The normal boiling point of methanol (CH3OH) is 64.6°C. Given that the vapor pressure of methanol is 75.0 torr at 15.2°C, calculate the molar enthalpy of vaporization of methanol.

Answers

Answer 1

The molar enthalpy of vaporization is 374.9 J/mol.

What is the  molar heat of vaporization?

We know that at the boiling point of a substances, the vapor pressure of the substance would become equal to the atmospheric pressure of the substance.

We know that;

ln(P2/P1) = -ΔHvap/R(1/T2 - 1/T1)

P2 = final pressure

P1 = initial pressure

ΔHvap = molar enthalpy of vaporization

T2 = Final temperature

T1 = initial temperature

ln(75/760) = -ΔHvap/8.314(1/15.2 - 1/64.6)

-2.3 =  -ΔHvap/8.314(0.066 - 0.015)

-2.3 =  -0.051ΔHvap/8.314

ΔHvap = -2.3  * 8.314/ -0.051

ΔHvap = 374.9 J/mol

Learn more about molar enthalpy of vaporization: https://brainly.com/question/29064263

#SPJ1


Related Questions

How many moles of H2 can be made from the complete reaction of 1.5 moles of Al? Given: 2 Al + 6 HCl → 2 AlCl3. + 3 H2

Answers

Answer:

2.25 mol H₂

Explanation:

To calculate mol of H₂ ensure that the equation is balanced. Then use the equation and dimensional analysis to convert the given 1.5 mol Al to mol of H₂.

True or false: The Earth's rotation causes the winds to curve.

Answers

Answer:

true

Explanation:


How many chlorine atoms are there in 100 g of carbon tetrachloride

Answers

Answer:

1.566x10²⁴ atoms of Cl

Explanation:

In Carbon tetrachloride, CCl₄, you have 4 moles of Cl per mole of CCl₄. To solve this question we must find the moles of CCl₄ in order to find the moles of Cl. Using Avogadro's number we can solve the chlorine atoms:

Moles CCl₄: 153.82g/mol

100g * (1mol / 153.82g) = 0.65 moles CCl₄

Moles Cl:

0.65 moles CCl₄ * (4 moles Cl / 1mol CCl₄) = 2.6 moles Cl

Atoms Cl:

2.6 moles Cl * (6.022x10²³ atoms / mol) =

1.566x10²⁴ atoms of Cl

A una sustancia que tenia una etiqueta poco legible se le determina de iones de 3.16x10 a la -10 M.Calcula su pH determina si se trata de jugo de naranja o leche magneisa

Answers

Answer:

pH = 9.44, leche de magnesia

Explanation:

Número de iones [H⁺] de 3.6x10⁻¹⁰M

El pH es una medida en química utilizada para determinar si una sustancia es ácida o básica.

Si el pH < 7 La sustancia será ácida (Jugo de Naranja)

Si el pH > 10 La sustancia será básica (Leche de Magnesia)

Ahora, el pH es definido como el -log[H⁺], el pH de la solución será:

pH = -log[3.6x10⁻¹⁰M]

pH = 9.44

Como el pH > 7, probablemente se trate de leche de magnesia

Calculate the value of Key in the following reaction if the equilibrium concentrations are
[H2S] -0.25 M, (H2) - 0.88 M, [S2] -0.44M.
2 H2Sig) = 2 H2(g) + S218)

Answers

Answer:

The value of the equilibrium constant Kc is 5.45

Explanation:

The "Law of Mass Action" states:

"For a reversible reaction in chemical equilibrium at a given temperature, it is true that the product of the concentrations of the products raised to the stoichiometric coefficients divided by the product of the concentrations of the reactants raised to their stoichiometric coefficients is a constant."

This constant was called the equilibrium constant. For a reaction:

aA + bB ⇄ cC + dD

the equilibrium constant Kc is:

[tex]Kc=\frac{[C]^{c} *[D]^{d} }{[A]^{a} *[B]^{b} }[/tex]

In this case, the balanced reaction is:

2 H₂S → 2 H₂ + S₂

So, the equilibrium constant Kc is:

[tex]Kc=\frac{[H_{2} ]^{2} *[S_{2} ] }{[H_{2} S]^{2} }[/tex]

The equilibrium concentrations are

[H₂S] =0.25 M[H₂]= 0.88 M[S₂]= 0.44M

Replacing in the definition of equilibrium constant:

[tex]Kc=\frac{(0.88 M)^{2} *0.44 M }{(0.25 M)^{2} }[/tex]

Solving:

Kc= 5.45

The value of the equilibrium constant Kc is 5.45

3. Ca(OH)2 + 2HCI = Cacl. + 2HO

If you start with 29.0 grams of Ca(OH), and 12.5 grams of HCl how many moles of water can be formed? What is the limiting reagent?​

Answers

Answer:

https://download.cnet.com/1-Click-Answers/3000-2378_4-10060189.html

Explanation:

For her science project, Suzanne made an animal cell using a rectangular
shoe box, pipe cleaners, and construction paper. One comment that the
teacher made was that Suzanne should not have used a shoe box. Why did
the teacher make this comment? *

Answers

Answer:

Animal cells are more round and do not have a rigid cell wall.

Explanation:

number 2 ...............​

Answers

It’s B sonorous

I hope it’s right ❤️❤️❤️

When solving mass to mass stoichiometry problems, where do you get the molar ratio for the first and second chemicals?

Answers

In the mole ratio. If you have moles of one substance. And the coefficients from the balanced equation you can use the ratio to figure out the moles of the other compounds.

8.
What domain does column A represent?

Archaea

Eukarya

Bacteria

Euryarchaeota

Answers

The answer is A because I did this before
A doing it rn hope I’m right

Please help!
Explain how the Gray Wolf is a keystone species in the Yellowstone
National Park ecosystem.

Answers

Wolves are a censerious(critical) keystone species in a healthy ecosystem. By regulating prey populations, wolves authorize(enable) many other species of plants and animals to flourish. Without predators, such as wolves, the system fails to support a natural level of biodiversity.

Where are Gold, Limestone and kaiolin found.

Answers

Gold is usually found embedded in quartz veins, or placer stream gravel, The most common place to find limestone is beneath the marine waters. Ocean conditions form the rock as organisms, animal skeletons, and calcium carbonate combine, Kaolinite is a layered silicate clay mineral which forms from the chemical weathering of feldspar or other aluminum silicate minerals. It is usually white, with occasionally a red color impurity due to iron oxide, or blue or brown from other minerals.

The fictional element “Nt” contains atoms with two valence electrons. Which type of intermolecular force is most likely responsible for the properties of NtF2?
O dipole-dipole forces
O ion-ion forces
O hydrogen bonding
O dispersion forces

Answers

ion-ion forces

Nt has two valence electrons, and bonds with F to form NtF2. This means that the ion form of Nt is Nt2+. This means that NtF2 is an ionic compound.

how atoms form chemical bond discuss in detail

Answers

Answer:

Atoms form chemical bonds to make their outer electron shells more stable. An ionic bond, where one atom essentially donates an electron to another, forms when one atom becomes stable by losing its outer electrons and the other atoms become stable (usually by filling its valence shell) by gaining the electrons.

How can you Weigh more on the earth than you would on the moon and still have the same mass in both places.

Answers

Answer:

Your Mass never changes but your weight can..

Explanation: This all depends on gravity..

Answer:

its because of gravity your mass doesn't change but the gravity does and the  gravity from earth and on the moon is way different.please choose me as brainliest

Which flows through the other?

Answers

Is there a picture, or.

Which of the following radiations is attracted to the positive electrode?
a.Alpha and beta particle
b.Alpha particle and neutron
c.Photon
d.Beta particle

Answers

The best answer for this is C

What is one thing that is the same about a mole of sodiums and a mole of carbons?
A) The weight
B) All of these
C) The total number of atoms
D) The mass

Answers

C the total number of atoms

Please help!! The answer that shows work and does not send link will get brainiest!

Answers

Answer:

5 mol H₂. this is the answer bro all the best for your test/exam

1. How many grams are in 1.7 x 10^23 particles of Cl2?

2. How many moles are in 3.28 x 10^23 atoms of NaCl? *

3. If I were to determine how many liters 26 grams of water is, what type of conversion would this be? *

A Mass --> Moles --> Particles
B Mass --> Moles --> Volume
C Volume --> Mass --> Moles
D Moles --> Mass --> Volume

Answers

Answer: 1. 20.0 grams

2. 0.272 moles

3. B) Mass --> Moles --> Volume

Explanation:

According to avogadro's law, 1 mole of every substance weighs equal to molecular mass and contains avogadro's number [tex]6.023\times 10^{23}[/tex] of particles.

To calculate the number of moles, we use the equation:

[tex]\text{Number of moles}=\frac{\text{Given molecules}}{\text{Avogadros number}}[/tex] or

[tex]\text{Number of moles}=\frac{\text{Given mass}}{\text{Molar mass}}[/tex] or  

Putting in the values we get:

1. [tex]\text{Number of moles of} Cl_2=\frac{1.7\times 10^{23}}{6.023\times 10^{23}}=0.282moles[/tex]

Mass of [tex]Cl_2=moles\times {\text {Molar mass}}=0.282mol\times 71g/mol=20.0g[/tex]

2. [tex]\text{Number of moles of NaCl}=\frac{3.28\times 10^{23}}{2\times 6.023\times 10^{23}}=0.272moles[/tex]

3. [tex]\text{Number of moles of water}=\frac{26g}{18g/mol}=1.44moles[/tex]

Volume of water =[tex]moles\times {\text {Molar volume}}=1.44mol\times 22.4L/mol=32.4L[/tex]

True/False: Energy can’t be created or destroyed: it can only be transferred from one place to another.

Answers

Answer:

true

Explanation:

Answer:

True.

Explanation:

It is true that energy cannot be made or lost, but it can move. For example, if you touch a metal pole and get a static shock, then the energy from the pole is being transferred to you. However, energy was not made or lost in the process. So, energy cannot be made or destroyed, but it can be moved. This also means there was the same amount of energy in the universe as there was millions of years ago. Hope this helps!

Hyperthermus butylicus is an aquatic prokaryote found near the coast of Portugal. It is found sand along the gas vents that release steam and carbon dioxide. In what domain would scientists classify this prokaryote?
A Eukarya
B Bacteria
C Archaea
D Fungi

Answers

they would classify it as c.


An Archaea

have a great day!

What is the temperature

Answers

Answer:

I think it mught be 12.9?

Answer:

the average sum of kinetic energy of all the molecules present in a body is called temperature. it's 12.9

hope it is helpful to you

Can plants and animals adapt more easily to slow environmental changes or fast environmental changes? Explain.
A. None of the other answer choices

B. Fast changes, because they weed out weak organisms

C. Fast changes, because species prefer to adapt quickly

D. Slow changes, because they give species time to adapt
2..Which trait would likely help an organism survive in a cold environment so it can reproduce offspring?
Responses

A. A good sense of smell

B. Layers of fat

C. Strong legs

D. Large ears

Answers

Answer:

D

Explanation:

Question number 1 is D and Question 2 is C

Question is in picture

Answers

Dont click on that link it is a scam

How many moles are in 46.7g of H2O gas?

Answers

46.7 g=total mass
18.02=18 g= H2O’ molar mass

46.7/18= 2.59.... moles =3 moles
Remember to round

What is the chemical formula for this?

Answers

Answer:

-OOH

Explanation:

This forms an acid if it comes in contact with a metal

Answer:

HO2; Hydroperoxyl

Explanation:

Since there are two oxygen molecules, and one hydrogen molecule, it can be classified as a hydroperoxyl molecule.

It is an inorganic compound with the following characteristics

Covalent compound (O,H are nonmetals) Valence of O (O must form an octet): 6 Valence of H: 1 Total valence electrons: 13 Molar mass: 33.01 g/mol

Using the periodic table, choose the more reactive nonmetal.
Te or o

Answers

Te is the correct ok is this

Which of the following is true concerning methane?
1)It is a gas at standard temperature and pressure.
2)It consists of one carbon atom and four hydrogen atoms.
3)It is the major component of natural gas.
4)all of the above

Answers

Answer:

4

Explanation:

at room temperature and standard pressure methane is a colourless gas. Methane consist of one carbon atom bonded to 4 hydrogen atom and it also forms the major percentage of natural gas

Regarding methane, it is true that:

It is a gas at standard temperature and pressure. It consists of one carbon atom and four hydrogen atoms. It is the major component of natural gas. All of the above

Let's consider which of the following is true concerning methane?

1) It is a gas at standard temperature and pressure. TRUE. Like most small hydrocarbons, methane is a gas at STP.

2) It consists of one carbon atom and four hydrogen atoms. TRUE. The chemical formula of methane is CH₄.

3) It is the major component of natural gas. TRUE. It represents about 95 mole % of natural gas.

4) All of the above. TRUE.

Regarding methane, it is true that:

It is a gas at standard temperature and pressure. It consists of one carbon atom and four hydrogen atoms. It is the major component of natural gas. All of the above

Learn more: https://brainly.com/question/2127750

If an atom has 7 valence electrons, what will its charge be when it becomes an ion?

Answers

Answer:

Well, he needs to take one more electron to have a stable structure. And by doing that the atom will have more electrons than protons and will turn into a negative ion.

Other Questions
Communism is an extreme form of socialism.TRUE OR FALSE What is the most common theme of haiku? Wwhich file should you edit for sendmail configuration? Does the FCC protect consumers? How does religious conflicts affect society? Match each rhetorical appeal to its correct definition. Match Term Definition Ethos A) An appeal to emotion that may use vivid imagery, descriptions of emotional events, or emotionally charged words Logos B) An appeal to credibility, ethics, or moral principles that may use positive references to the audience's sense of right versus wrong Pathos C) An appeal to logic or reason that may use facts, statistics, and citations of valid evidence to bring an audience to a clear and logical conclusion What was the first Agricultural Revolution known as? What is iambic pentameter in sonnet? A line with a slope of 4 and passes through (2, 4) What is the equation of the line in slope intercept form (y = mx + b) ? What is range in set? when constructing an angle bisector, the compass must be used to make three arcs. do all three arcs need to have the same radius? explain. What two symbols does the Animal Farm flag have? What is mixed economy in economics? PLEASE HELP MECan someone please explain how the "-6000(1+1.1+1.1^2+...+1.1^7)" became "-6000(1.1^8/0.1)"????Thank you very much which of the following is a true statement? multiple choice a remainder interest held by the decedent at the time of death is not included in the decedent's gross estate. the value of a remainder interest depends in part on the section 7520 interest rate at the time of death. the value of a remainder interest in a life estate is independent of the age of the life tenant. the value of a life estate does not depend upon the age of the life tenant. none of the choices are true. 16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word? An organization whose members have a common cause for which they seek to influence public policy is called an ____.