally gasoline that bureaucracy while plant and animal stays are uncovered to intense situations which include excessive pressure (eg below a dust layer on the sea floor.) for hundreds of years. Therefore the oil we use these days took millennia to form.

Read more about oil here:

https://brainly.com/question/25614315

#SPJ2

What is the role of enzymes in the DNA replication process?
A. Enzymes read the DNA code and build a new DNA molecule from scratch.
B. Enzymes link together to form a template for a new DNA molecule to be built.
C. Enzymes split the DNA molecule into two rails and then transport corresponding nitrogenous bases to each rail.
D. Enzymes link adjacent nucleosides together, becoming an integral part of the structure of the new strands of DNA.

Answers

Answer:

B.

Explanation:

10. Modern telescopes make it possible for astronomers to detect planets around distant stars. Why couldn't
astronomers detect these planets before?
A. The planets are much closer than the stars they orbit.
B. The planets are much larger than the stars they orbit.
C. The planets are much farther than the stars they orbit.
D. The planets are much smaller than the stars they orbit.

Answers

Answer:

I would Say the answer is D

Explanation:

Answer:

I I think it’s D

Explanation:

D the planets are much smaller than the stars they orbit.

Please help I'm behind

Answers

Answer:

B : Barometer

Explanation:

A barometer is a scientific instrument used to measure atmospheric pressure, also called barometric pressure. The atmosphere is the layers of air wrapped around the Earth. That air has a weight and presses against everything it touches as gravity pulls it to Earth. Barometers measure this pressure.

5. Why might a cell need to phagocytose?

Answers

Answer:

Phagocytosis is a critical part of the immune system. ... By knowing the enemy, the cells of the immune system can specifically target similar particles circulating in the body. Another function of phagocytosis in the immune system is to ingest and destroy pathogens (like viruses and bacteria) and infected cells.

Explanation:

Other Questions
how old am i if 200 reduced by 2 times my age is 18 8 percent as a fraction or mixed number in simplest form Please Help ASAP!! PLEASE HELP The vertex of this parabola is at (-2, 1). Which of the following could be itsequation? 38. Which ordered pair is a solution to theequation y = 2 - x? a) (5,3)b) (8,10)c) (-1,1)d) (-5,7) Use the right triangle shown to answer the question.2632*not drawn to scaleWhat is the approximate value of x? the sum of three numbers is 133. the third number is 4 times the second. the second number is 5 more than the first. 25 points+ brainliest Which of the following is a compound?GoldSilverCarbon DioxideLead some please help! lot of points! Which type of triangle is this? What is equivalent to 5(x + 12)A x +12B 2x - 60C 5x + 60D 2x - 60 -5(t + 3)= -30Solve for the variable!! Please What are the six segments of the travel Industry? Give examples of each. The corners of a square are cut off two centimeters from each corner to form an octagon. If the octagon is 10 centimeters wide, what is its area?can't be determined84 cm 292 cm 2100cm 2asap What is the empirical formula of C 6 H 18 O 3 ? 6. What charge is in the nucleus?a. negative chargeb. positive chargeC. no charged. positive and negative charges What do 4 things do governments provide their citizens? which is NOT part of the cell theory? A) all living thing a are composed of cellsB) Cells are the building blocks of germsC) All cells come from other cellsD) Cells are the basic units of structure and function in living things 1. If the original price of an item was 75 cents and the new price is 81 cents, 1 pcwhat is the percent change? (MAKE SURE YOU TYPE % AT THE END OFYOUR ANSWER) *Your answer Which is held constant when a gas obeys Boyle's law?A. motionB. pressureC. temperatureD. volume