The interior of a car is designed around the physical needs of the average person. Measurements are made so the average person can reach the steering wheel and pedals comfortably and so the radio controls are within a comfortable reach. Of which of the following is this an example of?

Answers

Answer 1

The radio controls are positioned according to measurements that ensure the average person can comfortably reach the steering wheel, pedals, and radio. An illustration of ergonomics is this.

What does ergonomics mean in the workplace?

A task will be tailored to the worker by an ergonomics specialist in order to make it safer and more effective. By integrating ergonomic solutions that give workers more comfort, productivity can be increased.

The definition of ergonomics given by Merriam-Webster is: "An applied science concerned with designing and positioning objects that people use to interact with each other in the most efficient and secure manner." Manufacturers place a great priority on the establishment of a setting that is both incredibly safe and productive.

The importance of ergonomics

Put these simple suggestions into practice to make your workstation more ergonomic. Ergonomics can increase your performance and productivity while lowering your risk of injury and weariness by changing factors like the height of your desk and the angle of your computer monitor.

Learn more about ergonomics: https://brainly.com/question/17408983

#SPJ4


Related Questions

barrackpore meerut
gorakpore dandi champaran​

Answers

1. Barrackpore 2. Delhi 3. Chauri Chaura 4. Champaran 5. Jallianwalla Bagh 6. Dandi 7. Kheda 8. Meerut 9. Lucknow 10. Ahmedabad.

FILL IN THE BLANK a serious candidate for a u.s. house of representatives race must raise at least several ________dollars, while a serious candidate for a u.s. senate race must raise at least several _____dollars.

Answers

A serious candidate for a u's house of representatives race must raise at least several hundred thousand dollars, while a serious candidate for a u's senate race must raise at least several million dollars.

What qualifications are needed to run for office in the US House of Representatives?

No one may serve as a representative unless they are at least twenty-five years old, have been citizens of the United States for seven years, and are residents of the state in which they are elected at the time of their election.

What criteria are there to be elected to the House of Representatives?

House: be at least 25 years old, a resident of the state from which he or she is elected, and a citizen for at least 7 years.

To Know more about  million

https://brainly.com/question/28200508

#SPJ4

the compares the number of reported or discovered crimes to the number of crimes solved through arrest or other means.

Answers

The clearance rate compares the number of reported or discovered crimes to the number of crimes solved through arrest or other means.

What does the clearance rate refer to?

When arrests "clear" a crime, law enforcement authorities consider the crime to be solved. Clearance rates can therefore be used as a measure of both police-community cooperation and efficacy. A law enforcement agency's "clearing rate" is the percentage of cases it successfully resolves. It is one way to gauge how adept and effective a certain agency is at resolving crimes, although, if it is utilized at all, it is frequently done in conjunction with numerous other metrics.

By dividing the total number of crimes that have been reported by the number of crimes that have been "cleared," the clearance rate in criminal justice is determined. In order to gauge how many crimes the police have solved, different groups employ clearance rates.

To learn more about criminal justice, visit:

https://brainly.com/question/28550060

#SPJ4

pam witnessed a murder during a robbery. now, she has intrusive thoughts of the event, nightmares, sleeplessness, anxiety, and feels emotionally numb. she is likely suffering from

Answers

In the situation given above, it can be concluded to mention that the condition that Pam is going through is most likely the post-traumatic stress disorder.

A post-traumatic stress disorder can be referred to or considered as a form of a psychological or a mental state wherein a person experiences the happening of intrusive thoughts. Moreover, such a mental condition can also be caused due to highly uncertain or disturbing events to take place. It is the disorder most likely faced by Pam in the aforementioned situation.

Learn more about post-traumatic stress disorder here:

https://brainly.com/question/13097232

#SPJ4

an individual with a schizotypal personality disorder will usually exhibit all of these symptoms except:

Answers

An individual with a schizotypal personality disorder will usually exhibit all of these symptoms except: affective flattening

What is schizotypal personality disorder?A persistent pattern of extreme discomfort with interpersonal relationships and social interactions is a defining characteristic of schizotypal personality disorder (STPD), a mental health disease. Superstitions, flawed reality views, and strange actions are all characteristics of STPD patients. Typically, these symptoms interfere with their relationships.Peculiar, quirky, or strange ways of thinking, believing, or doing. ideas that are suspicious or paranoid, and persistent uncertainty about the loyalty of others. belief in superstitions or unique abilities like mental telepathy. unusual perceptions, such feeling the presence of someone who isn't there or seeing illusionsBrain damage, including brain dysfunction. Including instances of abuse or neglect in childhood being raised by a parent who is distant or chilly. sickness or injury before or during pregnancy. a history of psychotic outbursts or delusionary spells triggers schizotypal personality disorder.

Learn more about schizotypal personality disorder refer to :

https://brainly.com/question/6982763

#SPJ4

the area of the somatosensory cortex that is devoted to a particular region of the body is relative to the

Answers

The area of the somatosensory cortex that's devoted to a particular region of the body is relative to the density of the cutaneous tactile receptors that are located in that region of the body.

The somatosensory cortex is a part of the brain that is responsible for receiving and processing sensory information that are happening across the body, like pain, touch, and temperature. It's related to the cutaneous receptor, the sensory receptor in the skin that receives information about pressure, pain, and temperature.

The body part that has the most somatosensory cortex devoted is the hands and the lip. That's why those two are very sensitive to sensations.

Attached below is an image made by Blausen Medical that shows where the somatosensory cortex is located in the brain (colored purple).

Learn more about somatosensory cortex at https://brainly.com/question/5457822
#SPJ4

three major obstacles standing in the way of effective emotional communication are . group of answer choices western syndrome, the cowboy syndrome, and inadequate interpersonal skills fear, the cowboy syndrome, and emotional contagion emotional contagion, society's rules and customs, and fear society's rules and customs, fear, and inadequate interpersonal skills

Answers

Out of the choices given above, it can be said that the three major obstacles standing in the way of effective emotional communication are society's rules and customs, fear, and inadequate interpersonal skills. Therefore, the option D holds true.

An effective communication can be referred to or considered as the communication, wherein there is a smoothness being experienced in the way a communication develops between two or more people. However, most of the communications do not become effective, especially when they are emotional due to the fear of inadequate skills and social customs.

Learn more about effective communication here:

https://brainly.com/question/1423564

#SPJ4

According to the textbook, which of these events would have the highest likelihood of causing posttraumatic stress disorder? a fire to one's home that left no remains reading about the death of dozens of people in a terrible airplane crash surviving a hurricane that destroyed a city being assaulted and robbed of your cash and credit cards A Moving to another question will save this response Se here to search 0 RI DED 19 g a lije

Answers

Being assaulted and robbed of your cash and credit cards have the highest likelihood of causing posttraumatic stress disorder.

A terrible event, whether you really experience it or see it, can cause post-traumatic stress disorder (PTSD), a mental health condition. Flashbacks, nightmares, excruciating anxiety, and irrational thoughts about the incident are just a few symptoms that may appear. Most survivors of traumatic situations may initially struggle with adjusting and coping, but with time and proper self-care, they typically grow better. You might have PTSD if the symptoms worsen, last for weeks, months, or even years, and affect how you function on a daily basis. After PTSD symptoms start to manifest, seeking good treatment is often essential to reducing symptoms and enhancing function.

Learn more about posttraumatic stress disorder here:

https://brainly.com/question/28811192

#SPJ4

PLEASE HELP 10 POINTS

What was one major cultural change caused by the Industrial Revolution in the United States?

A.
More people began working for companies instead of for themselves.

B.
Children began to attend school rather than working in factories.

C.
The cost of most consumer goods rose rapidly because of greater demand.

D.
Women had fewer options for working outside the home.

Answers

Answer:

A. More people began working for companies instead of for themselves.

Answer:

A. More people began working for companies instead of for themselves.

Explanation:

Got it correct

which of the following occurs at the foot to help generate force during toe off during normal walking?Pronation Supination Neutral

Answers

Supination occurs at the foot to help generate force during toe off during normal walking.

Supination is a movement that aids in the generation of forces during toe off. Toe off, also known as the propulsive phase, is the last part of the stance phase. During toe off, the ankle supinates, which aids in propelling the body forward. When the weight is transferred forward and the big toe is flexed, the soft tissues in the arches tighten, which helps to support supination.

Supination is the movement of turning one's hand, wrist, and forearm upward. Supination is demonstrated by turning your hand over to accept money.

For more information on Supination , visit :

https://brainly.com/question/24246532

#SPJ4

which of the following is a government program to provide skills for success in school for lower socioeconomic status preschool children in the united states? multiple choice question.

Answers

I can get a ride home if I can get it done tomorrow if you want it done thanks bud bud merry Christmas merry thanksgiving to see everyone I know you were like oh my mom and I got a lot done on the way back to the park I was like I don’t have to

Any behavior that would increase the probability of an injury occurring is a(n): A. Unintentional injury. B. Unsafe act. C. Hazard D. Unsafe condition.

Answers

Any behavior that would increase the probability of an injury occurring is an unsafe act. Therefore, the option B holds true.

An unsafe act can be referred to or considered as an act, which involves the performance of an activity wherein the chances of safety of the performer is very less. The performance of an unsafe act is highly likely to give an invitation to the occurrence of an injury. It is an unideal behavior, and must be avoided by an individual to avoid unnecessary injuries to take place.

Learn more about an unsafe act here:

https://brainly.com/question/1191444

#SPJ4

if the court allows someone with a first operating under the influence (oui) conviction to complete an alcohol education course , what happens to the license suspension ?

Answers

Answer:

If the driver agrees to therapy and the judge determines that it would be beneficial, the judge may choose to drop the charges during a probationary period. The judge can still impose up to 30 hours of community service, and the accused will still be compelled to pay any penalties that would typically be imposed for an OUI conviction.

The judge will mandate the completion of a driving alcohol education programme as well as potential drug and alcohol treatment as terms of probation. For 45 to 90 days, the driver's licence will be suspended. A temporary hardship licence is offered at this time. Drivers under 21 and those whose blood alcohol content (BAC) is over.20% may be subject to additional licencing and treatment requirements.

Week 8 studies weekly

Answers

Fort Caroline

General Ribault

hemisphere

the idea that we observe objects with our senses as they actually are

Answers

Empiricism is an epistemic paradigm that maintains that sensory experience alone or predominantly provides knowledge or justification.

What is an empiricist view?Empiricism is the philosophical school of thought that holds that all conceptions are products of experience, that all concepts are about or pertain to objects that can be experienced, or that all reasonable views or propositions can only be known or justified by experience.Natural scientists frequently adopt the empiricism school of thought, which holds that knowledge is derived from experience and is provisional and probabilistic in nature, susceptible to ongoing revision and falsification. The scientific process is guided by empirical investigation, which includes experiments and approved measurement equipment.Empiricism about concepts and empiricism about knowledge are not necessarily mutually exclusive. Many empiricists acknowledge the existence of a priori propositions but disagree with the existence of a priori concepts. However, it is uncommon to come across a philosopher who accepts a priori notions but rejects a priori claims.

To learn more about Empiricism refer :

https://brainly.com/question/10795800

#SPJ1

Follow-up research on Piaget’s sensorimotor stage yields broad agreement on which of the following issues?A)Many cognitive changes of infancy are stagelike.B)Most aspects of infant cognition develop together.C)Many cognitive changes of infancy are gradual and continuous.D)Most aspects of infant cognition develop abruptly.

Answers

Option c: Many cognitive changes of infancy are gradual and continuous is the correct answer.

Jean William Fritz Piaget, a psychologist known for his work on child development. Piaget's cognitive development theory and epistemological view are collectively called "genetic epistemology".

Cognitive Development is the study of neurological and psychological development in children. Specifically, cognitive development is assessed based on levels of concepts, perceptions, information processing, and language as indicators of brain development.

According to Jean Piaget's theory of child development, the sensorimotor stage is the first stage of a child's life, which begins at birth.

To learn more about ‘cognitive development’, here:

https://brainly.com/question/28011228

#SPJ4

Some researchers suggest that the brain activity associated with REM sleep provides the sleeping brain with periodic stimulation. This finding supports which of the following dream theories?
O wish-fulfillment
O developmental
O information-processing
O physiological
O activation-synthesis

Answers

The prevailing ideas are physiological. Some researchers suggest that the REM-related brain activity periodically stimulates the sleeping brain.

What transpires in the brain during REM sleep? quizlet

Brain wave activity gradually decreases as a person moves from being completely awake to being in a deep sleep until it reaches the REM state. Brain wave activity rises to the same level as alert alertness during REM sleep.

What transpires during REM sleep in terms of brain activity?

The thalamus quiets down during the majority of the stages of sleep, allowing you to block out the outside world. However, the thalamus is active during REM sleep, sending the cortex pictures, noises, and other sensations that make up our dreams.

To know more about REM visit:-

https://brainly.com/question/29375406

#SPJ4

15. Randy's parents reward him with extra TV time when he completes his homework on time, and take away TV
time when he doesn't do his homework. What parenting style are Randy's parents demonstrating?
Hint: This parenting style rewards children for following rules.
A. Overbearing
B. Permissive
C. Authoritative
D. Absent

Answers

The  parenting style that Randy's parents are demonstrating is option C. Authoritative parenting style.

What does a strict parenting approach entail?

Parenting with authority is really strict. Parents want their children to adhere to the rules without question or compromise. Parents employ this method for a variety of factors. Many people adopt this stance because it is required by their nationality, culture, or ethical foundations.

Therefore, to reinforce excellent behavior, they also employ positive discipline techniques including reward and praise schemes. This parenting method tends to make kids self-disciplined and independent thinkers.

Learn more about Authoritative parenting style from

https://brainly.com/question/1286263
#SPJ1

3. The table shows some statistics for four WNBA teams in
the 2021 regular season. Which team scored the most points
per game on average?

Answers

Answer: points per game on average 87.0 Seattle storm.

Explanation:

Final answer:

The team that scored the most points per game on average is Team 1.

Explanation:The team that scored the most points per game on average is the Team 1.

To determine which team scored the most points per game on average, we need to divide the total points scored by each team by the number of games they played. Looking at the table, we can see that Team 1 has the highest average points per game, with an average of 90 points.

Team 2 has an average of 80 points per game, Team 3 has an average of 75 points per game, and Team 4 has an average of 85 points per game.

Learn more about Points per game here:

https://brainly.com/question/32015917

#SPJ2

where to find the process theory, content , and reinforment theory of motivation in the text mgt 420

Answers

Approaches to explaining and comprehending the elements influencing human behavior and motivation have been established, including the process theory, content theory, and reinforcement theory. These beliefs can be found in a number of places, such as scholarly works, books, and internet sites.

In order to determine if these theories are particularly stated in the text MGt 420, it would be beneficial to browse through the index or table of contents. As an alternative, you may try looking up these theories using relevant keywords or phrases like "process theory of motivation," "content theory of motivation," or "reinforcement theory of motivation."

If you are unable to locate these theories in MGt 420, you might wish to look for additional materials that go into greater depth about them. You may try looking for scholarly writings or books that concentrate on organizational behavior or motivation, or you could seek material up online using websites or online encyclopedias.

Learn  more about  motivation to visit this link

https://brainly.com/question/972761

#SPJ4

according to the textbook, an important lesson to keep in mind when considering research on situational vs. dispositional attributions is that

Answers

When considering research on situational vs. dispositional attributions, an important lesson to keep in mind is that our attributions are often more complex than the two categories suggest.

While it is true that we often form attributions based on the immediacy of the situation or the personality of the person involved, research has shown that there are a variety of factors that can influence our attributions.

For example, research has shown that our attributions can be affected by our own biases or goals. For example, if we are biased towards a particular outcome, we may be more likely to make a particular attribution.

Additionally, research has shown that our attributions can be impacted by our current state of mind or our prior experiences. For example, if we are feeling particular stressors or have experienced a similar situation before, we may be more likely to make a particular attribution.

Learn more about stressors at : https://brainly.com/question/29510175

#SPJ4

Nina is a mother. The responsibilities and expectations associated with this position constitute a social role. dilemma. identity. schema.

Answers

Option a: The responsibilities and expectations associated with the position of a mother constitute a social role.

Motherhood comes with a lot of responsibilities and expectations. Bearing a baby, getting adjusted to the new feeling, new changes in oneself and from the surrounding environment.

A social role is a set of related behaviors, rights, duties, beliefs, and norms that people consider in social situations. It is expected, free, or ever-changing behavior that may have a particular individual's social status or status.

To know more about the social role, here:

https://brainly.com/question/11477014

#SPJ4

bonnie has been diagnosed with a personality disorder. her sense of self is unstable, and she is often irritable and unpredictable. which of the following personality disorders best describes bonnie?

Answers

A personality condition has been identified in Bonnie. She is frequently agitated and unpredictable, and her sense of self is unsteady. Bonnie Borderline is most like one of the following personality disorders.

What disorder affects a person's feelings, mood, and behavior?

A complicated psychotic condition called schizophrenia is characterized by disturbances in thinking, feeling, and reality perception. Among the many symptoms of schizophrenia include hallucinations, delusions, thought disorders, social disengagement, a lack of desire, and cognitive and memory impairment.

Which of the following describes the avoidant personality disorder quizlet's characteristic?

a sense of inadequate.

What of the following can contribute to the onset of schizophrenia?

According to research, a person may be more susceptible to acquire the illness if a combination of physical, genetic, psychological, and environmental factors are present. Because certain people are predisposed to schizophrenia, a difficult or upsetting life event could set off a psychotic break.

To Know more about Borderline

https://brainly.com/question/6819563

#SPJ4

____ is the skillful analysis and evaluation of existing ideas or problems. group of answer choices critical thinking thinking scholarly thinking cognitive analysis

Answers

The effective investigation and evaluation of current concepts or issues are known as critical thinking. The right response in this case is option A.

The process of actively and successfully conceiving, analyzing, applying,  synthesizing, and/or evaluating knowledge as a basis for belief and action is known as critical thinking. It requires intellectual discipline.

By employing critical thinking to better understand oneself, you can concentrate more on your advantages and avoid holding any kind of constricting or negative views. The ability to communicate your views may improve your quality of life.

The most important aspect of learning is critical thinking since it helps students reflect on and comprehend their own points of view. This ability aids a pupil in understanding the world through their own observations and insights.

Complete question:

____ is the skillful analysis and evaluation of existing ideas or problems. group of answer choices

A - critical thinking

B - scholarly thinking

C - cognitive analysis

To learn more about critical thinking

https://brainly.com/question/29775568

#SPJ4

Calculate the total revenue if the firm produces 20 versus 19 units. Then, calculate the marginal revenue of the 20th unit produced.

Answers

The marginal revenue of the 20th unit produced is $33.

What is marginal revenue?

Marginal revenue is the money a company makes for each additional sale. In other words, it determines how much money a company makes from selling another product. For example, if a baker sells an additional loaf of bread for $2, his marginal income is also $2 for him.

When, Q = 9 units and P = $123

Total revenue = P × Q

= 123 × 9

= $1107

When, Q = 10 units and P = $120

Total revenue = P × Q

= 120 × 10

= $1200

Marginal revenue of the 10th unit produced:

= Total revenue of 10 unit - Total revenue of 9 unit

= $1200 - $1107

= $93

When, Q = 19 units and P = $93

Total revenue = P × Q

= 93 × 19

= $1767

When, Q = 20 units and P = $90

Total revenue = P × Q

= 90 × 20

= $1800

Marginal revenue of 20th unit produced:

= Total revenue of 20 unit - Total revenue of 19 unit

= $1800 - $1767

= $33

To know more about Marginal revenue, visit:

https://brainly.com/question/13383966

#SPJ1

What do you think is the most important job of the president of the United States?

Answers

Protecting the constitution of the United States is the most important job of the president of the United States

What is the job of the President of the United States?

The president's primary responsibility is to implement the laws that Congress has passed. The pardon, in my opinion, is the least significant.

The President selects federal (national) judges, develops policies, appoints and dismisses members of the executive branch. Numerous nominations, such as those for Supreme Court justices and Cabinet secretaries, require the approval of Congress. According to the Constitution, the President is in charge of the military.

The President will have great communication and negotiating expertise in establishing these ties. He or she will also have the political acumen, moral courage, self-awareness, and fine judgment required for outstanding leadership. The President serves as the commander-in-chief of the armed forces and is the head of state and government.

Read more on the President here:https://brainly.com/question/2409724

#SPJ1

the ____ theory of emotion suggests that the experience of emotion is the result of physiological arousal and a cognitive label for this physiological state

Answers

The Schachter-Singer theory of emotion suggests that the experience of emotion is the result of physiological arousal and a cognitive label for this physiological state.

The theory of emotions, also known as the Schachter-Singer theory, is the one that explains about the cognitive thoughts that get raised within the psychology of an individual in a specific state. This theory explains for the different emotions that a person has during different periods of time. It is the entire significance of this theory.

Learn more about the Schachter-Singer theory here:

https://brainly.com/question/8924238

#SPJ4

Psychologists have long struggled with how, precisely, to determine whether someone has a psychological disorder. The current viewpoint requires consideration of three primary criteria: psychological dysfunction, personal distress, and cultural expectations.Which of the following best describes the criterion of a psychological dysfunction?

Answers

The criterion of psychological dysfunction

refers to the idea that a psychological

disorder is characterized by abnormal or

maladaptive patterns of thought, emotion, or

behavior that interfere with an individual's

ability to function effectively in their daily

life. This criterion is one of the three primary

criteria used to determine whether someone

has a psychological disorder, along with

personal distress and cultural expectations.

Psychological dysfunction is typically

evaluated by examining whether an

individual's thoughts, emotions, or behaviors

are causing significant difficulties in their

daily life, such as problems with work,

relationships, or self-care. These difficulties

may be caused by abnormal or maladaptive

patterns of thought, emotion, or behavior

that are persistent and difficult to change.

It's worth noting that the concept of

psychological dysfunction is somewhat

subjective, and what is considered abnormal

or maladaptive may vary depending on

the individual and their cultural context.

As such, the criterion of psychological

dysfunction is just one factor that is

considered where evaluating whether

someone has a psychological disorder.

Other factors, such as personal distress and

cultural expectations, may also be taken into

account.

To know more about Psychological dysfunction visit:

https://brainly.com/question/28206655

#SPJ4

which of the following refers to the analytical process joint intelligence organizations use to produce intelligence assessments, estimates, and other intelligence products in support of the joint force commander's decision-making process?

Answers

The JFC and staff can identify intelligence reorientations, information needs, and collection requirements with the use of the JIPOE process, which offers the fundamental knowledge and presumptions about the enemy and other pertinent components of the OE.

Which of the following best sums up the services provided by the intelligence division of the National Joint Operations and Intelligence Center (Njoic)?

Planning, supervision, and infrastructure are provided for intelligence working groups and intelligence task forces by the intelligence component of the National Joint Operations and Intelligence Center (NJOIC).

What is the second phase in the joint intelligence preparation of the operational environment?

The operational environment (OE) must be examined in the second stage in order to describe how it affects the mission. The discussion of how the OE impacts both friendly and adversary capabilities is particularly fascinating.

To know more about JFC visit :-

https://brainly.com/question/14307787

#SPJ4

using historical data to make informed decisions about how things may be in the future is an example of identifying themes. t/f

Answers

In a business setting, crucial strategic decisions about the present and future are based on historical data.

Managers use historical data to predict future trends, identify areas for improvement, and track organizational performance over time.

What kind of analysis combines data from the future and the past?

Analytical Prediction: Predictive analysis provides an answer to the question, "Analysts predict future events by using patterns found in older data and current events."

Which technique utilizes verifiable information?

Relapse examination is a measurable method used to track down connections among free and subordinate factors. Predicting future values through regression analysis makes use of observation and historical data.

To learn more about Predictive analysis here:

https://brainly.com/question/30087106

#SPJ4

Other Questions
Does the FCC protect consumers? How does religious conflicts affect society? Match each rhetorical appeal to its correct definition. Match Term Definition Ethos A) An appeal to emotion that may use vivid imagery, descriptions of emotional events, or emotionally charged words Logos B) An appeal to credibility, ethics, or moral principles that may use positive references to the audience's sense of right versus wrong Pathos C) An appeal to logic or reason that may use facts, statistics, and citations of valid evidence to bring an audience to a clear and logical conclusion What was the first Agricultural Revolution known as? What is iambic pentameter in sonnet? A line with a slope of 4 and passes through (2, 4) What is the equation of the line in slope intercept form (y = mx + b) ? What is range in set? when constructing an angle bisector, the compass must be used to make three arcs. do all three arcs need to have the same radius? explain. What two symbols does the Animal Farm flag have? What is mixed economy in economics? PLEASE HELP MECan someone please explain how the "-6000(1+1.1+1.1^2+...+1.1^7)" became "-6000(1.1^8/0.1)"????Thank you very much which of the following is a true statement? multiple choice a remainder interest held by the decedent at the time of death is not included in the decedent's gross estate. the value of a remainder interest depends in part on the section 7520 interest rate at the time of death. the value of a remainder interest in a life estate is independent of the age of the life tenant. the value of a life estate does not depend upon the age of the life tenant. none of the choices are true. 16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word? An organization whose members have a common cause for which they seek to influence public policy is called an ____. how did the Erie canal help the united states economy? give an example of culturaul diffusion found in the today explain where you would find the example and where it originated What is demand-pull caused by?