The earth and the moon have both been hit by asteroids. They've been hit throughout history. There are no craters on the earth's surface. Weather, water, and plants work together to erase craters from the earth's surface.

Answers

Answer 1
Where is the question man?
Answer 2

Answer:

the earth and the moon have both been hit by asteroids throughout history and there are no craters on earth's surface because the weather,water, and plants work together to erase them.

Explanation:

you combine them and it makes the most sense.


Related Questions

4.Why might Father be worried that Bruno was "watching" the people in
the striped pajamas? Why does Father make a distinction between
"watching" and "seeing" the people?

Answers

Answer:

1. because he doesnt want him to know whats going on and witness all the horible things

2. watching is like spying seeing is observing

the ,why ,play ,cant ,boys ,tennis
select the nouns​

Answers

Answer: Tennis and boys
Explination: a noun is is a person place, thing, or idea.

I will mark you brainlist!

List three things you know about social competencies.

Answers

Answer:

Social skills

social communication

interpersonal communication

1. Identify and underline all the noun phrases in these sentences. One has
been done for you.
a) The trip to the mountains was a great experience.
b) My friends and I left at dawn.
c) We travelled in a big and comfortable van.
d)
We hoped to arrive at our destination before dark.
e) The van headed towards the highway, and we reached the base of
the mountain
please I need the answers today because today is the due . I will make you brainliest. ​

Answers

Answer:

solution given:

a) The trip to the mountains was a great experience.

b) My friends and I left at dawn.

c) We travelled in a big and comfortable van.

d)

We hoped to arrive at our destination before dark.

e) The van headed towards the highway, and we reached the base of

the mountain


He explained the changes in the rules to the animals

Answers

Answer:wut

Explanation:i dont get it

Write a short response to an element of the novel


Choose one of the following topics and write an essay of at least 200 words.

1. Where does the crisis that changes Aronnax's evaluation of Captian Nemo occur?
Describe the event(s) that led up to it.



2. How did Captain Nemo change through the course of the novel?



3. Take an example of a static character, Conseil, and explain why you think he did not change.



4. Take the last paragraph of the novel and discuss it in Christian terms.



5. Read Luke 18:10-14 for examples of a static character (a character who does not change during the course of the story) and a dynamic character (a character that does change throughout the course of the story). Explain which character is static and why, and which character is dynamic and why.



6. You have been taking notes on characters in the novel. Write a short essay sketching the character of Captain Nemo and one other character.

Hint: Discuss Captain Nemo's physical attributes, outlook on life, education, manners, and so on. Then compare Captain Nemo and the other character you choose.
You will be graded on the following criteria:

1. Clearly state your answer and support it with evidence from the text. Use specific quotes.

2. Make sure each paragraph contains one main idea and support. Use complete sentences including compound and complex sentences.

3. Include an introductory paragraph, proper transitions, and an appropriate conclusion.

4. Make sure your essay contains no errors in conventions such as spelling and grammar errors, and is at least 200 words long.

Answers

When you read for pleasure, your only goal is enjoyment. You might find yourself reading to get caught up in an exciting story, to learn about an interesting time or place, or just to pass time. Maybe you’re looking for inspiration, guidance, or a reflection of your own life. There are as many different, valid ways of reading a book as there are books in the world.

When you read a work of literature in an English class, however, you’re being asked to read in a special way: you’re being asked to perform literary analysis. To analyze something means to break it down into smaller parts and then examine how those parts work, both individually and together. Literary analysis involves examining all the parts of a novel, play, short story, or poem—elements such as character, setting, tone, and imagery—and thinking about how the author uses those elements to create certain effects.

Schools almost over, good luck!!

How does Schenck use the Constitution of the United States to build his argument?

Answers

Answer: United States, legal case in which the U.S. Supreme Court ruled on March 3, 1919, that the freedom of speech protection afforded in the U.S. Constitution's First Amendment could be restricted if the words spoken or printed represented to society a “clear and present danger.”

Explanation:

Your class is studying recycling. On the one hand recycling can help protect the environment. On the other hand recycling is inconvenient and places an added burden on citizens.
Do you feel that recycling should be required of all citizens? Why?

Write an essay persuading your legislator to accept your recommendation on whether or not recycling should be mandatory.

Which of the following is the rebuttal or counterargument?
a. Write an essay persuading your legislator to accept your recommendation on whether or not recycling should be mandatory.

b. Your class is studying recycling. On the one hand recycling can help protect the environment.

c. On the other hand recycling is inconvenient and places an added burden on citizens. Do you feel that recycling should be required of all citizens? Why?

Please select the best answer from the choices provided

Answers

Answer:

C. On the other hand recycling is inconvenient and places an added burden on citizens. Do you feel that recycling should be required of all citizens? Why?

Explanation:

I calculated it logically

in deciding the best medium to tell a story, which step is first
A. figuring out the setting
B. deciding how much to leave to the imagination
C. thinking about what the characters are doing
D. identifying the audience
please i need help

Answers

Answer:

A

Explanation:

The setting is one of the most important things in a book. Usually authors start off with a vauge description of the time, place, and surroundings. I hope that helps!

fron the kitchen came the smell of fresh bread. where is the subject?​

Answers

Respuesta: pregunta difícil, tuvo que ser de donde venia el viento a la derecha o izquierda del lugar dependiendo de los puntos cardenale

Explanation:

Answer:

Kitchen is the main subject while bread is also the subject but kitchen best suits the subject because the subjects used at last are called objects.

Explanation:

keep that in mind!

ACTIVITY 8: Me and My Story
Considering the pandemic the world is experiencing today, write a
story about your personal experience/reaction relating to the present
situation you are facing today.
Write your story in your English activity notebook.​

Answers

Answer:

This current pandemic has ruined a lot of lives. a lot of people lost their lives due to this pandemic . Families have been suffering because they haven't been able to go to work to make money for their families. Some kids go to sleep without having food to eat.

By being concise in your writing, you can: A. say the same thing over and over again. B. save readers from having to read your entire work. C. direct readers to what's important in your work. D. send the message to your readers that you do not have a purpose.​

Answers

Answer:

I would say B

how to write an entry of a competition​

Answers

Answer:

: Do NOT go over the word limit. ...

Tip 2: Answer the question. ...

Tip 3: Think about the prize (specifically, the product or brand). ...

Tip 4: Know who is judging the competition. ...

Tip 5: Be honest. ...

Tip 6: Provide a valid email address. ...

Tip 7: Don't overthink your entry

Explanation:

Read these lines from the “it sifts from leaden sieves.”

It sifts from leaden sieves —
it powders all the wood —
it fills with alabaster wool —
the wrinkles of the road.

What is the alabaster wool referenced in these lines?
A. The coats of woodland animals
B. cloths that the speaker weaves in her grief
C. white gravel used to fill the rugs in the old road
D. snow — collecting in fluffy clumps

Answers

Answer: D

The Answer Is D

Explanation:

PLS help will give BRAINIEST

Answers

Answer: B

Explanation:

The thesis statement is the statement describing what the article will be about, so using this knowledge, you can tell that c is the correct answer.

According to Junior (from The Absolutely True Diary of a Part Time Indian) there is one “language” that everybody can understand. What is that language?

Art
O‘Philosophy
English
French

Answers

Answer:

ART

Explanation:

cuz everyone likes art

Read this section of the text:
With an excellent sense of smell that compensates for almost total blindness, the hagfish will locate and latch on to a victim.
Which phrases from the text provide clues to the meaning of the word compensates?
O Sense of smell and almost total blindness
O Excellent sense and locate and latch
O Almost total and latch on to
O Locate and latch and to a victim

Answers

Answer:

Option B

Explanation:

Compensates here means that the hag fish is able to locate and latch using its sense of smell only.

This indicates excellent sense of smell of hag fish and despite having no vision or total blindness, it is able to both locate and latch.

Thus, option B is correct

PLESS HELPPP
MEEEEEEEEEEEEEEE
Which word best completes the sentence?

Select the word from the drop-down menu.

Even though the man was handsome, he mostly thought of himself as rather
Choose...
a)cruel
b)homely
c)gorgeous
d)pleasant

Answers

Answer:

homely

Explanation:

Answer:

B: homley

Explanation:

Question 1: What did Sabrina like to do? Play dress up in her mom's clothes. Play basketball Go.

Answers

Answer:

play dress up

Explanation:

Answer:

Not the answer!! But, can you give us some context? Like maybe a link to what you are reading/watching?

The word rough is:
•A noun
•An adjective
•A verb
•all of the choices are correct

Answers

Answer:

•An adjective

Explanation:

word used to describe something- adjective

please answer before 11

Answers

The correct answer is A. Only

Explanation

It is known as a modifier to words or phrases that act by modifying the core of the subject in a sentence, complementing its meaning. Among the modifiers of the subject's nucleus, there are the articles and adjectives that accompany the subject's nucleus noun, define it, and agree with it in gender and number. These modifiers are called direct modifiers. Therefore, Only is a modifier because it modifies the complete meaning of the phrase by modifying the core noun of the subject "they". So the correct answer is A. Only.

Exercises about Present Continuous Tense
1. Pass the sentences to PRESENT CONTINUOS.
a) Jane rides a bike all the weekends.
b) I jump in all the parties that I go.
c) My friend does the school's work at night.
d) My mother make cake all the weekends.
My friends and I ride a bike every weekend. We enjoyed it very much.
f) George have a long hair.
g) I bring a snack to school all the day.
h) I sleep until late every day.
i) I think to go to London next year.
j) I play computer games in my bedroom.​

Answers

Answer:

The sentences in the present continuous are:

a) Jane is riding a bike this weekend.

b) I am jumping in the party right now.

c) My friend is doing the school's work tonight.

d) My mother is making a cake this weekend.

e) My friends and I are riding our bikes this weekend. We are enjoying it very much.

f) George is wearing long hair.

g) I am bringing a snack to school today.

h) I am sleeping until late tomorrow.

i) I am thinking of going to London next year.

j) I am playing computer games in my bedroom.

Explanation:

The present continuous structure is the following:

subject + am/is/are + main verb with -ing

We need to pay attention to the use of the present continuous as well before we can transform the sentences. The present continuous is used to refer to actions that are taking place at the moment of speaking or that are to happen in a nearby future. Notice that the present continuous cannot be used for habitual actions - that is for the simple present. That is why, in the sentences above, more changes were necessary. Instead of "all the weekends," which refers to a habitual action, for instance, we can use "this weekend".

NOTE: For letter F, I needed to change the verb. In English, "George is having long hair" is not an acceptable structure.

where does the frankenstein family move after justine is e

Answers

Answer:

Belrive

The family moves into their house in Belrive.

The frankenstein family moves to Belrive

Part A
In "The American Romantics v the American Realists,
which statement best describes how the American
Realists portrayed life in their novels?
American Realists wrote novels showing
o how people could live exceptional lives
despite their societal restraints.
American Realists described the daily life of
o ordinary citizens and the places in which
they lived
0
American Realists focused on how life had
deteriorated due to European influences.
American Realists tried to show that science
could change how people lived and that
industrialization had forever changed
society
Part B

Answers

Answer:

Part A: American Realists described the daily life of  ordinary citizens and the places in which  they lived

Part B: "By using dialects and entwining regional landmarks, such as the Mississippi River into The Adventures of Huckleberry Finn, Twain shared realistic life in Missouri with his readers."

Explanation:

I took the test

Answer:

i dont mean to copy but

the girl in top of ne is right

Explanation:

Why do so many people feel certain of
things they can't possibly know?

Answers

Explanation:

It might seem almost unfathomable that someone might not recognize what they’re feeling. But the phenomenon is much more common than most people realize.  In these instances, you’re just beginning to feel something but it hasn’t yet come into focus. It’s not yet identifiable.

I sound like a therapist lol

Read the excerpt from "A Modest Proposal."
What is Swift's purpose in listing other ways to solve
the issue of poverty?
This I freely own, and 'twas indeed one principal
design in offering it to the world. I desire the reader will
observe, that I calculate my remedy for this one
individual Kingdom of Ireland, and for no other that
ever was, is, or, I think, ever can be upon Earth.
Therefore let no man talk to me of other expedients: Of
taxing our absentees at five shillings a pound: Of using
neither cloaths, nor houshold furniture, except what is
of our own growth and manufacture: Of utterly
rejecting the materials and instruments that promote
foreign luxury ...
O to show that his plan to sell children is the most
reasonable plan that has been put forth
O to show that society is already asking too much of
wealthy individuals
to show that real reform is possible with reasonable
sacrifice
O to show that there are many other people who are
trying to bring about reform

Answers

Answer:

Here ya go.

Explanation:

to show that society is already asking too much of

wealthy individuals

Which is a run-on sentence?

The reporter writing an article with questionable sources.

Let's spruce up this room new drapes would be an improvement.

Answers

Let’s spruce up this room new drapes would be an improvement
Lets spruce up this room new drapes would be an improvement

what does King think about using violence to solve the problem of racial equality

Answers

Answer:He disagrees and suggests people to peacefully protest to show innocence towards the law.

Explanation:

ONE HUNDRED POINTS, pls be honest
It was a sunny day
My mother asks me every day
Why do you not go and play?
Each time I had no reply
Because I liked watching days go by
The reason is that I feel gray
I feel gray all-day


make this into a poem I am confused about the formating.

Answers

Answer:

BigDawg Never Lies Despite his friends who eats those flies. Help Me First and I'll help you My Question is here: Find the range and interquartile range of the data.

23,45,39,34,28,41,26,33

The range of the data is

.

The interquartile range of the data is

.

Explanation: Help me First I have the answer to the poem

Can you take it to the ......?peter is in there ,cooking dinner -breakfast nook
-dining room
-sitting room
-kitchen

Answers

The answer Is the Kitchen
Other Questions
A piece of fabric 4 meters long is cut into two pieces. One piece is 1.25 meters long. How much longer is the second piece of fabric? How do religious and ethnic groups both reflect and influence the geography of places at differentscales? You must use a number line!n + 5 > 13PLZ HELP ILL PUT BRAINLIEST What is the measure of arc QSR? Use the drop-down menus to complete these sentences.The running of a set of programming instructions multiple times is called .If a sequence of code is repeated multiple times, it is referred to as .One set of coding instructions processing many different sets of data and eliminating multiple lines of code is an example of An item on sale costs %50 of the original price. The original price was 45$.Find the sale price.Please help! I will give the brainiest! 9.5/19=x/30 solve the proportion Where are Gold, Limestone and kaiolin found. PLEASE HELP NO LINKS IM TIMED 1/2 x 1 3/5 to the simplest form Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG Match the words in the left column to the appropriate blanks in the sentences on the right. The secondary structure given in the MaxExpect results can best be described as_________ Thus, the type of RNA is best classified as_________ a single strand with a distinctive cloverleaf structure a single-stranded random coll an unspecified type of RNA rRNA a single strand folded upon itself to form a small, round structure tRNA Find the verbal in the sentence below. Then, Identify the type of verbal.Jane wanted to forget about the matter.-infinitive-participle-gerund Which choice is similar to the figure shown?Please help Im confused on what to do. A physics student of mass 43.0 kg is standing at the edge of the flat roof of a building, 12.0 m above the sidewalk. An unfriendly dog is running across the roof toward her. Next to her is a large wheel mounted on a horizontal axle at its center. The wheel, used to lift objects from the ground to the roof, has a light crank attached to it and a light rope wrapped around it; the free end of the rope hangs over the edge of the roof. The student radius 0.300 m and a moment of inertia of 9.60 kg m^2 for rotation about the axle, how long does it take her to reach the side walk, and how fast will she be moving just beofre she lands? a wave travels one complete cycle in20sec and has wavelength of 1000mm.what is the speed Solve for y:5y+2-2y=8y-4-2y Voluntary migration on culture PLEASE PLEASE HELP IVE BEEN STUCK ON THIS FOR TOO LONG help me please this gives 30 points Describe the steps a plant would take to move sugars from a source to a sink.