The data on price and quantity purchased relating to a commodity for 10 months are given
below:Calculate coefficient of correlation between price and quantity.

Answers

Answer 1

Price and number of goods purchased are inversely correlated. Consequently, price rises as quantity rises.

What is data on price ?

Pricing Data is accurate information on the costs of goods that are strikingly comparable to those being purchased. Prices are used interchangeably in this definition to refer to actual selling prices as well as suggested or prospective selling prices. Data pertinent to both primary and subcontract prices are referred to in the definition. Data may consist of specific costs, weights, addresses, names, ages, temperatures, dates, or distances, for instance. Data is a basic type of knowledge and has no meaning or use by itself. In other words, facts must be interpreted in order to have any significance. A pricing list again for new term has been sent by the Contractor to authorized buyers.

To know more about data on price visit:

brainly.com/question/29310320

#SPJ1


Related Questions

Spending on testing a product before shipment to customers is which type of quality cost? a. External failure cost b. Prevention cost C. Appraisal cost d. None of the above

Answers

The correct response is C. Appraisal cost. Costs associated with finding defective goods before they are delivered to customers. Additionally, they are known as "Inspection Costs."

Expenses linked with actions taken specifically to stop subpar product quality are referred to as prevention costs. Expenses related to actions especially created to gauge, examine, assess, or audit items in order to ensure compliance with quality standards are referred to as appraisal costs. It is a procedure for evaluating a product's performance, design, and acceptability for use in water and sewer infrastructure at a specified performance level. Costs for evaluating and keeping track of the calibre of goods and services purchased fall under the category of appraisal costs. This entails quality audits, examining and rating suppliers, and inspecting the supplied goods. So these are the clear expenses related to supply chain quality.

Learn more about Appraisal cost here

https://brainly.com/question/29969846

#SPJ4

A veteran desired a loan to buy a 200 acre residence. There are no VA lenders in the area. Which could happen

Answers

A veteran needed a loan to buy a 200-acre farm. There have been no VA lenders inside the neighborhood then The VA might loan the money self.

Money is any thing or verifiable record that is usually accepted as payment for services and goods and repayment of debts such as taxes, in a specific country or socioeconomic setting. Money serves as a medium of commerce, a monetary unit of account, a value store and, on occasion, a standard of postponed payment. Money was originally an emergent market phenomena having inherent worth as a commodity; practically all modern money systems are built on unbacked fiat money with no use value. Its worth is consequently established by social norms, having been proclaimed legal tender by a government or regulating organization; that is, it has to be accepted as a payment method inside the country's borders.

Learn more about method here

https://brainly.com/question/29741213

#SPJ4

What is the most important factor in giving service to the client?

Answers

Having a good understanding of the product and company is important for providing excellent customer service.

What are the importance in service?Customers that receive excellent service are more likely to return and spend more money with you in the long run. That's wonderful news for your financial situation. 50% of customers boost their spending with a brand after having a satisfying experience there.The key to excellent customer service is empathy. The greatest approach to convey to your consumers that you appreciate their business, care about their difficulties, and take their worries seriously is to listen to them when they call. Customer interactions can be made memorable by fostering empathy among support workers.Understanding and being able to detect other people's emotions is called empathy. It basically involves placing yourself in the client's emotional situation. The most crucial customer service talent, according to many, is empathy.

To learn more about service refers to:

brainly.com/question/1286522

#SPJ4

For a fee, a real estate licensee offers a mortgage company the names and telephone numbers of all of the people who attended an open house, but the mortgage company does not accept the offer. Who is in violation of RESPA

Answers

Both the real estate licensee and the mortgage company could potentially be in violation of RESPA

Both the real estate licensee and the mortgage company could potentially be in violation of RESPA (Real Estate Settlement Procedures Act) if the fee being offered for the names and telephone numbers of the open house attendees is considered a kickback or referral fee. Under RESPA, it is illegal for real estate licensees and mortgage companies to give or receive any fee, kickback, or thing of value for the referral of business related to a federally related mortgage loan. Therefore, if the fee being offered for the names and telephone numbers is considered a referral fee, both the real estate licensee and the mortgage company could be in violation of RESPA.

Know more about RESPA - https://brainly.com/question/30145347

#SPJ4

What is the importance of insurance to an individual?

Answers

The importance of insurance is that it provides financial security in the event of an unexpected illness, injury, or loss.

Insurance can protect you from the financial burden of medical bills, property damage, and other unforeseen expenses.

It can also provide peace of mind, knowing that you and your family are protected in the event of an accident or disaster. With the right insurance coverage, you can have the assurance that your family will be taken care of in the event of a tragedy.

Insurance also helps protect your hard-earned assets, ensuring that you and your family will be financially secure should unforeseen circumstances arise. Investing in the right insurance can provide you with the protection and peace of mind you need to live a life of financial security of an individual.

To learn more about insurance, click here:

https://brainly.com/question/25855858

#SPJ4

What are measurements that evaluate results to determine whether a project is meeting its goals? Multiple Choice BPMN turnover best practices metrics

Answers

Metrics are metrics that assess outcomes in order to ascertain if a project is succeeding in its objectives.

KPIs are the measurable measures that a business employs to assess advancement toward important success elements. KPIs are far more detailed than CSFs; examples include staff turnover rates, the proportion of help desk calls handled within the first minute, and the quantity of returned goods. A project, according to PMI, is a brief undertaking made to provide a special good, service, or outcome. A project is transitory since its scope and resources are predetermined, and its start and conclusion dates are fixed in time. An As-Is process model's main objective is to streamline, do away with, and enhance the To-Be processes. Switching fees and loyalty programmes are two strategies for reducing buyer power.

To learn more about Metrics click the link below:

brainly.com/question/24248807

#SPJ4

What is the difference between a secured and unsecured?

Answers

Secured loans require you to put up a valuable item as security in the event that you are unable to pay back the loan, whilst unsecured loans allow you to borrow the full amount.

secured loan definition.

Loans that must be secured by some sort of collateral, whether for company or for personal use, are known as secured loans. When making large loans or loans when the credit score is insufficient to qualify for an unsecured loan or when the money is being used to buy a specific asset, a bank or lender may ask for collateral. Due to the reduced risk that secured loans pose to lenders, they may qualify borrowers for cheaper interest rates. However, some varieties of secured loans, such as short-term installment loans and personal loans for people with bad credit,

To know more about loans visit: https://brainly.com/question/30006301

#SPJ4

If Japan were regarded as the best electronics manufacturer in the world, what would be true?
a. The United States would have a comparative advantage in electronics.
b. Japan would have an absolute advantage in electronics production.
c. Japan would have a positive balance of trade.
d. Japan would have a comparative advantage in electronics manufacturing.
e. Japan would have a trade deficit with the United States.

Answers

Japan would have an absolute advantage in electronics production in the given case.

Hence, Option B is correct

Japan is an East Asian island nation. It is located in the northwest Pacific Ocean and is bordered by the Sea of Japan on the west. The Sea of Japan stretches from the Sea of Okhotsk in the north to the East China Sea, Philippine Sea, and Taiwan in the south approvals, field preparations required to carry out the procedure.

Japan is still one of the world's top 15 most innovative nations. With one of the highest per capita R&D expenditures and a large number of innovative companies, Japan is also home to the most innovative cluster in the world, Tokyo-Yokohama, which is ranked first overall for the second year in a row.

To know more about Japan here

https://brainly.com/question/510537

#SPJ4

In 1990, those who invested money in fund Z for the entire year received a return of 9 percent on their investment. Roberta invested a certain amount in fund Z on January 1, 1990, and neither added to nor subtracted from her investment during the year; her investment and return for the entire year equalled $15,260. How much money did Roberta invest in fund Z on January 1, 1990

Answers

In 1990, those who invested money in fund Z for the entire year received a return of 9 percent on their investment. Roberta invested a certain amount in fund Z on January 1, 1990. Robert invested $14,000 in fund Z.

It is seen that the investment after entire year was $ 15,260 and the interest rate is given as 9%. We know that,

Amount = Principal * (100+ interest rate)/100

15,260 = Principal * (100+ 9)/100

15260 = Principal *109/100

Principal = 15260 *100/109

Principal = 14,000

Hence, the initial amount invested is $14,000.

An investment fund is a pool of money owned by several people that is used to buy securities as a group although each investor has ownership and control over his individual shares.

In comparison to what an investor might be able to find on their own, an investment fund offers a wider range of investment choices, more management experience, and lower investment fees. Mutual funds, exchange-traded funds, money market funds, and hedge funds are a few different types of investment funds.

To know more about investment fund:

https://brainly.com/question/29972619

#SPJ4

In which of the following will equilibrium prices will spontaneously establish themselves, persisting until the forces of supply and demand change

Answers

The competitive market is the one wherein the equilibrium prices tend to spontaneously establish themselves, while also persisting until the forces of supply and demand are affected by the changes.

A competitive market can be easily interpreted as a type of market structure, which includes a number of buyers as well as sellers without many restrictions being imposed for their entry and exit from the market. Due to equal forces of demand and supply, there is usually an equilibrium in the market prices in such an economy where competition exists.

Learn more about competitive market here:

https://brainly.com/question/29407851

#SPJ4

Complete question

In which market structures will the equilibrium prices will spontaneously establish themselves, persisting until the forces of supply and demand change?

____________________ pays health-care providers a fixed monthly fee for a range of services for each HMO member in their care.

Answers

Capitation  pays health-care providers a fixed monthly fee for a range of services for each HMO member in their care.

A type of health insurance plan that, in most situations, restricts coverage to medical services provided by staff members of the HMO or staff members with whom it has a contract. Unless it is urgent, out-of-network care is frequently not covered. You might need to reside or work within an HMO's service region to qualify for coverage.

Preventive care and general patient welfare are given top priority by a health maintenance organization, which also aims to keep costs low for its members by only covering in-network providers and facilities.

To know more about HMO visit :

https://brainly.com/question/5443980

#SPJ4

holds that unhindered free-enterprise economic markets and individual enterprise can solve economic and social problems such as poverty

Answers

Conservatives believe that unhindered free-enterprise economic markets and individual enterprises can solve economic and social problems such as poverty.

What are Economic Markets?

An economic system in which the majority of resources are owned by individuals rather than the government is known as a market economy. Capital, labor, and land are all part of this. In a market economy, individuals decide for themselves how to use these resources and how much they cost.

The following are characteristics of a market economy: The economic system is based on supply and demand. The demand and supply of a good or service determine the quantity produced. Traditional, command, market, and mixed economies are the four types of economies.

The economy can be divided into three main categories: command, free market, and mixed The following chart contrasts command and free-market economies; The two are combined in mixed economies. Economic decisions are made by both individuals and businesses on their own.

To know more about Supply and Demand, visit:

https://brainly.com/question/17069873

#SPJ4

The question as follows:

____ believes that unhindered free-enterprise economic markets and individual enterprise can solve economic and social problems such as poverty.

One way that marketing mix characteristics differ for organizational buying compared to consumer buying is that for organizational buying Multiple Choice direct selling is avoided. list price is considered firm. advertising and other promotions are technical in nature. distribution is of negligible importance. product quality is assumed among sellers and is rarely a buying criteria.

Answers

One way that marketing mix characteristics differ for organizational buying compared to consumer buying is the price is often negotiated.

The marketing mix is the collection of activities, or methods, that a business employs to sell its brand or merchandise. A typical marketing mix is comprised of the four Ps: price, product, promotion, and place.

The "marketing mix," or the strategy you use to introduce a new good or service to the market, can be improved using the four Ps of marketing. To ensure that your offering satisfies a particular client need or demand, it is helpful to identify your marketing alternatives in terms of pricing, product, promotion, and location.

Aids in understanding what benefits your service or item can provide to customers. aids in creating a profitable product offering. aids in the development, planning, and execution of successful marketing initiatives. assists companies in utilizing their strengths and avoiding unnecessary costs.

Learn more about the marketing mix here:

https://brainly.com/question/13495504

#SPJ4

Fresh Ideas employs part-time workers through a staffing firm. After the staffing firm sent over a part-time office assistant, Fresh Ideas asked the firm to replace her with someone from a different race. The replaced office assistant cannot proceed with a discrimination claim under Title VII of the Civil Rights Act since she (the part-time office assistant) was never an employee of Fresh Ideas.


A. True

B. False

Answers

True Through a staffing company, Fresh Ideas hires people on a part-time basis. Fresh Ideas requested that the hiring agency replace the temporary office assistant she had sent over with someone of a different race.

What does it entail to work for a staffing company?

A staffing firm serves as a liaison between businesses and job seekers, assisting in the matching of competent applicants with organizations that have openings.

What does an employment agency do?

Every day, staffing firms help people find fantastic employment, but their primary goal is to identify qualified applicants for unfilled positions at their customers. This service is free for you because it is paid for by their customers. For each open position, the agency strives to hire the best candidate.

To know more about  staffing visit:

https://brainly.com/question/30038252

#SPJ4

A transaction that is likely to cause an increase in a current liability is:
a. payment of accrued wages.
b. accrual of interest expense.
c. depredation of equipment.
d. accrual of bad debts expense.

Answers

Depreciation of equipment is a transaction that is likely to result in a rise in a current liability.

A corporation's or an individual's present obligation originating from a previous incident, from which the firm or individual expects to derive future financial advantage, is known as a liability. Liability is essentially split into current and non-current obligations. Non-current liabilities are the existing debts a company or person owes as a result of previous events from which it expects to get future economic benefits over a period longer than a year. Debentures, long-term loans, deferred taxes, etc. are some examples. The present debt owed by a company or person as a result of a previous incident from which they hope to receive future financial gain is known as a current liability.

Learn more about liability from

brainly.com/question/14921529

#SPJ4

What are trends in human resource today?

Answers

Trends in human resource today are Emphasis on Employee Engagement, Flexible Working Arrangements, Use of Technology, Data-Driven Decision Making, Diversity and Inclusion and Wellness Programs.

What is human resource?

Human resource (HR) is the term used to describe the people who make up an organization's workforce.

1. Emphasis on Employee Engagement: Companies are increasingly focusing on employee engagement and creating a positive work environment to attract and retain top talent.
2. Flexible Working Arrangements: Companies are offering more flexible working arrangements such as remote work, flexible hours, and job sharing to accommodate employees’ needs.
3. Use of Technology: Companies are leveraging technology to streamline HR processes, such as applicant tracking systems, employee self-service portals, and automated onboarding.
4. Data-Driven Decision Making: Companies are using data to make more informed decisions about their workforce, such as analyzing employee performance and engagement.
5. Diversity and Inclusion: Companies are focusing on creating a diverse and inclusive workplace to attract and retain top talent.
6. Wellness Programs: Companies are offering wellness programs to promote employee health and well-being.

To learn more about human resource
https://brainly.com/question/28154788
#SPJ4

Pressures for a global integration strategy for all markets are increased by the presence of

Answers

global competition and the interconnectivity of economies and businesses. As companies and industries become more interconnected and reliant on international trade, it becomes increasingly important for them to have a cohesive strategy for operating in all markets.

Additionally, as global competition intensifies, companies may need to adapt their strategies in order to remain competitive. This can include developing new products or services, entering new markets, or changing their marketing or distribution methods. Overall, the presence of global competition and interconnectivity can drive the need for a comprehensive global integration strategy, when competition on a global scale increases, businesses may need to modify their tactics to be competitive. This might involve creating new goods or services, breaking into untapped markets, or altering their advertising or distribution strategies. Overall, the requirement for a thorough global integration plan may be prompted by the presence of international competitiveness and connection.

To learn more about global integration strategy here:

https://brainly.com/question/18761002

#SPJ4

Because of the large number of resumes that a hiring manager may have to review, you want your resume to:

Answers

Because of the large number of resumes that a hiring manager may have to review one wants his resume to be easy to read and contain the information necessary for the hiring manager to make an informed decision about you.

The most effective resumes are neat, professional, and devoid of grammatical and spelling mistakes. contains true and current data regarding you. makes it clear to the prospective employers why you are a suitable candidate for the role you are applying for. You shouldn't refer to oneself by a nickname on your CV. any talk about compensation or vacation time. unnecessary personal information You should just say that connections are available to your prospective employers if they should require them whenever providing references on your resume. Do not list references in their entirety.

To learn more about resume refer here:

https://brainly.com/question/862477

#SPJ4

What is one advantage of a mixed market economy in a democracy ?

Answers

One advantage of a mixed market economy in a democracy is that it allows for more freedom and flexibility for individuals and businesses to pursue their economic interests.

This economic freedom encourages innovation, competition, and economic growth. It also allows for citizens to have a say in how their economy is managed, as they are able to vote for different policies that affect their lives. This leads to greater economic security, as individuals and businesses can be sure that their economic interests are being taken into consideration.

To know more about economics here

https://brainly.com/question/2113509

#SPJ4

Determine the eating capacity of an auditorium with 15 row of eat if there are 20 eat in the firt row, 23 eat in the econd row, 26 eat in the third row, 29 eat in the forth row, and o on

Answers

After solving the equation: the eating capacity of the auditorium is 645.

What is Arithmetic Sequence?

An arithmetic sequence is a sequence of numbers in which each subsequent number is obtained by adding a fixed number, called the common difference, to the preceding number. This fixed number is also referred to as the common ratio. Arithmetic sequences can be written as an explicit formula, a recursive formula, or graphically.

The total eating capacity of the auditorium can be calculated by using the arithmetic sequence formula. The sequence pattern is +3.
Arithmetic Sequence Formula:
Sum of n terms = n/2 (a1 + an)
Where,
n = total number of terms
a1 = first term
an = last term
In this case,
n = 15
a1 = 20
an = 29 + (15 - 1) * 3 = 74
Therefore,
Sum of 15 terms = 15/2 (20 + 74) = 645
Hence, the eating capacity of the auditorium is 645.

To learn more about Arithmetic Sequence
https://brainly.com/question/30111011
#SPJ4

At each sporting event in her town, Ayla sells fruit smoothies. Each smoothie costs her $2 to make, and she sells the smoothies for $5 each. She also pays a seller's fee to the town of $46 for each sporting event. What is the least number of smoothies Ayla needs to sell at each sporting event to cover the cost of the seller's fee

Answers

 The cost of the seller's fee is calculated as follows: units sold times seller's fee  ($5 * ($46 - $2) = $228).

The following are the definitions of "Seller Fees": (a) for an hourly contract, an amount equal to the number of hours the seller records in any hourly invoice times the hourly rate established by the seller; (b) for a fixed-price contract, the fixed fee agreed upon between a buyer and a seller; and (c) any bonuses or other payments made by a buyer. a payment made to the person or business hosting the auction in addition to the winning bid in an auction. For instance, if a bidder offers $1,000 for an antique bed, the seller might be required to pay a 10% buyer's fee. One revenue stream for the auctioneer is the seller's fee.

Learn more about seller's fee   from

brainly.com/question/19174083

#SPJ4

the federal government's role as the provider of national defense is justified by considerations of_____

Answers

the federal government's role as the provider of national defense is justified by considerations of Public goods.

Public goods are of philosophical interest because they have a close relationship to issues with the regulation of externalities and the free-rider problem, as well as because their provision is, in varying degrees, necessary to the efficient operation of society on an economic, political, and cultural level. Without infrastructure and their protection, it would be more difficult to exchange things, cast ballots, or enjoy the pleasures of cultural development. Political theorists generally concur that education at some degree is necessary for democracy to function. The provision of public goods presents significant economic and ethical problems because of its relationship to externalities and the free-rider dilemma.

Learn more about Public goods here:

https://brainly.com/question/30138129

#SPJ4

An ADR has been issued where each ADR equals .1111 ordinary shares of the foreign issuer. If a client wished to buy enough ADRs to cover 100 ordinary shares, how many ADRs must be purchased

Answers

1111 ordinary shares of the foreign issuer are represented by each ADR that has been issued. How many ADRs would need to be purchased if a customer wanted to purchase enough to cover 100 ordinary shares.

900, as each ADR is equal. A foreign security held at a foreign office of a U.S. bank is known as an American Depositary Receipt. The bank issues receipts in exchange for these ordinary shares, which are listed and traded on U.S. stock exchanges and registered in the country as securities. The number of advancing shares divided by the number of decreasing shares is known as the advance-decline ratio.

To learn more about ordinary shares, click here.

https://brainly.com/question/16554294

#SPJ4

Unlike price ceilings, price floors lead to very positive effects when properly implemented.
True/False

Answers

The given statement about Price floors lead to very positive effects when properly implemented is False.

Price floors have a variety of unforeseen consequences that are hardly ever addressed by decision-makers. The term "price floor" refers to the lowest allowed cost that can be incurred in a market for goods and services, labor, or financial capital. The most widely recognized example of a price floor is probably the minimum wage, which is based on the normative principle that someone doing a full-time job should be able to afford a basic standard of life. It is a limitation on the lowest price at which a thing, commodity, or service may be sold and which is determined by the government or another party. It must be higher than the equilibrium price to be effective.

To learn more about Price floors click here

brainly.com/question/13335147

#SPJ4

A firm's total output times the price at which it sells that output is:
A. net revenue.
B. total revenue.
C. average revenue.
D. marginal revenue.

Answers

A firm's total output times the price at which it sells that output is total revenue. Hence option B is correct here.

What is total revenue?

Total revenue is the total amount of money a company receives from selling its goods or services. It is calculated by multiplying the quantity of goods or services sold by the price at which they were sold. In other words, it is the product of a firm's total output and the price at which it sells that output. Total revenue is an important metric for a company, as it is used to measure the overall performance of a business and can be used to make important decisions such as setting prices, determining production levels, and evaluating the effectiveness of sales and marketing efforts.

The calculation of total revenue is relatively simple. It is the product of the quantity of goods or services sold and the price at which they were sold. For example, if a company sells 100 units of a product for $10 each, the total revenue would be 100 x $10 = $1,000.

Alternatively, if a firm is selling more than one product, then it will have to sum up the revenue generated from each product.

For example, if the firm sells product A for $20 and product B for $30, and it sold 100 units of product A and 50 units of product B, then the total revenue would be (10020)+(5030) = 2000 + 1500 = $3500.

It's important to note that total revenue is not the same as profit. Total revenue only takes into account the money a company brings in, while profit takes into account the money a company spends, such as on cost of goods sold, operating expenses, and taxes.

To know more about total revenue visit:

https://brainly.com/question/13000391

#SPJ4

What is the difference between recognizable and decidable?

Answers

If a machine accepts strings that are in the language and rejects strings that are not in the language, the language is said to be decideable. A language is said to be Turing Recognizable if a Turing Machine can understand it.

What distinguishes identifiable from decidable in TM? When a machine will accept strings written in a language and reject strings written in another language, that language is said to be decideable.Turing is a language.Identifyable if a Turing machine can identify it.Understandable LanguageIf L = L, then language L is recognized by Turing machine M. (M).If TM M exists such that L = L, then L is considered Turing-recognizable (or just recognizable) (M).Decision-Making Language.In the case when L = L(M) and M halts on all inputs, a Turing machine M determines the language L.A language that can be recognized by a Turing machine that halts for all inputs, or one for which membership can be determined by an algorithm that halts on all inputs in a finite number of steps.Also known as entirely decidable language and recursive language.

To learn more about decidable in TM refer

https://brainly.com/question/29891845

#SPJ4

How can capital resources be used to increase productivity?

Answers

The assets physical machinery, plants, and tools that enable higher levels of work productivity are known to as capital. More items can be generated and the level of living raised by raising productivity through enhanced capital equipment.

Productivity is a measure of how effectively commodities or services are generated. Productivity is sometimes expressed as a ratio of the entire output to a single input or the total input used in a production process, or output per unit of input, typically over a predetermined time period. The most typical illustration is the (aggregate) measure of labor productivity, where GDP per worker is one example. The choice of a productivity definition (including those that do not relate to ratios of output to input) is dependent on the objective of the productivity measurement and/or the availability of data. The main cause of variability across productivity measures is often (directly or indirectly) connected to how the inputs and outputs are combined to produce such a ratio-type productivity measure.

Learn more about productivity here

https://brainly.com/question/2992817

#SPJ4

Julius is asked to conduct an STP analysis for his firm. The first step he should perform in this analysis is to Multiple Choice conduct a SWOT analysis. divide the marketplace into subgroups. choose the best target markets. develop a business mission statement. reposition existing segments.

Answers

Julius is tasked with doing an STP study for his company. The initial stage in this study should be to split the market into subgroups. Hence, the correct answer is to divide the marketplace into subgroups.

What is STP in research?

Grasp marketing and business strategy requires an understanding of the process of market segmentation, targeting, and positioning (STP). Most marketing textbooks present the STP approach as a simple three-step process. While that method provides a fantastic introduction to this marketing concept, it falls short of addressing the smaller parts of the STP process that must also be understood.

STP marketing (Segmentation, Targeting, and Positioning) is a three-step marketing framework. Using the STP technique, you separate your market, target your consumers, and place your offering in each category.

To learn more about market segmentation, click

https://brainly.com/question/27993208

#SPJ4

Suppose you normally work in the stock room and are not a trained retail associate. You are stocking new merchandise. A customer start

Answers

about it because no other retail employees can be seen. You are aware that one of the regular retail associates in that area is absent on leave due to illness, and the other is taking a lunch break outside the store.

Who are Retail Employees?

A retail salesperson works in a store and sells books, automobiles, clothing, cosmetics, electronics, furniture, lumber, plants, shoes, and a wide range of other goods. They are also known as salespeople, retail clerks, or salespeople. In the United States, over 4.6 million retail salespeople are employed.

The majority of retail salespeople work in neat, well-lit stores. A lot of salespeople work nights and weekends.

What retail employees want—insights for increasing engagement and retention—reveals what makes retail workers tick. We discover that retail workers are among the most self-assured and are more likely than workers in other occupations to believe that their product or service is superior to that of their rivals. However, they are also the least likely of all industries to believe that their pay is competitive and are prepared to leave for a better offer. There are retail salespeople who work part-time.

Types of workers:

Permanent employees.Workers who work part-timeSeasonal WorkersTemporary Workers

To know more about Retail salespersons, visit:

https://brainly.com/question/29617774

#SPJ4

What are the goals of a society?

Answers

The main goals of a society are the following:

Living in a system that guarantees the safety, education, health, and work of all members of society.Guarantee the freedom of expression of all people and media in society.Have a justice system that guarantees the human rights of all, such as the right to vote and freedom.Guarantee the peace of society away from wars or social or political conflicts.Guarantee adequate economic and social conditions so that citizens can live with quality of life and do not have to emigrate from the country.Promote the protection and well-being of its members.

Learn more about the goals of society here:

https://brainly.com/question/26552843

#SPJ4

Other Questions
What is the best evidence we have for evolution ? Quadrilateral FGHI is similar to quadrilateral JKLM. Find the measure of side JK. Figures are not drawn to scale. I need to show work please help me its due tomorrow What are 6 major technological advances of ww2? Select the correct answer. which gas is the most abundant greenhouse gas? a. ozone b. chlorofluorocarbon c. carbon dioxide d. methane e. water vapor What type of lines will be presented by the system of equations 2x 3y 6 and 4x 6y 11? Suppose a historian wants to estimate the true mean number of children per household in New York City in 1900. The historian randomly selects 200 household census records from New York City. She records the number of children residing in each household. The historian then computes the mean number of children per household among these 200 households. For every described currently living species of organism, there are about ________fossil species.O 2O 1/6O 100O 6O 1/100 Checkpoint 4 is -117 and checkpoint 3 is -212 how much higher is checkpoint 4 than 3 PLSSS HELP IF YOU TURLY KNOW THISS Please help asap people kept giving me wrong answers. Due tonight in a couple hours +25ptsES = ___ unitsRound your answer to the nearest tenth. jacks meeting stared at 2:45 pm and ended at 5:25 pm how long did the meeting last Today, most nations, like the United States support...isolationism.democratic-socialism.internationalism.communism. Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA Is the simplified form of 2 square foot 3. Square Foot 12 rational II. Rewrite the given sentences in their present continuous2. Rahul receives an award on the children's day. PLEASE HELP!!The equation of a circle is (x+10)2+(y4)2=100.What is the center and radius of the circle?Responses center: (10, 4); radius: 10,000 center: , begin ordered pair 10 comma negative 4 end ordered pair, ; radius: 10,000 center: (10, 4); radius: 10,000 center: , begin ordered pair negative 10 comma 4 end ordered pair, ; radius: 10,000 center: (10, 4); radius: 10 center: , begin ordered pair 10 comma negative 4 end ordered pair, ; radius: 10 center: (10, 4); radius: 10 2. Experiment: Click Play and hunt peppered moths on dark tree trunks for five years. In each year, try to capture as many moths as you can. When you are done, select the TABLE tab and record the percentages of each moth type. Year Dark moths Light moths o 1 2 3 4 5 What was Hale's purpose in the play? What is the smallest positive multiple of $13$ that is greater than $500?$