The diameter of a circle is 32 inches. What is the circle's circumference?

Answers

Answer 1

Answer:

32[tex]\pi[/tex]

Step-by-step explanation:

if diameter 32 then radius 16

circumference formula 2*[tex]\pi[/tex]*radius

32[tex]\pi[/tex]


Related Questions

Aubrey is going to see a movie and is taking her 2 kids. Each movie ticket costs $13 and there are an assortment of snacks available to purchase for $4 each. How much total money would Aubrey have to pay for her family if she were to buy 3 snacks for everybody to share? How much would Aubrey have to pay if she bought x snacks for everybody to share?

Answers

Answer:

$51

Step-by-step explanation:

do 13*3 because of the 2 kids and the adult then add 12 because of the snacks

hope this helps

Answer:

51 and what?

Step-by-step explanation:

3 x 13 = 39                  4 x 3 = 12

39 + 12 = 51

what is x supposed to be, sorry, i suck at variables

Is it the 1st one. I’m not to sure.

Answers

Answer:

Yes, it's the first one

Step-by-step explanation:

Since the number line is from 0 to 1 and it's divided into 6 sections, the correct answer is 1

What is 4 8/9 plus 3 2/11

Answers

Answer:

8 7/99, Decimal. (8.07 repeated)

Step-by-step explanation:

Sorry it’s so blurry but I think u can see it it’s 8.07..... also if u needed to know it’s irrational.

The lgrsedfaffedadwaawdwaffweaf

Answers

What does that even say

What is the solution to the system of equations? =6x=y=8 5x+3y = 29 (10,-2) (10, 2) O (2, 10) (-2, 10)​

Answers

Its the 2nd one in the picture


Select ALL the correct answers,

Select the scenarios that correctly represent the given graph

1. The amount of money in an account decreases for a few months and then increases.
2. The height of a stone shot by a catapult reaches a maximum height and then falls on the ground.
3. The sale of a product increases at first and then decreases.
4. The radioactivity of a substance decreases by 10% every year.
5. The speed of a car increases constantly by 10 miles per hour.

Answers

Answer :

Option (2) and Option (3) is the correct answer .

Required Explaination :

Scenario 2 : The height of a stone shot by a catapult reaches a maximum height and then falls on the ground.

The graph of this scenario is a downward parabola. Therefore option 2 is correct.

Scenario 3 : The sale of product increases at first and then decreases.

The graph of this scenario is a downward parabola. Therefore option 3 is correct.

Therefore, the correct options are 2 and 3.

You invested $1,000 in a savings account at the end of 7th grade. The account pays 5% annual interest. How much money will be in the account after 6 years? Round to the nearest hundredth. * 1 point

Answers

Step-by-step explanation:

1000 x .05= 50.

1000 + 50= 1050

1050 x 6= 6300

If d= 2, what is the value of 8/(4-d)? A.1
B. 4/3
C. 4
D. 0​

Answers

8/ (4-2)
8/2
Answer 4 (C)

What is the equation in point−slope form of the line passing through (−3, −4) and (0, 2)?
Use the table below to answer this question:

x y
0
2
1
−1
2
−6
Find the average rate of change for the given function from x = 0 to x = 2.

Answers

Answer:

The answer is A

A restaurant has 100 tables and 28 of the tables seat 2 people and 72 of the tables seat 4. What percentage of the tables seat 4 people?

Answers

The percentage would be 72.

12. If f"(x) = x(x + 1)(x - 2)2, then the graph of f has inflection points when x =
A.-1only
B. 2only
C.-1 and 0only
D.-1 and 2 only
E. -1,0 and 2 only

Answers

Answer:

C. - 1 and 0 only

Step-by-step explanation:

(x + 1) / x = 0, - 1, 2

inflection points / when sign Changes

+  /   -   /  +       /  +

"- 1 "   "0"      2

  ^      ^

"Hope this helps"

The graph of f has inflection points when x = 0 and -1.

Given that,

If graph =  f"(x) = x(x + 1)(x - 2)^2

We have to determine,

The graph of f has inflection point when x is.

According to the question,

Inflection point is the point in which the rate of slope changes in increasing to decreasing order or vice versa.

These points are generally not local maxima or minima but stationary points.

[tex]f''(x) = 0[/tex]

Therefore,

The graph of f has inflection point at,

[tex]f''(x) = x (x+1) (x-2)^{2} = 0\\\\x = 0 \ and \ x+1 = 0 \ \ = x = -1\\\\ or \ x-2 = 0 , \\\ \ \ = x =2[/tex]

On taking intersection of these points,

The graph has inflection points at x = 0 and -1.

Hence, The graph of f has inflection points when x = 0 and -1.

To know more about Inflection points click the link given below.

https://brainly.com/question/2289668

PLEASE ANSWER ASAP FOR BRAINLEST!!!!!!!!!!!!!!!!!!!!11

Cecilia records the weight change in her cat over 2 weeks. What number does she record as the total weight change for her cat?

LOOK AT THE ATTACHED PICTURE

Answers

Answer:

1 over 16

Step-by-step explanation:

help! i will mark brainliest!

Answers

Answer: C

Step-by-step explanation:

Help me out with 5,6,7 (Geometry)

Answers

Problem 5

A counterexample could be a number like 6. Divide it over 2 and we get 6/2 = 3, which is a whole number. This shows 6 is a multiple of 2. However, 6/4 = 1.5 is not a whole number, so 6 is not divisible by 4. The overall claim is false.

======================================================

Problem 6

Let's say we are subtracting a positive number and a negative number. For instance, let's say we're subtracting 10 and -7

So,

10 minus -7 = 10 - (-7) = 10+7 = 17

When subtracting a negative, the two minus signs cancel to form a plus sign. The result we get is 17, which is larger than the greater number 10. So this is one counterexample that proves the claim to be false.

======================================================

Problem 7

Start with a circle. The circle can be any size. Plot four random points on the circle. The points can be anywhere you want. Let's label those points A,B,C,D. Form quadrilateral ABCD.

Now let's say we pick point A and pull it off the circle and pull it outside the circle. Points B,C and D remain on the circle. This is one example where we cannot draw a circle through this new arrangement of points. The circle goes through B,C, and D just fine; however, it doesn't go through point A. If you try to attempt to get the circle to go through A, then you'll have to pick B,C or D to ignore. In other words, you'll only be able to pick three points that the circle can go through. Therefore, a circle cannot be drawn as described for every quadrilateral.

Note: Any quadrilateral that has all four points on the same circle is known as a cyclic quadrilateral.

1+1=? HHHHHHELP!!!!!!!

Answers

Answer:

2,thanks,for the points

find the measusre of the angles.

Answers

Answer:

1, 3, 5 =117

2, 4, 6, 7= 63

Step-by-step explanation:

Since we know that one angle is 117 degrees, 5, 1 and 3 will also be 117. 2, 4, 6 and 7 will also be the same. 117 plus 117 is 234. 63 + 63 = 126. 234+ 126 = 360.

FLIP OR NOT TO FLIP?
A. -4x + 2 < -2
B. - 9>-8
-7.

Answers

Answer:

the answer is not flip because when u calculate it

The starting annual salary for an office worker at a company is $29,000. If the company
awards an annual increase of 6.2%, which graph models this situation after the office worker
receives x annual increases?
Office Worker's Salary

Answers

Answer:

On my screen the answer would be A

Step-by-step explanation:

but it could be different for u but I found the answer on Quizizz picture down below

The graph models this situation after the office worker receives x annual increases is to be considered as an option A.

Calculation of the graph model;

Since

The starting annual salary for an office worker at a company is $29,000. If the company awards an annual increase of 6.2%.

So, based on the given graph we can say that The graph models this situation after the office worker receives x annual increases is to be considered as an option A.

Learn more about graph here: https://brainly.com/question/24613103

What is the Factor: 24x - 60

Answers

the answer is
12(2x-5)
good luckk
i hope i could help

Daniel buys two apples for every five oranges. If you bought 12 apples, how many oranges dis he buy?

Answers

Answer:

30 oranges

Step-by-step explanation:

2 apples : 5 oranges

12 apples : 30 oranges

because 12 apples is 6 times the original ratio, so we multiply the 5 oranges by 6 too.

graph each function (equation) by making a table y = |2x| + 1

please help​

Answers

Answer:

the table:

x | y

-2 | 5

-1 | 3

0 |  1

1  | 3

2 | 5

for the graph: go up from the middle point, then right then up by two and repeat on the other side as well, should look something like this

( up one, go left, up 2)  ∨  (up one, go right up two)

                         

Simplify:(-3x3)(-2x)
A. -5x15
B
6x15
–5x²
6x

Answers

Step-by-step explanation:

[tex]( - {3x}^{3} )( - {2x}^{5} ) = 6x {}^{3 + 5} = {6x}^{8} [/tex]

It’s in the picture please and thank you ^*

Answers

Answer:

38 degrees

Step-by-step explanation:

3x+2x+15+95+60=360

the sum of the angles of a quadrileteral=360

5x+170=360

5x=360-170

5x=190

x=190/5

x=38 degrees

HELP PLEASE 18 POINTS

Answers

Answer:

Step-by-step explanation:

line 1  m=y2-y1 / x2-x1  [formula for slope ]

m= 0 - (-3) / 8-(-4)

m= 3 /12      

m= 1/4  slope of line 1

line2  

m = 2-6 / 0-(-1)

m = -4 / 1

m = -4  slope of line 2

line 3

m = -4 - (-7)  / -3 -  6

m = 3 / -9

m = - 1/3  slope of line 3

lines 1 & 2   perpendicular b/c they are reciprocals with a sign change :)

lines 1 & 3     neither.. differet slopes and not reciprocals

lines 2 & 3  perpendicular  b/c they are reciprocals with a sign change :)

Kim has a bag with 4 blue marble, 4 black marble, 7 orange marbles, 2 red marbles, 6 yellow marbles, and 1 pink marble.


P(pink OR red)?
A. 12.5%
B. 0.89
C. 1 1/4

Answers

This does not make sense, but with the logic, it would be B. Please comment to clarify so I can make changes if needed.

ANSWER: B

What value of n makes the equation true?

Answers

Answer:

-0.7

Step-by-step explanation:

First do 3.2-1.8= 1.4. So now we know that -2n=1.4. Next you solve for n to get the answer of -0.7 with your answer of the third option.

help please, don’t guess or don’t answer if you don’t know it

Answers

the answer to this is (-3,-5)

One out of every 4 students in a club is a girl. There are 20 students in the club. How many girls are in the club? Explain how you know

Answers

Answer:

5 girls because 1/4 times 20 is 20/4 which gets 5

Step-by-step explanation:

because 1/4 times 20 is 20/4 which gets 5

suris age is 4 less than 3 times her cousins age. suri is 17 years old. which method can be used to find c, her cousins age?

Answers

The answer is: D
You have 3c (3 times her cousins age) -4 (4 less than)

Item 6
At the beginning of the day, the temperature is -8°F. As the sun comes out, it warms up 19°F. What is the temperature once it warms up?
°F

Answers

Answer:

-8 + 19 = 11ºF

Step-by-step explanation:

Other Questions
Please help Im stuck!!!! PLEASE HELP I NEED THE ANSWER QUICK!!! What is the Length/ value of N is 63 / 168 equivalent to 312 / 832 Which Pope wanted to liberate Jerusalem from Muslim control? A 14.0 tank contains 250 g of methane (CH4) gas at 27 atm at 298 K. Accidentally, 190 g of CO2 was added to the tank. What will be the resulting pressure of the mixture in the tank? Assume that no CH4 leaked out as the CO2 gas waa being added. Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) PLEASE HELP!! I'LL GIVE BRAINLEST!!Use the formula P = 2l + 2w. Find the perimeter of a rectangle with a length of 12.9 ft and a width of 19.3 ft. Show all of your work. (4) NH3+02- NO+H2Obalance the equation Find the slope intercept equation of the line Ryan buys a baseball bat. The original price is $20. Ryan has a coupon for a 20% discount. What is the sale price? Which can provide the most energy in an ecosystem?a mushroom ,a coyote, a pine tree ,a grassy meadow Please HELP what is the slope-intercept equation slope: -2 y-intercept: 3 Please help me with this question please!!!Look at the picture provided and answer the question >>Select one only.Q:An aromatic hydrocarbon is represented by which structural formula?>>Choose one answer from the picture below that answers the question above ABCD Angel and his 2 sisters shared 1/2 cup of baby carrots. How many cups did they each get? How does biology affect behavior? tell whether each question is true or false.a. [tex] \sqrt[3]{60} = 20 \: true \: or \: false[/tex]b.[tex] \sqrt[3]{64} = \sqrt{16 \:} true \: or \: false[/tex]c. [tex]25 = \sqrt[3]{125} \: true \: or \: false[/tex]d.[tex]12 = \sqrt[]{144} \: true \: or \: false[/tex]e.[tex] \sqrt{ \frac{4}{9} } = \sqrt[ 3]{ \frac{8}{27} } \: true \: or \: false[/tex] If a wagon train traveled 12.5 miles each day, how many days would it takethem to get to Independence Rock which is 900 miles from their startingpoint? Find the value of c x 8 when c=9. Can someone find the mistakes and make the sentence plz.On both plz :(