the first several terms of a sequence {an} are: 14,−19,114,−119,124,.... assume that the pattern continues as indicated, find an explicit formula for an.

Answers

Answer 1

The explicit formula for the sequence {an} is:

an = 14 + 5n + 100(n-1) for even n
an = -(14 + 5n + 100(n-1)) for odd n

To find the explicit formula for the sequence {an} with the given terms 14, -19, 114, -119, 124, ...,
Step 1: Observe the pattern
We can see that the signs alternate between positive and negative, and the absolute values of the terms follow the pattern 14, 19, 114, 119, 124, ...
Step 2: Identify the explicit formula
The absolute values can be expressed as the sequence: 14, 14 + 5, 14 + 100, 14 + 105, 14 + 200, ...
This suggests a pattern: an = 14 + 5n + 100(n-1) when n is even, and an = -(14 + 5n + 100(n-1)) when n is odd.

Learn more about sequence:

brainly.com/question/6561461

#SPJ11



Related Questions

Which action is an example of a medium-term savings goal?

A. Saving to buy a house

B. Saving to buy concert tickets

C. Saving to make a down payment on a used car

D. Saving for a new smartphone

Answers

A. buy house


Reason- You finish paying off your student debt, saving for your wedding, saving for your first home, or even doing renovations to your current home. Then to car and lastly whatever fun life you want to do

PLEASE HELP ME

The figure below shows roads near a pond. Each segment of the triangle represents a road or a path, except AB, which represents the distance across the pond.
Are the two triangles similar?

Answers

Yes the two triangles ΔCDE & ΔABC are similar according to the rules of similarity of triangles.

What is similarity?

If two triangles have the same proportion of matching sides to matching angles, they are said to be similar. Similar figures are items that share the same shape but differ in size between two or more figures or shapes.

Given that in ΔCDE,

∠DEC=55°

EC=40 ft

DE=25 ft

Also Given that in ΔCAB,

∠ABC=55°

BE=60 ft

Consider ΔCDE & ΔCAB

∠ABC = ∠DEC = 55°

∠C = ∠C

∠CAB =180-( ∠C+∠B)

          =180-(∠C +55)

∠CDE= 180- (∠C+∠E)

         =180-(∠C +55)

∠CAB =∠CDE=180-(∠C +55)

As three angles are congruent, the triangles are similar.

To know more about Similarity, visit:

https://brainly.com/question/14926756

#SPJ1

find f. f ''(x) = 8 cos(x), f(0) = −1, f(7/2) = 0

Answers

The final answr is F(x) = -8 cos(x) + (8cos(7/2)/7)x - 1.

Integrating, also known as integration, is a fundamental concept in calculus that involves finding the area under a curve or the accumulation of a quantity over a given interval. Integration is the opposite of differentiation, which involves finding the slope of a curve at a given point.

There are two main types of integrals: definite integrals and indefinite integrals. A definite integral involves finding the area under a curve over a specific interval, while an indefinite integral involves finding a function whose derivative is equal to the original function.

To find f given that f''(x) = 8 cos(x), we need to integrate this expression twice with respect to x to obtain f(x).

Integrating f''(x) once gives:

f'(x) = ∫ f''(x) dx = ∫ 8 cos(x) dx = 8 sin(x) + C1

where C1 is the constant of integration.

Integrating f'(x) once more gives:

f(x) = ∫ f'(x) dx = ∫ (8 sin(x) + C1) dx = -8 cos(x) + C1x + C2

where C2 is another constant of integration.

We can solve for the constants of integration using the initial conditions:

f(0) = -1 implies -8cos(0) + C1(0) + C2 = -1, so C2 = -1

f(7/2) = 0 implies -8cos(7/2) + C1(7/2) - 1 = 0, so C1 = 8cos(7/2)/7

Thus, the solution for f(x) is:

f(x) = -8 cos(x) + (8cos(7/2)/7)x - 1

Therefore, f(x) = -8 cos(x) + (8cos(7/2)/7)x - 1.

To learn more about Integrating visit:

https://brainly.com/question/18125359

#SPJ11

prove that 2n > n2 if n is an integer greater than 4.

Answers

By mathematical induction we know that P(n) is true for all integers n > 4

We have proven that [tex]2^n > n^2[/tex] for all integers n > 4.

=> Let P(n) be the proposition that [tex]2^n > n^2[/tex], n > 4

Put n = 5

[tex]2^5 > 5^2[/tex]

32 > 25

It is true for n = 5

=> For the inductive hypothesis we assume that P(k) holds for an arbitrary integer k > 4

Let P(k) be true where k is greater than 4

That is, we assume that

[tex]2^k > k^2[/tex], k > 4

Under this assumption, it must be shown that, it is true for p(k+1).

[tex]= > 2^k^+^1=2.2^k\\\\=2^k+2^k > k^2+k^2\\\\=k^2+k.k > k^2+4k\\\\=(k+1)^2\\\\[/tex]

This shows that P(k + 1)  is true under the assumption that P(k) is true.

This completes the inductive step.

Learn more about Integers at:

https://brainly.com/question/15276410

#SPJ4

consider the finite geometric series: 14 14(0.1) 14(0.1)2 14(0.1)23 what is the exact sum of the finite series? express your answer in the form a(1-bc)/1-b
a=
b=
c=

Answers

The exact sum of the finite geometric series is 14(1 - 0.1 * 0.0001) / (1 - 0.1).

To find the exact sum of the finite geometric series 14 + 14(0.1) + 14(0.1)² + 14(0.1)³, we can use the formula for the sum of a finite geometric series: S = a(1 - rⁿ) / (1 - r), where 'a' is the first term, 'r' is the common ratio, and 'n' is the number of terms.

In this case, we have:
a = 14 (the first term)
r = 0.1 (the common ratio)
n = 4 (the number of terms)

Now, let's plug these values into the formula:
S = 14(1 - 0.1⁴) / (1 - 0.1)

Calculating the values:
S = 14(1 - 0.0001) / (0.9)

Now, we can write the answer in the form a(1 - bc) / (1 - b):
a = 14
b = 0.1
c = 0.0001

Therefore, the exact sum of the finite geometric series is 14(1 - 0.1 * 0.0001) / (1 - 0.1).

To know more about Finite geometric series refer here:

https://brainly.com/question/12546223

#SPJ11

y varies directly as a square of z and inversely as x. if the constant variation is -2. what is the equation that relates y,x, and z

Answers

The equation that relates y,x, and z when constant variation is -2: y = -2 *(z²) / x.

What is equation?

An equation is a mathematical statement that shows the equality of two expressions. It usually consists of two sides separated by an equal sign (=). The expressions on both sides of the equal sign can include numbers, variables, and mathematical operations such as addition, subtraction, multiplication, and division. An equation can have one or more unknown variables, and the goal is often to find the values of these variables that make the equation true. Equations are used in many different areas of mathematics and science to describe relationships between quantities, to solve problems, and to model real-world phenomena.

Here,

If y varies directly as the square of z and inversely as x, we can write:

y = k * (z²) / x

where k is the constant of variation. We are told that the constant of variation is -2, so we can substitute this value into the equation:

y = -2 * (z²) / x

This is the equation that relates y, x, and z.

To know more about equation,

https://brainly.com/question/28243079

#SPJ1

fill in the table using the function rule. y=19-2x​

Answers

Using the function rule, y = 19 - 2x, the table can be filled as follows:

x       y

1       17

3      13

4      11

6      7.

What is a function?

A function is a mathematical equation that represents the relationship between the independent variable and the dependent variable.

The independent variable is the domain while the dependent variable is the codomain of the function.

The codomain depends on the domain.

x       y

1       17 (19 -2(1)

3      13 (19 -2(3)

4      11 (19 -2(4)

6      7 (19 -2(6)

Learn more about mathematical functions at https://brainly.com/question/11624077.

#SPJ1

in each of problems 4 through 6, find the laplace transform of the given function. 4. f (t) = t 0 (t − τ ) 2 cos(2τ ) dτ

Answers

The Laplace transform of the given function is:

L{f(t)} = (6 - 4s/(s²+4) + 2s²/(s²+4)²) / s⁴

To find the Laplace transform of the given function:

f(t) = t∫0 (t-τ)² cos(2τ) dτ

We will first factor out the constants outside the integral and write the function as:

f(t) = t ∫0 (t² - 2tτ + τ² ) cos(2τ) dτ

We can then break the integral into three parts and take the Laplace transform of each part separately, using the properties of the Laplace transform:

L{t} = 1/s²

L{t²} = 2/s³

L{cos(2τ)} = s/(s² + 4)

Using these Laplace transforms, we can write the Laplace transform of the given function as:

L{f(t)} = L{t ∫0 (t²- 2tτ + τ²) cos(2τ) dτ}

= L{t³} - 2L{t²}L{∫0 τ cos(2τ) dτ} + L{t}L{∫0 τ²cos(2τ) dτ}

= 6/s⁴ - 4/s⁴ * (s/(s²+4)) + 2/s⁴ * (s²(s²+4)² )

Simplifying this expression, we get:

L{f(t)} = (6 - 4s/(s²+4) + 2s²/(s²+4)²) / s⁴

Therefore, the Laplace transform of the given function is: L{f(t)} = (6 - 4s/(s²+4) + 2s²/(s²+4)²) / s⁴

Learn more about “ Laplace transform  “ visit here;

https://brainly.com/question/31041670

#SPJ4

57 .99 rounded to two decimals places

Answers

57.99 rounded to two decimal places is 57.99.

assume that all the given functions have continuous second-order partial derivatives. if z = f(x, y), where x = r2 s2 and y = 6rs, find ∂2z/(∂r ∂s).

Answers

Given functions have continuous second-order partial derivatives. Value of ∂²z/∂s∂r is 24r² + 48rs.

How to calculate ∂²z/∂s∂r?

We can use the chain rule and product rule to find the second-order partial derivative of z with respect to r and s:

∂z/∂r = ∂z/∂x * ∂x/∂r + ∂z/∂y * ∂y/∂r

= 2rs * 2rs + 6s * 6r

= 24r²s + 24rs²

∂z/∂s = ∂z/∂x * ∂x/∂s + ∂z/∂y * ∂y/∂s

= 2rs * 2rs + 6r * 6s

= 24r²s + 36rs²

Taking the partial derivative of the first equation with respect to s, we get:

∂²z/∂s∂r = 24r² + 48rs

So the value of ∂²z/∂s∂r is 24r² + 48rs.

Learn more about partial derivatives.

brainly.com/question/31397807

#SPJ11

A train travelled along a track in 120 minutes, correct to the nearest 5 minutes

Sue finds out that the track is 290 km long.

She assumes that the track has been measured correct to the nearest 10 km.


a) Could the average speed of the train have been greater than 145 km/h? You must show how you get your answer and your final line must clearly say, 'Yes' or 'No'.


Sue's assumption was wrong.

The track was measured correct to the nearest 5 km.

b) What will the new maximum average speed be in km per minute? Give your answer correct to 2 decimal places.

Correct Answer gets brainliest.

Answers

a) To answer this question, we need to calculate the maximum average speed of the train.
- If the train travelled the full 290 km in 120 minutes, its average speed would be 290/120 = 2.42 km/min.
- If we round this value to the nearest whole number, the maximum average speed of the train would be 2 km/min.

Since 2 km/min is equal to 120 km/h, which is less than 145 km/h, the answer is NO, the average speed of the train could not have been greater than 145 km/h.

b) If the track was measured correct to the nearest 5 km, the actual length of the track could be anywhere between 287.5 km and 292.5 km.
- If we assume that the train travelled the full 292.5 km in 120 minutes, its average speed would be 292.5/120 = 2.4375 km/min.
- If we round this value to 2 decimal places, the new maximum average speed of the train would be 2.04 km/min.

Therefore, the new maximum average speed of the train would be 2.04 km/min.

(1 point) find a particular solution to ″ 6′ 8=54.

Answers

Therefore, a particular solution to the equation y″ + 6y′ + 8y = 54 is yp = 27/4.

To find a particular solution to the equation y″ + 6y′ + 8y = 54, we can use the method of undetermined coefficients.

First, identify the general form of the particular solution based on the non-homogeneous term: Since the right side of the equation is a constant (54), we can guess that the particular solution will be in the form of yp = A, where A is a constant.

Next, substitute the guess into the equation: The first and second derivatives of yp = A are both 0 (y′ = 0, y″ = 0). So, substituting into the equation, we get 0 + 6(0) + 8A = 54.

Now, solve for the constant A: 8A = 54, so A = 54/8 = 27/4.

To know more about second derivatives click on below link:

https://brainly.com/question/29090070#

#SPJ11

Find the distance from (-2,5) to (5,9) (round to the nearest tenth)

Answers

Answer:

8.1 hope this helps

Step-by-step explanation:

7 to the power of 2 and 4 to the power of 2

16 + 49 = 65

65 rounded to the nearest tenth is 8.1

Answer:

8.1

Step-by-step explanation:

Distance (d) = √(5 - -2)2 + (9 - 5)2

= √(7)2 + (4)2

= √65

= 8.0622577482985

After rounding

8.1

Jerry’s grandmother worked in a department store for many years. Now that she has retired,she receives a monthly Social Security check.Jerry’s grandmother and her employer paid a tax during her working years that helped fund Social Security. Which is the tax?

Answers

The tax that Jerry's grandmother and her employer paid during her working years that helped fund Social Security is called the FICA tax. FICA stands for Federal Insurance Contributions Act, and it is a payroll tax that is used to fund Social Security and Medicare. The FICA tax is split between the employer and the employee, with each paying a portion of the tax. The employee's portion of the FICA tax is deducted from their paycheck, while the employer's portion is paid separately.

Tom buys a radio for £40
Later he sells it and makes a profit of 20%
Tom says:
"The ratio of the price I paid for the radio to the price I sold the radio is 5:6”

Enter a ratio that, when simplified, would show that Tom is correct.

Answers

Answer: he is correct

Step-by-step explanation:

40 x 1.2 = 48        

40:48  

divided by 8

=5.6

find the area under the standard normal curve to the right of z=0.81z=0.81. round your answer to four decimal places, if necessary

Answers

The area under the standard normal curve to the right of z=0.81 is approximately 0.2090. To find this area, we first look up the area to the left of z=0.81 in a standard normal table or calculator, which is approximately 0.7910. We then subtract this value from 1 since the total area under the standard normal curve is 1. The result is approximately 0.2090, which is the area under the standard normal curve to the right of z=0.81.

To find the area under the standard normal curve to the right of z=0.81, follow these steps:

1. Look up the z-score of 0.81 in a standard normal table or use a calculator with a built-in z-table function. This will give you the area to the left of z=0.81.

2. Since the total area under the standard normal curve is equal to 1, subtract the area to the left of z=0.81 from 1 to find the area to the right of z=0.81.

3. Round your answer to four decimal places, if necessary.

After looking up the z-score of 0.81 in a standard normal table, we find the area to the left is approximately 0.7910. Subtracting this value from 1, we get:

1 - 0.7910 = 0.2090

So, the area under the standard normal curve to the right of z=0.81 is approximately 0.2090.

Learn more about the standard normal curve :

https://brainly.com/question/28971164

#SPJ11

Working alone John can wash the windows of a building in 2.5 hours Caroline can wash the building windows by her self in 4 hours if they work together how many hours should it take to wash the windows

Answers

It should take John and Caroline approximately 0.1538 hours, or about 9.2 minutes, to wash the building windows when working together.

To solve this problem, we can use the formula:

Time taken when working together = (product of individual times) / (sum of individual times)

Let's first find the individual rates of work for John and Caroline:

John's rate of work = 1/2.5 = 0.4 windows per hour

Caroline's rate of work = 1/4 = 0.25 windows per hour

Now, we can substitute these values into the formula to find the time taken when working together:

Time taken = (0.4 x 0.25) / (0.4 + 0.25)

= 0.1 / 0.65

= 0.1538 hours

To learn more about time and work click on,

https://brainly.com/question/30316123

#SPJ1

The position vector r describes the path of an object moving in space. Position Vector Time r(t)= 3ti + tj + 1/4t^2k t=2 Find the velocity vector, speed and acceleration vector of the object. v(t)=___
s(t)=___
a(t)=___

Answers

The velocity vector at t=2 is 3i + j + k.

The speed at t=2 is sqrt(11).

The acceleration vector at t=2 is 1/2k.

To find the velocity vector, we need to take the derivative of the position vector with respect to time:
v(t) = dr/dt = 3i + j + 1/2t k

Substituting t=2, we get:
v(2) = 3i + j + k

To find the speed, we need to take the magnitude of the velocity vector:
s(t) = |v(t)| = sqrt(3^2 + 1^2 + 1^2) = sqrt(11)

Substituting t=2, we get:
s(2) = sqrt(11)

To find the acceleration vector, we need to take the derivative of the velocity vector with respect to time:
a(t) = dv/dt = 1/2k

Substituting t=2, we get:
a(2) = 1/2k

Therefore, the velocity vector at t=2 is 3i + j + k, the speed at t=2 is sqrt(11), and the acceleration vector at t=2 is 1/2k.

To learn more about velocity vector visit : https://brainly.com/question/626479

#SPJ11

suppose an = 2n2 n -4 .. find a closed formula for the sequence of differences by computing . simplify your answer as much as possible.

Answers

The closed formula for the sequence of differences is:
Δan = 3n

To find the sequence of differences for the given sequence, we subtract each term from the next term. So, the sequence of differences is:
2(2n + 1)

To find a closed formula for this sequence of differences, we can use the formula for the sum of the first n natural numbers:
sum = n(n+1)/2

Using this formula, we can write the sequence of differences as:
sum from i=1 to n of [2(2i + 1)]
= 2 sum from i=1 to n of [2i + 1]
= 2 [n(n+1) + n]
= 2n^2 + 4n
Therefore, the closed formula for the sequence of differences is 2n^2 + 4n.

Learn more about the sequence:

brainly.com/question/30262438

#SPJ11

Find the sum of the following series. Round to the nearest hundredth if necessary.

Answers

The sum of the finite geometric series in the problem is given as follows:

26,240.

How to obtain the sum of the finite geometric series?

The first term of the series is given as follows:

[tex]a_1 = 8[/tex]

The common ratio of the series is given as follows:

r = 3.

(as each term is the previous term multiplied by 3).

The rule for the nth term of the series is given as follows:

[tex]a_n = 8(3)^{n - 1}[/tex]

Considering that the final term is of 17496, the value of n is given as follows:

[tex]17496 = 8(3)^{n - 1}[/tex]

3^(n - 1) = 2187

3^(n - 1) = 3^7

n - 1 = 7

n = 8.

Hence the sum of the series is given as follows:

S = [8 - 8 x 3^8]/-2

S = 26,240.

More can be learned about geometric series at https://brainly.com/question/24643676

#SPJ1

express the quotient z = 1 3i 6 8i as z = reiθ .

Answers

The polar form of the complex number quotient z = (1+3i)/(6+8i) is z = (1/sqrt(10))e^(i0.262)

To express the complex number quotient z = (1+3i) / (6+8i) in polar form, we need to find its magnitude (r) and argument (θ).

First, we find the magnitude of z:

|z| = sqrt( (1^2+3^2) / (6^2+8^2) )

|z| = sqrt(10/100)

|z| = sqrt(1/10)

|z| = 1/sqrt(10)

Next, we find the argument of z:

θ = arctan(3/1) - arctan(8/6)

θ = arctan(3) - arctan(4/3)

θ ≈ 0.262 radians

The polar form is z = (1/sqrt(10))e^(i0.262)

This represents the magnitude and direction of the complex number in terms of its distance from the origin (magnitude) and its angle with respect to the positive real axis (direction).

Learn more about complex number here

brainly.com/question/30340045

#SPJ4

The given question is incomplete, the complete question is:

Express the quotient z = 1+3i /  6 +8i as z = re^(iθ)

if 3/4 cup of flour is used to make 4 individual pot pies, how much flour should be used to make 12 pot pies

Answers

Using proportion, amount of flour used to make 12 pot pies is 2.25 cups.

Given that,

Amount of flour used to make 4 individual pot pies = 3/4 cups

We have to find the amount of flour used to make 12 individual pot pies.

This can be found using the concept of proportion.

Using the concept of proportion,

Amount of flour used to make 1 individual pot pie = 3/4 ÷ 4

                                                                                  = 3/16 cups

Amount of flour used to make 12 individual pot pies = 12 × 3/16 cups

                                                                                       = 2.25 cups.

Hence the amount of flour used is 2.25 cups.

Learn more about Proportions here :

https://brainly.com/question/29774220

#SPJ1

An A.P has common difference d.If the sum of of the first twenty terms is twenty five times the first term, find in terms of d, the sum of thirty terms.

Answers

The sum of the first 30 terms in terms of d is 815d.

What is sum?

In mathematics, the sum refers to the result of adding two or more numbers together. The process of adding numbers is called addition and the result of the addition is the sum.

What is arithmetic progression?

An arithmetic progression (AP) is a sequence of numbers in which each term (except the first term) is obtained by adding a fixed constant to the preceding term. This fixed constant is called the common difference of the arithmetic progression.

According to given information:

The sum of the first n terms of an arithmetic progression (A.P) is given by the formula:

[tex]S_n = [n/2] * [2a + (n-1)d][/tex]

where a is the first term and d is the common difference.

Given that the sum of the first 20 terms is 25 times the first term, we have:

[tex]S_{20} = 25a[/tex]

Substituting into the formula above, we get:

[tex]25a = [20/2] * [2a + (20-1)d]\\\\25a = 10a + 190d\\\\15a = 190d\\\\a = (190/15)d\\\\a = 38/3 d[/tex]

So the first term in terms of d is 38/3d.

Now we can use the formula to find the sum of the first 30 terms:

[tex]S_{30} = [30/2] * [2(38/3d) + (30-1)d]\\\\S_{30} = 15 * [76/3d + 29d]\\\\S_{30} = 5 * [76d + 87d]\\\\S_{30} = 815d[/tex]

Therefore, the sum of the first 30 terms in terms of d is 815d.

To know more about sum visit:

https://brainly.com/question/24205483

#SPJ1

halp il give all the points just help me

Answers

Answer:

Step-by-step explanation:

-5/2

To find the slope you need to use rise/run which is basically difference of y coordinates over difference of x coordinates

so first, pick 2 coordinates that you know in that linear relationship like in this case

(0,3) and (2,-2)

do rise/run which will look like this

=(y2-y1)/(x2-x1)

=(3-(-2))/(0-2)

=-5/2

Evaluate the following integral by converting to polar coordinates.
∫10∫√2−x2x(x+2y)dydx

Answers

The value of the given integral is 1/2.

To convert the integral to polar coordinates, we need to find the polar limits of integration and the Jacobian.

The region of integration is the half-disk with radius 1 centered at the origin in the first quadrant. In polar coordinates, this region is described by 0 ≤ r ≤ 1 and 0 ≤ θ ≤ π/2.

The Jacobian is r.

So, we have:

∫10∫√2−x2x(x+2y)dydx = ∫0π/2 ∫01 (r cosθ)(r cosθ + 2r sinθ) r dr dθ

= ∫0π/2 ∫01 r3(cos2θ + 2sinθ cosθ) dr dθ

= ∫0π/2 [(1/4)(cos2θ + 2sinθ cosθ)] dθ

= [(1/4)(sin2θ + 2sin2θ/2)]|0π/2

= (1/2)

Therefore, the value of the given integral is 1/2.

To learn more about coordinates, visit:

https://brainly.com/question/16634867

#SPJ11

The value of the given integral is 1/2.

To convert the integral to polar coordinates, we need to find the polar limits of integration and the Jacobian.

The region of integration is the half-disk with radius 1 centered at the origin in the first quadrant. In polar coordinates, this region is described by 0 ≤ r ≤ 1 and 0 ≤ θ ≤ π/2.

The Jacobian is r.

So, we have:

∫10∫√2−x2x(x+2y)dydx = ∫0π/2 ∫01 (r cosθ)(r cosθ + 2r sinθ) r dr dθ

= ∫0π/2 ∫01 r3(cos2θ + 2sinθ cosθ) dr dθ

= ∫0π/2 [(1/4)(cos2θ + 2sinθ cosθ)] dθ

= [(1/4)(sin2θ + 2sin2θ/2)]|0π/2

= (1/2)

Therefore, the value of the given integral is 1/2.

To learn more about coordinates, visit:

https://brainly.com/question/16634867

#SPJ11

solve differential equation dy/dx=y^2 . 16y(2)=0

Answers

The particular solution corresponding to the initial condition 16y(2) = 0 (which I assume means y(2) = 0), we can plug x = 2 and y = 0 into the equation:
-1/0 = 2 + C

To solve the differential equation dy/dx=y^2, we can separate the variables and integrate both sides.
dy/y^2 = dx

Integrating both sides:
-1/y = x + C

where C is the constant of integration. Solving for y:
y = -1/(x+C)

To solve the second part of the question, 16y(2) = 0, we substitute y(2) into the equation we just found:
y(2) = -1/(2+C)
16y(2) = 16*(-1/(2+C)) = -16/(2+C) = 0

Solving for C:
-16 = 0*(2+C)

Thus, C can be any value since 0 multiplied by any number is 0. Therefore, the solution to the differential equation dy/dx=y^2 and the equation 16y(2)=0 is y = -1/(x+ C), where C is any constant.

Learn more about Equation:

brainly.com/question/29538993

#SPJ11

Suppose the following system of equations has a solution of (

5,

1), where A, B, C, D, E, and F are real numbers.
Ax+By=C
Dx+Ey=F
Which systems are also guaranteed to have a solution of (–5,–1)? Select all that apply.

Answers

As a result, none of the above systems have a solution of (-5,-1).

How to find the system has a solution or not?

To see which systems have a solution of (-5, -1), enter x=-5 and y=-1 into the two equations and see if they are both true at the same time.

So, let's enter the values:

A(-5) + B(-1) = C is the solution to the first equation.

To simplify: -5A - B = C

D(-5) + E(-1) = F is the solution to the second equation.

Simplifying: -5D - E = F

As a result, the equation system can be represented as:

-5A = C -5D = E = F

Now we may enter x=-5 and y=-1 into the system and see if the equations still hold true.

When A=1, B=-5, and C=20, the expression -5A - B = C should be true.When D=1, E=-5, and F=30, D - E = F should be true.

As a result, the equation system becomes:

1x - 5y = 20

1x - 5y = 30

If we attempt to solve We have a contradiction in this system since the two equations are incompatible. As a result, there is no solution to this system of equations that meets (-5,-1).

As a result, none of the above systems have a solution of (-5,-1).

Learn more about the system of the solution here:

https://brainly.com/question/28971387

#SPJ1

Complete question:

Suppose the following system of equations has a solution of

where A, B, C, D, E, and F are real numbers.

Ax+By=C

Dx+Ey=F

Which systems are also guaranteed to have a solution of (–5,–1)? Select all that apply.

A histogram of the sale price of (a subset of) homes in Ames, and a scatterplot of first floor area vs. sale price of the same homes are given below. 400 300 6e+05 200 4e+05 count Sale Price (dollars) 100 - 2e+05 Oe+00 - Oe+00 2e+05 8e+C 1000 3000 4e+05 6e+05 Sale Price (dollars) 2000 First Floor Area (sq. feet) (a) Describe the shape of the histogram of sale price of houses. (Where are the majority of sale prices located? Where are the minority of sale prices located?) (b) Are exponential, normal, or gamma distributions reasonable as the population distribution for the sale price of homes? Justify your answer. (c) Describe the relationship between first floor sq footage and sale price. (What happens to price as the area increases? What happens to the variability as area increases?)

Answers

The histogram of the sale price of houses appears to be skewed to the right, indicating that the majority of sale prices are located on the lower end of the price range. The majority of sale prices seem to be located between $100,000 and $400,000, with very few sale prices above $600,000.

An exponential distribution would not be a reasonable fit for the sale price of homes because it assumes a continuous variable with a constant rate of change. The sale price of homes is not a continuous variable, as it is determined by factors such as location, condition, and size. A normal distribution could potentially be a reasonable fit if the data was centered around a mean and did not have any significant outliers. However, as the histogram shows a skewed distribution, a gamma distribution may be a more appropriate fit as it allows for skewness in the data.

The scatterplot of first floor area vs. sale price shows a positive relationship between the two variables. As the first floor area increases, the sale price tends to increase as well. However, there appears to be a lot of variability in the sale price as the area increases. This suggests that other factors may be influencing the sale price of homes, in addition to the size of the first floor area.

Know more about histogram here:

https://brainly.com/question/30354484

#SPJ11

A= 5 0 0 09 1 -3 4-4 -1 -2 1-4 -1 -7 6has two distinct real eigenvalues λ1<λ2. find the eigenvalues and a basis for each eigenspace. the smaller eigenvalue λ1 is_____ and a basis for its associated eigenspace is___ The larger eigenvalue λ2 is____ and a basis for its associated eigenspace is ____

Answers

The smaller eigenvalue λ1 is -2 and a basis for its associated eigenspace is {-1, 2, -1, 0}. The larger eigenvalue λ2 is 3 and a basis for its associated eigenspace is {0, -1, -1, 1}.

How to find the eigenvalues and eigenvectors?

We need to solve the characteristic equation and the corresponding eigenvector equations.

The characteristic equation is:

det(A - λI) = 0

where I is the 4x4 identity matrix.

Expanding the determinant, we get:

(5 - λ)((1 - λ)(-7 - λ) - 6) - 0 + 0 - 0 = 0

Simplifying and solving for λ, we get:

λ^2 - λ - 6 = 0

(λ - 3)(λ + 2) = 0

So, the eigenvalues are λ1 = -2 and λ2 = 3.

Now, we need to find the eigenvectors corresponding to each eigenvalue.

For λ1 = -2, we need to solve the equation:

(A - λ1I)x = 0

Substituting λ1 = -2 and solving the system of equations, we get:

x1 = -1, x2 = 2, x3 = -1, x4 = 0

So, a basis for the eigenspace associated with λ1 is:

{-1, 2, -1, 0}

For λ2 = 3, we need to solve the equation:

(A - λ2I)x = 0

Substituting λ2 = 3 and solving the system of equations, we get:

x1 = 0, x2 = -1, x3 = -1, x4 = 1

Basis for the eigenspace connected to λ2 is:

{0, -1, -1, 1}

Therefore, the smaller eigenvalue λ1 is -2 and a basis for its associated eigenspace is {-1, 2, -1, 0}. The larger eigenvalue λ2 is 3 and a basis for its associated eigenspace is {0, -1, -1, 1}.

Learn more about eigenvalue.

brainly.com/question/29749542

#SPJ11

A home has a rectangular kitchen. If listed as ordered pairs, the corners of the kitchen are (11, 5), (−6, 5), (11, −2), and (−6, −2). What is the area of the kitchen in square feet?

A. 119 ft2
B. 49 ft2
C. 48 ft2

Answers

Answer:

A. 119 ft2

Step-by-step explanation:

(11, 5) and (-6, 5)

= 11 - (-6)

= 17 feet

(11, 5) and (11, -2)

= 5 - (-2)

= 7 feet

17 × 7 = 119 square feet

Other Questions
1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose? Question 1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose? You are spinning two identical balls attached to strings in uniform circular motion, Ball 2 has a string that is twice as long as the string with ball 1, and the rotational speed (v) of ball 2 is three times the rotational speed of ball 1. What is the ratio of the centripetal force of ball 2 to that of ball 1? Select all of the ratios that are equivalent to 1:5. What starting alkyl halide and ketone would give 2-methyl-2-pentanol? Write a grignard synthesis for this reaction. Please help!!!There is a photo! Pleasee help!! to the principal for remission of fine What are the bond angles? You want to buy a house within 3 years, and you are currently saving for the down payment.You plan to save $5000 at the end of the first year, and you anticipate that your annual savingswill increase by 10 % annually thereafter. Your expected annual return is 7%. How much wouldyou have for a down payment at the end of year 3? how do the values of the integral 1 2 q/t compare for a reversible and irreversible process between the same end states? calculate the change in entropy for the vaporization of xe at its boiling point of -107 c given that vaph = 12.6 kj/mol. 1. -0.118 j/k mol 2. -13.2 j/k mol 3. 0.750 j/k mol 4. 75.9 j/k mol FeatureThe Ethanol DebateNatalie StewartOur society has recently undergone a shift towards greener living. People have grown more aware of how their actions seriously and negatively impact the environment. Many are seeking out new ways to decrease pollution levels and to find cleaner energy sources to power their homes and businesses. Ethanol is an increasingly popular fuel alternative to gasoline, made from distilled, fermented corn. The benefits of ethanol include lowering the amount of harmful carbon dioxide gases released into the air by burning fossil fuels like gasoline, as well as decreasing the United States dependence on foreign oil. Though many people support the production of ethanol for use as an alternative fuel, most of them ignore the serious drawbacks of ethanol use.One important economic factor in producing ethanol is its influence on the price of corn. Corn prices have more than doubled since 2005 because of increased demand, according to financial experts. Farmers know that corn is highly sought after, so they allot more space on their farms to grow large amounts of corn. This leaves less room for growing other kinds of crops, such as wheat or soybeans. These smaller amounts force suppliers to raise the prices of these now secondary crops as well. Bread and cereal manufactures are also involved in the economics of ethanol. These companies then pass rising costs of their crops to consumers, leading to higher prices at the grocery store.Corn is also a common source of food for livestock. Many farmers are now struggling to feed their herds of cows, chickens, and pigs. The increased cost of feeding their animals has forced many farmers to reduce the size of their herds, decreasing the supply of meat available to consumers. Shoppers are certain to see the prices of beef, chicken, and pork increase if corn prices continue to skyrocket. Unfortunately, hardworking farmers and ranchers see very little profits from this increase in price. Many of them oppose ethanol as an alternative fuel source because of the extreme impact it is having on their way of life.In addition, opponents of ethanol note that government subsidies cost American taxpayers more money. State and federal government subsidy programs offer tax credits to gas stations for each gallon of ethanol they mix in with the gasoline they sell. Government programs also supply companies that produce ethanol with corn! Where does the government get the money for these subsidies? Money for these projects comes from ourthe taxpayerspockets. These costs are in addition to rising fuel prices, which are currently almost four dollars per gallon. Many people are disappointed in ethanol because they believed that it would help reduce the price at the pump, not increase it. Overall, it would be more cost-effective for everyone if the government pursued other options for fuel and energy sources.Ethanol has some benefits. However, overenthusiastic supporters should consider all sides of the issue before taking actions that are already putting Americas economy in a precarious position. Ethanol is not the answer to our economic and environmental problems. Instead of focusing on a technology that is too costly to be practical, we should be encouraging our government to continue investing in other alternatives. Only then will we see our food and energy prices stabilize. Which two pieces of evidence from the passage support the author's point of view as identified in the previous question?ResponsesA The increased cost of feeding their animals has forced many farmers to reduce the size of their herds, decreasing the supply of meat available to consumers.The increased cost of feeding their animals has forced many farmers to reduce the size of their herds, decreasing the supply of meat available to consumers.B People have grown more aware of how their actions seriously and negatively impact the environment.People have grown more aware of how their actions seriously and negatively impact the environment.C Another benefit of ethanol is decreasing the United States dependence on foreign oil.Another benefit of ethanol is decreasing the United States dependence on foreign oil.D One benefit of ethanol includes lowering the amount of harmful carbon dioxide gases released into the air by burning fossil fuels like gasoline.One benefit of ethanol includes lowering the amount of harmful carbon dioxide gases released into the air by burning fossil fuels like gasoline.E Many people are disappointed in ethanol because they believed that it would help reduce the price at the pump, not increase it. Please answer question #35 According to Thomson Financial, last year the majority of companies reporting profits had beaten estimates. A sample of 162 companies showed that 94 beat estimates, 29 matched estimates, and 39 fell short.(a) What is the point estimate of the proportion that fell short of estimates? If required, round your answer to four decimal places.pshort = .2407(b) Determine the margin of error and provide a 95% confidence interval for the proportion that beat estimates. If required, round your answer to four decimal places.ME = (c) How large a sample is needed if the desired margin of error is 0.05? If required, round your answer to the next integer.n* = Discussion What part of the life cycle is represented by the mature pollen grain int[] oldArray = {1, 2, 3, 4, 5, 6, 7, 8, 9}; int[newArray = new int[3][3]; int row = 0; int col = 0; for (int index = 0; index < oldArray.length; index++) { newArray[row][col] = oldArray[index]; row++; if ((row % 3) == 0) { col++; row = 0; } } System.out.println(newArray[0][2]); What is printed as a result of executing the code segment? Determine if each of the following relationships represents a proportional relationship or not.SELECT ALL situations that represent a proportional relationship.A). Natalia is selling fresh eggs at the local farmer's market. She sells 6 eggs for $3.12, a dozen eggs for $6.24, and eighteen eggs for $9.36.B). Joey is training for a bicycle race and has been completing his longer training rides on Saturdays. Over the past month, Joey has ridden his bicycle 36 miles in 3 hours, 46 miles in 4 hours, and 22 miles in 2 hours.C). graph 1 provided in the picturesD). graph 2 provided in the picturesE). Azul bought several different packages of 8-inch by 10-inch art canvases for craft project at her family reunion. The number of canvases in a package and the cost of the package is shown in the table. (TABLE PROVIDED IN PICTURES)F). Kareem is comparing the cost of regular unleaded gasoline at three different gas stations near his home. Instead of filling up his car's gas tank at one station, he puts a few gallons in at each of the three different stations. The number of gallons of gasoline and the cost of the gasoline is shown in the table. (TABLE PROVIDED IN PICTURES) In the financial statements, dividends in arrears on cumulative preferred stock should be _____Select one: a classified as an offset to retained earnings b. classified as a liability either current or long term.C. disclosed in the footnotes. d. classified as an offset to net income f q1 has the same magnitude as before but is negative, in what region along the x-axis would it be possible for the net electric force on q3 to be zero? (a) x , 0 (b) 0 , x , 2 m (c) 2 m , x Janelys has a bag of candy full of 15 strawberry chews and 5 cherry chews thatshe eats one at a time. Which word or phrase describes the probability thatshe reaches in without looking and pulls out a strawberry chew? The purpose of this homework is to write an image filtering function to apply on input images. Image filtering (or convolution) is a fundamental image processing tool to modify the image with some smoothing or sharpening affect. You will be writing your own function to implement image filtering from scratch. More specifically, you will implement filter( ) function should conform to the following:(1) support grayscale images,(2) support arbitrarily shaped filters where both dimensions are odd (e.g., 3 3 filters, 5 5 filters),(3) pad the input image with the same pixels as in the outer row and columns, and(4) return a filtered image which is the same resolution as the input image.You should read a color image and then convert it to grayscale. Then define different types of smoothing and sharpening filters such as box, sobel, etc. Before you apply the filter on the image matrix, apply padding operation on the image so that after filtering, the output filtered image resolution remains the same. (Please refer to the end the basic image processing notebook file that you used for first two labs to see how you can pad an image)Then you should use nested loops (two for loops for row and column) for filtering operation by matrix multiplication and addition (using image window and filter). Once filtering is completed, display the filtered image.Please use any image for experiment.