The correct answer will get Brainliest!
Calculate the diversity of the community below using Simpson's diversity index. Provide your answer to the nearest hundredth.
An area of the black forest in Germany contains 134 pitch pines, 24 Douglas firs, and 53 red pines.

Answers

Answer 1

Answer:

Diversity of the community = 2.097

Explanation:

Given:

Number of pitch pines = 134

Number of douglas firs = 24

Number of red pines = 53

Find:

Diversity of the community

Computation:

Simpson's diversity index = N(N-1)/Σn(n-1)

Particular              n n(n-1)

Pitch pine         134       17822

Douglas firs       24 552

Red pine            53  2756

Total       N=211 21130

So,

D= [211(211-1)] / 21130

D = 2.097

Diversity of the community = 2.097

Answer 2

The diversity of the community below using Simpson's diversity index. Provide your answer to the nearest hundredth is 2.097.

diversity of the community = N(N-1)

N= 21121130no. of

d= 2.097

What is Simpson's diversity index.?

It is a measure of index that has diversity which takes into no. species.Itis calculated by nxn-1.

Ths it is well explained.

To know more about the Simpson's diversity index refer link ;

https://brainly.com/question/19878450


Related Questions

Structure number 2 is the_______
and most like the______
system
in the human body because it________.

Answers

Answer:

Structure number 2 is the nucleus  and most like the nervous  system  in the human body because it controls and regulates the cell much like the nervous system does

Explanation:

How do Earth's spheres interact as systems, both within each sphere and with other spheres?

Answers

Answer:

All the spheres interact with other spheres. For example, rain (hydrosphere) falls from clouds in the atmosphere to the lithosphere and forms streams and rivers that provide drinking water for wildlife and humans as well as water for plant growth (biosphere). ... water evaporates from the ocean into atmosphere.

A plant growing in an area where it is not required is called?

Answers

Answer:

weed(s)

Explanation:

it’s a plant that is out of place, undesirable, or an annoyance because it interferes with agricultural or animal production.

hope this helped!

Describe how decomposers link the living and non-living parts of an ecosystem

Answers


Decomposers are living organisms that breaks down other living and non-living things into smaller parts.

Decomposers can recycle dead plants and animals into chemical nutrients such as carbon and nitrogen that are released back into the soil, air and water as food for living plants and animals.
Decomposers are living organisms that breaks down other living and non-living things into smaller parts. ... Decomposers can recycle dead plants and animals into chemical nutrients such as carbon and nitrogen that are released back into the soil, air and water as food for living plants and animals.

Decomposers play a critical role in the flow of energy through an ecosystem. They break apart dead organisms into simpler inorganic materials, making nutrients available to primary producers.

Decomposers, such as bacteria, fungi, termites, and earthworms, are scavengers that feed on the organic material found in dead producers and consumers. They break down the organic material to the nutrient level. Nutrients in soils are essential for producers to grow. Nutrients include nitrogen, carbon, and phosphorous. Thus, dead consumers (and producers) are recycled back into new producers.

The average amino acid length of proteins in Escherichia coli is 235. Therefore, according to the video, the elongation time for an average E. coli protein would be about _______seconds.
How is the small ribosomal unit positioned to allow for translation to start at the proper start codon?Choose one:
A. Shine-Dalgarno sequence
B. The start codon sequence is specifically attracted to the P site.
C. Initiation factors position the mRNA accordingly.
D. The small ribosomal subunit starts at the far 5' end of mRNA where the start codon is located.

Answers

Answer:

approximately 15 seconds

A. Shine-Dalgarno sequence

Explanation:

In Escherichia coli, it has been shown that the translation elongation rate is approximately 16 amino acids per ribosome per second (16 x 15 = 240). On the other hand, the Shine-Dalgarno sequence is a polypurine stretch of variable length present in prokaryotic cells and acts as a ribosomal binding site for the messenger RNA (mRNA). This sequence can base-pair to a complementary sequence known as the 'anti-Shine-Dalgarno sequence' at the 3' end of the bacterial 16S rRNA subunit and is required to initiate the process of translation by which a polypeptide chain is synthesized. Generally, the Shine-Dalgarno sequence is located from 10 to 8 nucleotides upstream of the start codon (AUG codon). In E. coli, the Shine-Dalgarno sequence is AGGAGGU.

How are phone numbers in a phone book classified? When you are looking for someone's phone number , do you have to look through everybody's name to tind the number?

Answers

Answer:

There are usually categories for names and the categories are sorted in alphabetical order. But nowadays phone books only are used for businesses and all that

A river is being polluted with fertilizer
runoff from a neighborhood of houses.
This is considered
A. point source pollution
B. nonpoint source pollution
C. heavily regulated water pollution
D. illegal

Answers

B. Non-point source pollution

i. Identify the potential sources of land, water, and air pollution in your locality.
ii. As a responsible citizen, frame a policy to reduce pollution.​

Answers

Answer:

F yo 0 più 4 iijswfo6d4fgs6 ljtik

Definition: This is the gas produced as a result of respiration.
Example: CO2
Hello me ASAP

Answers

Answer:

carbon dioxide

Explanation:

Carbon dioxide. Hope this helps.

Which of the following statements is not true?\
A. Water is essential for life.
B. Water stabilizes temperature.
C. Water is polar.
D. Water is the most abundant atom in Earth’s atmosphere.
E. Water and ice vary in density.

Answers

Answer:

D. Water is the most abundant atom in Earth’s atmosphere.

Explanation:

An atom can be defined as the smallest particle of an element (e.g., oxygen, hydrogen, etc). Water is a molecule (H2O) because its atoms are connected by molecular bonds (i.e., water is not an atom). Water is the most abundant molecule on the Earth's surface which covers more than 70 percent of the world's surface. A water molecule contains one oxygen (O) and two hydrogen (H2) atoms which are connected by covalent bonds. Water is also a compound known as a diatomic molecule, i.e., a molecule composed of two atoms of the same type.

The nervous system interacts with the endocrine system by ____.

A. sending neurotransmitters to endocrine target cells

B. sending neurotransmitters to neuroendocrine cells

C. translating messages from endocrine cells

D. receiving messages from hormones

Answers

Answer: D. Receiving messages from hormones.

Explanation:

I would definitely go with D as it seems to be the most logical answer

16.Which part of your nervous system controls the involuntary actions like how and when your stomach goes through mechanical digestion?

Answers

Answer:

Autonomic nervous system

Explanation:

Ta bien mi respuesta •w•'''' ?

Answers

Answer:

yes

Explanation:

that is the answer I think so.


Community interactions among species include which of the following?
O prey species
O assistance to other species
O parasitism
O all of these choices

Answers

Answer:

D. all of these choices

Explanation:

This is because the community is made up of different types of organisms, not just one. Therefore, its D.

describe how a jump rope could be used to model the cell membrane of a plant cell

Answers

Answer:

Due to its thin width and elasticity.

Explanation:

A jumping rope could be used to model the cell membrane of a plant cell because of their elasticity that acts like cell wall or cell membrane of the cell. Just like a cell wall or cell membrane which is the outer covering is thin in width and has the ability to elasticity so the jumping rope is also used in the model due to its elasticity and thin width so that's why we can used it in the cell model.

A researcher speculates that an enzyme has the following energy profile and that it is a reasonable profile given what we know about enzyme behavior. Enzyme bound to Substrate: -7.00 kcal/mol Enzyme bound to Product:-10.00 kcal/mol Enzyme in transition state:-5.00 kcal/mol
a) True
b) False

Answers

Explanation:

TRUE MAY BE

HOPE IT HELP U

Which of the following is a concern if you forgot to resuspend (mix) culture solutions when performing serial dilution?
A) Bacteria would no longer be able to grow on solid media
B) CFU/mL calculations would not be accurate
C) Colony morphology would be disrupte
D) The pure culture would be contaminated

Answers

Answer:

B) CFU/mL calculations would not be accurate

Explanation:

In microbiology CFU is the acronym for Colony Forming Unit, which indicates the number of bacteria or fungi capable of multiplying under suitable conditions. In this case, CFU/mL indicates how much bacterial or fungal cells, susceptible to reproduction, exist within 1 mL of a culture solution.

When this solution is used, to make a dilution or other laboratory activity, it is important that it be resuspended, that is, mixed, as the bacteria or fungus cells can accumulate in the bottom or surface of the substance, changing the value of CFU/mL and causing inaccurate dilutions if used. When resuspended, the substance presents the appropriate value of CFU/mL, ensuring that the dilution is accurate and effective.

Why do you think the parts of the body have different sensitivities? Write an argument to support your explanation.​

Answers

The four senses of sight, hearing, smell, and taste are located in specific parts of the body.

The sense of touch is located throughout the body, in your largest organ, the skin. The sense of touch originatees in the bottom layer of your skin called the dermis.

The dermis is filled with many tiny nerve endings that give you information about the things your body is touching. Nerve endings do this by carrying the information to the spinal cord, which sends messages to the brain where the feeling is registered.

The nerve endings in your skin can tell you if something is hot or cold. They can also feel if something is hurting you. Your body has about twenty different types of nerve endings that all send messages to your brain. However, the most common receptors are heat, cold, pain, and pressure or touch receptors. Pain receptors are probably the most important for your safety because they can protect you by warning your brain that your body is hurt.

Some areas of the body are more sensitive than others because they have more nerve endings. It hurts when you bite your tongue because the sides of your tongue have a lot of nerve endings that are very sensitive to pain. Your tongue, however, is not as good at sensing hot or cold. That is why it is easy to burn your mouth when you eat something really hot. Your fingertips are also very sensitive. People who are blind use their fingertips to read Braille by feeling the patterns of raised dots on their paper.

In the population of plant K, each plant has only red flowers or only white flowers. A farmer collected the seeds from plant K with red flowers to grow new plants. Explain why the new plants will have only red flowers

Answers

Answer:

nose

Explanation:

nosenosenosenosenosenosenosenosenosenosenose

The new plants will have only red flowers because the trait for red flowers is determined by a dominant gene, and all the plants in population K have the same homozygous genotype for the flower color.

In genetics, the flower color trait in population K is determined by genes present in the plants' DNA. There are two alleles, or gene variants, for the flower color: one for red flowers (let's call it R) and one for white flowers (let's call it r). The gene for red flowers (R) is dominant, meaning that even if only one copy of the gene is present in an individual's genotype (heterozygous), it will produce the red flower phenotype. On the other hand, the gene for white flowers (r) is recessive, which means it will only produce the white flower phenotype if two copies are present in the genotype (homozygous recessive).

In population K, all the plants have only red flowers, indicating that they must have the genotype RR. Since all the plants are homozygous for the dominant red flower gene (RR), when they reproduce, they can only pass on the dominant allele R to their offspring. As a result, all the new plants that grow from the seeds collected from these plants will also have the genotype RR and, therefore, express the red flower phenotype.

Since there are no plants in population K with the genotype rr (homozygous recessive), which is necessary for white flowers, there is no chance of white-flowered plants appearing in the new generation. Thus, the new plants will have only red flowers due to the uniformity of the homozygous dominant genotype in the original population.

To learn more about population, here

https://brainly.com/question/15889243

#SPJ2

please help very easy 5th grade work giving brainliest

Answers

Answer:

pretty sure its A hope this helps!

Answer:

A

Explanation:

because fuels are used to produce electricity from solar energy

describe the energy transfer between water molecules occurring as water moves in the ocean.​

Answers

Explanation:

Mark me as brainliaste

Then I will give you answer

Describe the metabolic pathways in the monarch butterfly that take advantage of milkweed nectar to convert it into an energy currency.

Answers

Answer:

Metabolic pathways in monarch butterflies are as follows:

GlycolysisKreb's cycleOxidative phosphorylation

Explanation:

They convert sugar which they obtain from nectar into fats that they store as source of energy. Monarch have a little layer of fatty tissues which aid in conversion of Sugar in to fat.

They consume the stored fat during reproduction. A lot of fat is eventually converted to eggs and some of it is used to provide energy just to sustain the reproductive butterflies.

During winter season, when their metabolic is low they consume energy by converting stored fat into sugar called Trehalose.  The conversion of fat also releases little water which help them to survive during winter.

1) Glycolysis:

Glucose is phosphorylated by hexokinase enzyme to give glucose-6phosphate. This glucose-6-phosphate enters into glycolysis and is broken down into two molecules of pyruvate in a series of ten reactions. During glycolysis net two molecules of ATP are synthesised per glucose molecule. Moreover, two molecules of NADH+H+ are also synthesised. In aerobic organisms like monarch butterfly the pyruvate is again oxidised to give acetyl-CoA in the mitochondria. The enzyme responsible for this oxidation is Pyruvate Dehydrogenase Complex. This reaction occurs in the mitochondrial matrix. Here one CO2 molecule is removed from the pyruvate and one NADH is produced.

2. Kreb's Cycle:

The acetyl-CoA formed enters into the Kreb's cycle by condensing with oxaloacetate. In Kreb's cycle acetyl-CoA is completely oxidised to give carbon dioxide in eight enzymatic reactions. During Kreb's cycle NADH, FADH2 and one molecule of GTP is produced and oxaloacetate is regenerated to continue the cycle.

3. Oxidative Phosphorylation:

The NADH produced in the glycolysis and Krebs cycle and FADH2 produced during Krebs cycle are now oxidised to generate proton gradient across the inner mitochondrial membrane. This gradient is generated when the electrons from the reduced NADH and FADH2 are transported in the electron transport chain(ETC), and are finally accepted by the oxygen.

When the electrons are picked up by the complexes of the ETC they pick protons from the matrix. When the electrons are transferred to next complex the protons are transferred to the inter-membrane space. In this way a proton gradient is generated across the innner membrane of the mitochondria.

This proton gradient is used by the complex V of the ETC. This complex is the enzyme ATP Synthase. This enzyme complex is located in the inner mitochondrial membrane. When the protons flow back from the inter-membrane space into the matrix along the concentration gradient , they move through the channel in the ATP Synthase Complex. When these protons flow through this complex it catalyzes the phosphorylation of ADP to give ATP, the energy currency.

The fructose component of the sucrose is first converted into glycogen and then broken down to give glucose-1-phosphate, which enters into glycolysis.

Sucrose cannot enter the pathway of glycolysis as such. It is first hydrolysed to glucose and fructose as described above along with the path way.

Given the following cross TtYyRr x TtyyRr (T = tall; t = short Y = yellow; y = green R = round; r = wrinkled), what proportion of offspring would be expected to be short plants with round, green seeds. Write your answer as a reduced fraction - e.g. 1/2 proportion is

Answers

Answer:

3/32 ttyyR-  

Explanation:

Cross: Tall, Yellow, Rounded individuals with a tall, green, rounded individual

Parentals) TtYyRr      x      TtyyRr      

Gametes) TYR, TyR, TYr, Tyr, tYR, tyR, tYr, tyr (Parent one)

                 TyR, TyR, Tyr, Tyr, tyR, tyR, tyr, tyr (Parent two)

We need to know what proportion of offspring is expected to be short plants with round, green seeds. So we need to identify the gametes for these traits. The genotypes are:

Shot → ttRound → RR or RrGreen → yy

⇒ Parent one can provide gametes tyR and tyr

⇒ Parent two can provide gametes tyR and tyr

(1/8 tyR x 2/8 tyR) + (1/8 tyR x 2/8 tyr) + (1/8 tyr x 2/8 tyR) =

2/64 ttyyRR + 2/64 ttyyRr + 2/64 ttyyRr =

1/32 ttyyRR + 2/32 ttyyRr =

3/32 ttyyR-          

The branch of science which deals with the gene and inheritance is called biology.

The correct answer is 3/32.

When a parent has 3 characters and crosses with other parents which have a 3 character is called a trihybrid cross.

In this question, the genotype of the parent is given as follows:-

Mother - TtYyRrFather - TtyyRr

The gametes formed by the parents is as follows:-

TYR, TYr, TyR, Tyr,  tYR, tYr, tyR, tyr is gamete of motherTYR, TYr, TyR, Tyr,  tYR, tYr, tyR, tyr is gamete of father.

According to the law of inheritance it stated that the each gamete can fused with any gamete to increase the chances of variation.

Hence, after the crossing the number of offspring will form is 32.

Therefore the offspring which has a short plant with a round green seed is 3/32.

Hence, the correct answer is 3/32.

For more information, refer to the link:-

https://brainly.com/question/12985618

A man with O type blood marries a woman with AB type blood. What are the possible blood types of their offspring?
(Set up a Punnett square for an O and AB blood type)

-What is the probability that the offspring will have ..

a. O blood?

b. A blood?

c. B blood?

d. AB blood?

Answers

P(O blood)= 0

P(A blood) = 2/4= 1/2

P(B blood) = 1/2

P(AB blood)= 0

i = recessive Gene

IA = dominant Gene

IB = dominant gene

B. A blood. Cause the women is AB while the man is O, O being the top tier blood could only boost it to A blood

Lactobacillus in yogurt, some Escherichia coli in the intestines of humans and animals, and Rhizobium that fixes atmosphere nitrogen are all considered beneficial bacteria. Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a True b False

Answers

Answer: a. True.

Explanation:

Lactobacillus is a genus of gram-positive, facultative or microaerophilic bacteria that produce lactic acid. They are normally found in different parts of the body such as the mouth, digestive tract and vagina. Lactobacilli usually do not cause disease, although they can cause dental caries. Some lactobacilli have a homofermentative metabolism, that is, they produce lactic acid from sugars, which makes their environment acidic and inhibits the growth of pathogenic bacteria. Some species of Lactobacillus are used in the industry for the production of yogurt, cheese and other fermented foods.

Escherichia coli is a bacterium that is part of the microbiota of the gastrointestinal tract of various animals. It is a gram-negative bacillus, facultative anaerobe, and the most abundant commensal of the microbiota of the gastrointestinal tract where, together with other microorganisms, it is essential for the correct functioning of the digestive process. It also participates in the production of B and K vitamins.

Rhizobium is a genus of gram-negative soil bacteria that fix atmospheric nitrogen and live in symbiosis with certain plants (such as leguminous plants) in their roots, after a process of infection induced by the plant itself through the secretion of lectin, to which they provide the nitrogen necessary for the plant to live and which in return gives it shelter. Fixation is the combination of molecular nitrogen (N2) with hydrogen or oxygen to give ammonium or oxides that are incorporated into the biosphere. Molecular nitrogen, which is the major component of the atmosphere, is inert and not directly usable by most living things. Therefore, it involves the incorporation of a significant amount of nitrogen into the biosphere.

Therefore, all three are considered beneficial.

how are seasons in the northern hemisphere related to seasons in the southern hemisphere?

Answers

Answer: In the Northern Hemisphere, the seasons are the polar opposite of those in the Southern Hemisphere.

Explanation: As a result, winter in Argentina and Australia begins around June. In the Southern Hemisphere, the winter solstice occurs on June 20 or 21, while the summer solstice, the longest day of the year, occurs on December 21 or 22.

hope this helps good luck mate! :)

Answer:

Reveresd.

Explanation:

Northern/Southern

Summer/Winter

Fall/Spring

When it is summer in the northern it is winter in southern. After that the northern goes into fall while the southern goes into spring.

What is Bt Cotton. Explain its mode of action.

Answers

Answer:

Bt cotton is a genetically modified organism (GMO) or genetically modified pest resistant plant cotton variety, which produces an insecticide to combat bollworm.

You are digging in a desert in the mountains and find fossil imprints of ferns. Based on this which type of environment did the mountain used to be?

Answers

Answer:

The environment was probably a moist and shady forest, like a rain forest. This is the most suitable condition for ferns to grow in.

Photosynthesis occurs with the help of
A. CO2 and Water
B. SO2 and water
C. Oxygen and CO2
D. Oxygen and water​

Answers

Explanation:

(A) = Carbon dioxide and water. Because, photosynthesis is the process by which green plants manufacturer their food by combining water and carbon dioxide in the process of sunlight energy trapped by chlorophyll to produce carbohydrate and released oxygen. from the above definition we see that, Photosynthesis cannot occur without water and carbon dioxide present

Why does organic plant remains best describes coal?

Answers

Coals are the most abundant organic-rich sedimentary rock. They consist of undecayed organic matter that either accumulated in place or was transported from elsewhere to the depositional site. The most important organic component in coal is humus. Is correct

Answer:

what he/she said

Explanation:

Other Questions
Peter work three more days than jill. Peter earn $20 day jill earn $40 day. But they earned the same amount of money Which of the following is an equivalent trig ratio for tan 28Cos 621/ tan 621/ tan152Cos 28 The answer choices are spelling rules about what to do before adding suffixes to a base word that ends in a consonant. Identify the rule that was applied to the word below.benefit + -ingDo not double the final consonant if the suffix begins with a consonant.If a base word has three or more syllables, do not double the final consonant.If a base word ending in one consonant has two syllables, and the second syllable gets the accent, double the final consonant.If a base word ends in more than one consonant, just add the suffix without changes.If a base word has only one syllable and ends in one consonant, double the final consonant.If a base word ending in one consonant has two syllables, and the first syllable gets the accent, do not double the final consonant. two types of global food webs show the feeding relationships of organsms. What distinguishes one type of global web from the other?A whether the producers are located on land or in waterB whether or not the food web includes tertiary consumersC whether the web includes animals that migrate during the yearD whether the ecosystem described by the web is localized or very broad two particles woth each charge magnitude 2.010^-7 c but opposite signs are held 15cm apart.what are the magnitude and direction of the electric field E at tge point midway between charges Subordinate Conjunctions make a _______ clause not be able to stand on its own. PLEASE HELPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP please help please help the tRNA for GUCAUCGAUCGAUCGGAUGCC A red light flashes every 6 seconds A yellow light flashes every 4 seconds They both flash at the same time.After how many seconds will they next both flash at the same time? The radius of a right circular cone is increasing at a rate of 1.1 in/s while its height is decreasing at a rate of 2.6 in/s. At what rate is the volume of the cone changing when the radius is 107 in. and the height is 151 in. The elements in a long array of integers are roughly sorted in decreasing order. No more than 5 percent of the elements are out of order. Which of the following is the best method to use to sort the array in descending order?I. Insertion sort.Il. Merge Sort.III. Heap Sort.a. Ill only.b. I only.c. II and III only.d. I and II only.e. Il only I and.f. Ill only. Help please I asp !!! For A = R + PRT/100 make P the subject. 1. What are metabolic wastes?2. Which are the main organs of the excretory system? please help me with this The practice of selling indulgences troubled many Catholics because the practice made it seem like? Which sentence in the paragraph is structured differently than the others? Which territory did the Mongol Empire conqueror after Genghis Khan's death Because Japan felt disrespected by the provisions of the Treaty of Portsmouth, it would most likely lead Japan toA. an increase in aggressive imperialism.B. a desire to reclaim Manchuria from China.C. eventual revenge against the country of Russia.D.lack of trust in the US and future negotiations with it.Could someone help me with this question? Im kinda stuck with it Which statement about the mass and the weight of an object is correct?A They are both affected by changes in the acceleration of free fall.B They are both forces.C They have different units.D Weight is calculated by dividing mass by the acceleration of free fall.