The north pole of a compass magnet points toward
O A. magnetic north
B. geographic south
C. geographic north
D. magnetic south
SUBMIT

Answers

Answer 1

D. Magnetic south

Hope this helps :)


Related Questions

The adequate stimulus for your auditory sense is

Answers

The following provides a sufficient audio stimulus: Vibration in a carrying medium serves as an appropriate stimulus for audition. We can hear underwater and via our skulls in addition to the usual conducting medium of air.

The correct physical domain of the sensory system under study is where the stimuli come from, therefore sounds are adequate stimulus for the auditory system and smells are adequate for the olfactory bulb. Light and light contrasts provide the visual system with the necessary stimulus. Audition. The following provides a sufficient audio stimulus: Vibration in a carrying medium serves as an appropriate stimulus for audition. We can hear underwater and via our skulls in addition to the usual conducting medium of air.The basic sensory receptor cells in the inner ear, known as hair cells, transduce, or change into electrical impulses that are sent to the brain, mechanical sensations generated by sound and head motions. The type and amount of energy needed to excite a particular sensory organ is the appropriate stimulus. Numerous sensory stimuli are divided into groups based on how they work and what they're used for.

Learn more about  skull

https://brainly.com/question/28190325

#SPJ4

why can swabbing items such as keyboards, computer mice, pens, and phones provide an accurate representation of microbes living in association with humans? a. the items such as keyboards, pens, phones, and others provide a great growth resource for microbes. b. microbes that naturally live on these surfaces survive better due to oils released from human skin. c. certain microbes live on the surface of the skin, and humans shed their skin cells fairly frequently. d. microbes that naturally live on these surfaces survive better due to sugars found on human skin. e. the items such as keyboards, pens, phones, and others provide a sterile growth resource for microbes, improving the accuracy of the swabs.

Answers

certain microbes live on the surface of the skin, and humans shed their skin cells fairly frequently.

What type of microbes live on the skin?Rod and round bacteria, such as Proteobacteria and Staphylococcus spp., respectively, create communities on the skin surface that are intricately entwined with one another and other microbes. Commensal fungi, like Malassezia spp., can develop both as individual cells and as branching filamentous hypha.For instance, researchers discovered that almost everyone regularly contains infections, or bacteria, known to cause disease. However, pathogens do not cause disease in healthy people; instead, they merely coexist with their host and the rest of the human microbiome, which is a collection of all the microorganisms found in the human body.

To learn more about microbes  refer,

https://brainly.com/question/8695285

#SPJ1

how did mendels experiments with peas convince him that there were disfuct units of heritance that were not blended together in the offspring

Answers

Mendel conducted this well-known experiment in which he purposely cross-pollinated pea plants based on their many characteristics in order to learn crucial truths about how traits are passed down through the generations.

What is Mendel's experiment?

Because he noticed that specific features were regularly and predictably passed from one generation to the next, Gregor Mendel was convinced by his studies with peas that there were discrete units of heredity, today is known as genes.

For instance, he discovered that the progeny of crosses between purebred pea plants with tall stems and those with short stems all produced long stems. But when he let these kids self-pollinate, around three-fourths of the offspring had tall stems, while roughly one-fourth had short stems.

Therefore, Mendel's research served as the cornerstone for the modern understanding of genetics and the function of genes in inherited traits.

To learn more about Mendel's experiment, refer to the link:

https://brainly.com/question/29775819

#SPJ2

Luis is studying agriscience in class and needs to list three challenges facing the agricultural industry today. Which of the
following would best complete his list? (5 points)
Challenges
• Water quality issues
• Climate change
O More farmers' markets opening
O Improvements in renewable energy
O Less available land to cultivate
O Decreasing world population

Answers

The world's expanding population, problems with water quality, and soil deterioration are some of the challenges that the agricultural industry is currently facing.

What is agriculture?

Agriculture is defined as the study or practice of farming, which includes preparing the land for plant growth as well as raising animals for their meat, wool, and other goods.

Climate change and soil degradation difficulties, which reduce the appropriateness of the land for crop cultivation, are the most frequent issues that agricultural industries encounter.

Thus, the world's expanding population, problems with water quality, and soil deterioration are some of the challenges that the agricultural industry is currently facing.

To learn more about agriculture, refer to the link below:

https://brainly.com/question/3632132

#SPJ1

C. Less available land to cultivate.

I hope this helped! :)

16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form • Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe

Answers

The phenotype is affected by mutations 1 and 2 because in the first, the complete protein is altered, and in the second, the new amino acid may cause the protein to have altered or no function.

What is Mutation?

Mutations can happen naturally or as a result of UV rays, congenital conditions, ionic radiations, or specific free radicals.

Even with the point mutation, there is no alteration to the amino acid sequence, hence the protein will not be affected.

In mutation 1, a new nucleotide is added at codon 9, changing the whole sequence of amino acids and codons in the process,  mutation frameshift.

Because a new codon was created as a result of the substitution of one nucleotide by another in mutation 2, produced a new amino acid, so Point mutation.

Therefore, in mutation 3, one nucleotide is swapped out for another, and the resulting codon codes the same amino acid as the one before it, so point mutation.

Learn more about mutation, here:

https://brainly.com/question/17130462

#SPJ4

christians are equipped with both natural abilities and _________ gifts.

Answers

Spiritual gifts. You receive Jesus when you rely on Him and accept Him as your Savior. Second, in order to convey the life of the natural dwelling Christ, God imparted His Spirit to the elect.

Jesus bought us back so that we may be adopted as sons. Natural talents are skills that one is born with and develops within the setting of their family. We all know folks who are gifted and who have a long line of ancestors who are also gifted. The seven gifts of the Holy Spirit are a list of seven spiritual talents that may be found in the book of Isaiah for the first time and have been extensively discussed by patristic writers. They are knowledge, courage, fortitude, piety, fear of the Lord, and wisdom.

Learn more about Natural

https://brainly.com/question/9830102

#SPJ4

Zeke is attempting to learn more about his world. when he encounters a new object, he picks it up and puts it in his mouth. zeke is most likely in which of jean piaget’s stages of cognitive development?

Answers

Zeke is trying to learn more about the world around him. He takes a new object and puts it in his mouth whenever he sees it. Zeke is most likely in the sensorimotor stage of jean Piaget's stages of cognitive development.

Sensorimotor stage: Children use their natural abilities of looking, sucking, grasping, and listening during this early stage of development to gain a deeper understanding of the world around them. To put it another way, they learn about the world through their senses and movements. Children gain a deeper understanding of the world around them through trial and error.

Because infants acquire a fundamental understanding of the world around them through their senses and motor skills, Piaget chose to refer to this stage as the "sensorimotor stage." Infants are able to interact and develop an awareness of themselves and their surroundings thanks to the combination of physical abilities that continue to develop like Zeke picking up the objects and putting them in his mouth is his attempt to learn more about his world.

Know more about the Sensorimotor stage here: https://brainly.com/question/14780906

#SPJ4

(complete question)

Zeke is attempting to learn more about his world. When he encounters a new object, he picks it up and puts it in his mouth. Zeke is most likely in which of Jean Piaget’s stages of cognitive development?

answer choices

Sensorimotor

Preoperational

Concrete operational

Formal operational

Postconventional

Explain the process of wastes and nutrients leaving the cell

Answers

Transmembrane protein channels and transporters

Nutrients, such as sugars or amino acids, must enter the cell, and certain products of metabolism must leave the cell. Such molecules diffuse passively through protein channels in facilitated diffusion or are pumped across the membrane by transmembrane transporters.

Due to the action of tears, potential pathogens of the eyes and its membranes usually end up where?
the skin
the lungs
the stomach
the bloodstream

Answers

Due to the action of tears, potential pathogens of the eyes and its membranes usually end up the stomach. Hence option c is correct.

What are potential pathogens?

The potential pathogens are defined as the pathogen includes characteristics including mortality, communicability, and the length of time it takes for a disease to develop following infection with a specific inoculum, and is related to the percentage of people that develop symptoms after infection.

Through a network of ducts and canals, tears and the germs they gather travel into the nose where they combine with nasal mucus before entering the throat where they are ingested.

Thus, due to the action of tears, potential pathogens of the eyes and its membranes usually end up the stomach. Hence option c is correct.

To learn more about potential pathogens, refer to the link below:

https://brainly.com/question/22538080

#SPJ1

the law that requires safety protocols to protect employees at work, including providing protective gloves, sharps boxes, and antibacterial wipes is known by the acronym:

Answers

The law that requires safety protocols to protect employees at work is known by the acronym OSHA, which stands for the Occupational Safety and Health Administration. OSHA is a federal organization that was created in 1970 to ensure safe and healthy working conditions for workers across the United States.

OSHA requires employers to provide safety protocols that protect employees from workplace hazards. This includes providing personal protective equipment, such as gloves, sharps boxes, and antibacterial wipes. Personal protective equipment (PPE) is any equipment worn by an employee to protect them from potential hazards, such as chemicals, sharp objects, and bacteria. PPE is an important part of OSHA's safety protocols, as it helps to reduce the risk of illness, injury, or death due to workplace hazards.

In addition to providing PPE, OSHA also requires employers to create and implement safety policies, such as providing safety training, conducting safety inspections, and establishing emergency plans. These policies provide a framework for employers to ensure their workplace is safe and healthy.

Learn more about Personal protective equipment (PPE) at : https://brainly.com/question/28178938

#SPJ4

the most common type of regenerated fiber, which is derived from cellulose and is mostly plant in origin, is rayon.T/F

Answers

Correct answer is :- TRUE

It is true that rayon, which is derived from cellulose and has a largely plant-based origin, is the most popular type of regenerated fiber. this is due to the cellulose-based fibers used in the plastic polymer strings, all of which start with oil products. Polyester resembles fiber in some ways, however it is easily destroyed by sunlight and strong acids.

know more about cellulose here

https://brainly.com/question/27963779#

#SPJ4

Vitamin e's primary function is as _______ that neutralizes potentially harmful free radicals in the body.

Answers

Vitamin E's primary function is as an antioxidant that neutralizes potentially harmful free radicals in the body.

Vitamin E is made up of eight fat-soluble compounds, four of which are tocopherols and four of which are tocotrienols. Vitamin E deficiency, which is uncommon and usually caused by an underlying problem with dietary fat digestion rather than a low vitamin E diet, can cause nerve problems.

Nausea, fatigue, headache, and bleeding are all possible side effects. When taken in doses greater than 1000 mg per day, vitamin E may be hazardous. When applied to the skin, vitamin E is most likely safe for the majority of people. Vitamin E is an essential nutrient for vision, reproduction, and the health of your blood, brain, and skin. Vitamin E has antioxidant properties as well. Sunflower seeds, almonds, spinach, avocados, squash, kiwifruit, trout, shrimp, olive oil, wheat germ oil, and broccoli are all high in vitamin E.

To learn more about Vitamin E, here

https://brainly.com/question/10670287

#SPJ4

How do you write a population as a function of time?

Answers

I = rN (K-N / K), where I is the population's annual rise, r is its annual growth rate, N is its size, and K is its carrying capacity, can be used to calculate the population's annual growth.

How do you determine population trends?

Estimating Population Growth To get the population growth, subtract the population at Time 1 from the initial population, divide the result by the initial population, and multiply the result by 100.

What is the population's definition or purpose?

The population in statistics refers to the complete set of items from which you collect data for a statistical study. It could be an assortment of things, a collection of people, etc. It comprises a study's data set.

To know more about population visit :-

https://brainly.com/question/27991860

#SPJ4

How do you calculate population time?

Answers

To figure out how long it would take a population to double at a single rate of growth, we can use a simple formula known as the Rule of 70. Basically, you can find the doubling time (in years) by dividing 70 by the annual growth rate.

How do you calculate population over time?

Population Growth Calculation To calculate the Population Growth (PG) we find the difference (subtract) between the initial population and the population at Time 1, then divide by the initial population and multiply by 100. The Population Growth Rate (PGR) for that period of time (10 years) was 12%.

How to calculate population?

The best way to measure the size of a population is to count all the individuals in that population. When determining the population sizes of trees or other relatively immobile organisms, this method is practical. If the organism is mobile, however, such as a fish, counting every individual would be difficult.

To know more about calculate population time visit :-

https://brainly.com/question/29128892

#SPJ4

How is protein made using the information from amino acid?

Answers

A complex collection of molecules known as  ribosome it is used by cells to assemble proteins. The ribosome puts amino acids in the correct order and connects them with peptide bonds. A polypeptide chain—a lengthy collection of amino acids—is produced by this procedure, known as translation.

Which proteins are produced using amino acids?

Amino acids unite to form peptide bonds, which are another name for proteins known as polypeptides. Depending on the interactions (dashed lines) between the side chains of the polypeptide's amino acids, the polypeptide will then fold into a particular shape.

Are amino acids present in all proteins?

All proteins are made up of one or more chains of amino acids, despite the fact that their shapes, as well as their functions, vary widely.

To know more about protein  visit:-

https://brainly.com/question/29776206

#SPJ4

What is cancer and how does it relate to the cell cycle and mitosis?

Answers

Cancer is related to the cell cycle and mitosis because by drilling down to the atomic level of how specific proteins interact during mitosis, a a unique new target for attacking cancer is found.

Mitosis is a type of cell division in which one cell( the mama ) divides to produce two new cells( the daughters) that are genetically identical to itself. In the environment of the cell cycle, mitosis is the part of the division process in which the DNA of the cell's nexus is resolve into two equal sets of chromosomes.

Cancer is a term for conditions in which abnormal cells divide without control and can incursion near apkins. Cancer cells can also spread to other corridor of the body through the blood and lymph systems. There are several main types of cancer.

To learn more about mitosis  here

brainly.com/question/29776367

#SPJ4

How is a plaque similar to a bacterial colony?

Answers

Plaque similar to bacterial colony 1 virus replicates in a host and expands outwards to infect more and more cells germs multiply, spreading outward no bacterial lawn after one week of incubation; only dead cells No, a temperate phage.

Bacteriophage tail fibres attach to the proteins in cell walls. The host cell is infused with viral DNA. No coating is necessary. Lysogeny, cytoplasmic biosynthesis. lysing of the host cell. 2) Wildlife Plasma membrane proteins and glycoproteins serve as attachment sites. Capsid entry is mediated by receptor fusion or endocytosis. Enzymatic elimination of capsid proteins during uncoating. Biosynthesis in the cytoplasm or nucleus (DNA viruses) Cancer, sluggish viral infections, and latency. Nonenveloped viruses burst plasma membrane after being released through an enveloped virus' bud out.

To know more about Plaque

https://brainly.com/question/9411605

#SPJ4

Where is the organized form of DNA?

Answers

Chromosome is the final organized form of DNA which is present within the nucleus.

Cells enclose their DNA strands all over scaffolding proteins to construct chromatin, a coiled compressed structure inside the nucleus. Chromatin is hence rolled up into higher powers of structure, resulting in the distinctive shape of chromosomes.

The DNA molecule is encapsulated into thread-like structures known as chromosomes in the nucleus of each cell. Each chromosome is composed of DNA that has been tightly coiled many times around proteins known as histones that support its structure. Chromatin coils tightly and compresses to create chromosomes when a cell is poised to divide.

For more information on Chromosomes, visit :

https://brainly.com/question/12537598

#SPJ4

Select the statements that accurately characterize T-cell activation.

a. CD8+ cells are stimulated by antigen bound to MHC I molecules.
b. T helper cells play a role in B-cell activation.
c. CD4+ cells are stimulated by antigen bound to MHC II molecules.
d. TH17 cells lead to the development of inflammatory reactions.
e. Activation of CD4+ T cells leads to the development of TC cells only.

Answers

that precisely describe the activation of T cells. Antigen that has been attached to MHC I receptors stimulates CD8+ lymphocytes. In the stimulation of B-cells, T helper cells are involved. The formation of inflammatory responses is facilitated by Il-17.

When tissues are harmed by infection, trauma, toxins, heat, or really any cause, the inflammatory response (also known as inflammation) takes place. Chemicals like histamine, cholecystokinin, and prostaglandins are released by injured cells. These substances promote inflammation by spurting blood capillaries to bleed water into the tissues. organisms pathogens such as bacteria, such as bacteria, viruses, or fungi. Explicit wounds such as scratches or injury with foreign items effects of radiation or chemicals

Learn more about inflammatory her:

https://brainly.com/question/29774118

#SPJ4

What are complex traits affected by?

Answers

Answer:

From variation within multiple genes and their interaction with behavioral and environmental factors.

Axons of the cochlear branch sensory neurons extend toA) nuclei in the ponsB) the cerebellumC) nuclei in the medulla oblongataD) the spiral ganglion of the cochlea

Answers

Cochlear branch sensory neurons' axons extend to medulla oblongata nuclei.

The sensory, mesencephalic, and major motor trigeminal nerve nuclei are all situated in the pons. The trigeminal nerve's sensory, mesencephalic tract, and motor nuclei are all located near the pons. A motor neuron called the Abducens neuron (cranial nerve VI) develops anteriorly & medially from the pons-medulla junction. The abducens nucleus is located directly ventral to the fourth ventricle floor, in the middle of the inferior temporal lobe of the pons. The cardiac, respiratory, vomiting, and vasomotor centers are located in the medulla, which controls the sleep-wake cycle as well as the parasympathetic functions of breathing, heart rate, and blood pressure.

Learn more about  neuron

https://brainly.com/question/29462317

#SPJ4

The haploid number of chromosomes of a plant is 20. the number of chromosomes in root, stem, and leaf cells would be?

Answers

The number of chromosomes in root, stem, and leaf cells would be 40.

Chromosomes are thread-like structures made of protein and a single DNA molecule that transport genomic information from cell to cell. Chromosomes are found in the nucleus of cells in plants and animals.

A chromosome is a long DNA molecule that contains all or part of an organism's genetic material. Most chromosomes have very long thin DNA fibers coated with packaging proteins; the most important of these proteins in eukaryotic cells are the histones.

Genetic diversity is greatly influenced by chromosomal recombination during meiosis and subsequent sexual reproduction. If these structures are incorrectly manipulated, as with chromosomal instability and translocation, the cell may undergo mitotic catastrophe.

Normally, this causes the cell to initiate apoptosis, which leads to its own death, but mutations in the cell can impede this process and thus cause cancer progression.

To learn more about number of chromosomes, here

https://brainly.com/question/27419643

#SPJ4

describe what is the difference of protein coagulation mechanism (specifically casein) between yogurt and cheese making? (think about what caused casein to coagulate during these two procedure, and describe in detail)

Answers

Yogurt

Produced by milk fermentationLactic acid provides the tangy flavor in Yogurt Bacteria will ferment sugars in milk to produce lactic acid. therefore mixture become acidicHigher acidity solidifies the casein proteins

Cheese

Produced by  acidification of milkbacteria provide the taste in cheese.coagulation of casein protein in milk separatingthe milk into solid curds and liquid whey. liquid whey is drained away, and the curds are salted, shaped and left to ripen in a controlled environment.Casein molecules have hydrophobic and hydrophilic regions in the molecules.This leads to formation of micelles.Micelles are globular round structures which float around in milk.

Coagulation is done by

Lower the pH ( by the addition of an acid or by the addition of micro organisms that make acids) Addition of enzymeThese two  causes the stable micelles to lose stability and curdle into larger aggregates.The lower pH will destabilize the casein micelles and cause them to aggregate.They will form clumps which catch the fat and which will form the final cheeseEnzymes change the size of the proteins.

Learn more about Yogurt to visit this link

https://brainly.com/question/7580803

#SPJ4

How are proteins made using the information found in the DNA?

Answers

The sandwich-like arrangement of ribosomal subunits on the strand of mRNA that occurs during translation allows them to draw in tRNA molecules bound to amino acids (circles). The ribosome transforms the decoded mRNA sequence into a polypeptide, or new protein, into a lengthy chain of amino acids.

Ribosomes are located where?

Depending on whether the cell is from a plant, an animal, or a bacterium, ribosomes are usually found attached to the endoplasmic reticulum and the nuclear envelope, as well as freely dispersed throughout the cytoplasm.

For the purpose of protein synthesis, the mRNA is produced in the nucleus and moved to the cytoplasm. In the cytoplasm, mRNA polymers are wrapped with the ribosomal subunits. Proteins are then created by the tRNA. The building of proteins occurs on ribosomes.

learn more about Proteins refer

brainly.com/question/10058019

#SPJ4

Why do clams not have eyes?

Answers

The clams does not proper eyes instead contains pinholes over the exposed mantles. They belong to Bivalvia class of mollusca

The eyes of clams are located over the circumference of the hemispherical shell. Light travels through the retina of a clam's eye, where it is poorly focussed by the cornea, before being reflected from a hemispherical concave mirror along the back of the eye.Clam eyes can detect fluctuations in light levels because they are light-sensitive. They shrink their syphon and mantle and partially seal their shells in response to abrupt light dimming, object movement, and sudden brilliant light. When individuals sweep their hands over the water, clams quickly close their shells and retract their mantles.

Hence, clams primitive eye detect changes in intensity of light .

To know more about Bivalvia.

https://brainly.com/question/29977705

#SPJ4

What is the most common theme of haiku?

Answers

Feelings about Nature are the most common theme of haiku.

A haiku is a type of poetry from Japan that dates back to the ninth century. There are three lines in a haiku. The standard metric for haiku is 5-7-5, but modern haiku rarely adhere to that format.

The primary purpose of haiku poems is to convey feelings about nature. Time, nature, emotions, and other topics were addressed in traditional poems. They are intended to be instructive for the readers. The Western Haiku, on the other hand, deals with anything that could be a subject. Poems cover a wide range of topics, including houses, drainages, dogs, and cats. However, serious poets make a concerted effort to adhere strictly to the Japanese Haiku format.

know more about Japanese Haiku here: https://brainly.com/question/29553627

#SPJ4

What solute is found in plasma?

Answers

Plasma contains more than 90% water. The remainder is primarily made up of dissolved solutes like glucose, lipids, electrolytes, and dissolved gases, as well as plasma proteins, primarily albumin, globulins, and fibrinogen.

What are the three dissolved substances in plasma?

Essential components including water, salt, and enzymes are also present in plasma. These also include antibodies and coagulation components like albumin and fibrinogen.

Does plasma contain any dissolved solutes?

Plasma proteins, electrolytes (including sodium, potassium, and calcium), dissolved gases (like oxygen and carbon dioxide), and organic nutrients are among the dissolved solutes that can be found in plasma (such as glucose, amino acids, lipids).

To know more about Plasma visit:-

https://brainly.com/question/18207038

#SPJ4

What type of asexual reproduction is snail?

Answers

However, some hermaphrodite snails reproduce asexually. In other words, the snail fertilises its own egg with its own sperm.

Some hermaphrodite snails can reproduce on their own without the help of another snail (this is called asexual reproduction). Even though some snails are hermaphrodites, they still require a partner to procreate (this is called sexual reproduction). Nerite snails do not reproduce asexually, unlike the majority of aquatic snails. Similar to fish, a female nerite snail will lay eggs that the male will fertilise. The developing larvae will then be dispersed throughout the tank with the eggs.

To learn more about snails click here:

https://brainly.com/question/2961767

#SPJ4

What 3 things do you need to make bacteria grow?

Answers

Bacteria need three things to grow and multiply which are Nutrients, water, and optimal temperature.

Nutrients: Bacteria require a source of energy and various organic and inorganic compounds to grow and function. These nutrients can come from a variety of sources, such as organic matter, minerals, and other substances in their environment.

Water: Bacteria need water to survive and grow. Water is essential for many biological processes, including the synthesis of new cell material and the removal of waste products.

Optimal temperature: Different types of bacteria have different temperature requirements for growth. Some bacteria can grow at a wide range of temperatures, while others are very sensitive to temperature changes. In general, bacteria tend to grow best within a narrow temperature range that is specific to each species.

It's worth noting that while these three things are necessary for bacterial growth, they are not always sufficient. Bacteria can also be affected by other factors, such as pH, oxygen levels, and the presence of other microorganisms or chemicals in their environment.

Learn more about Bacteria here:

https://brainly.com/question/26298859

#SPJ4

Answer:

Bacteria need three things to grow and multiply which are Nutrients, water, and optimal temperature.

Nutrients: Bacteria require a source of energy and various organic and inorganic compounds to grow and function. These nutrients can come from a variety of sources, such as organic matter, minerals, and other substances in their environment.

Water: Bacteria need water to survive and grow. Water is essential for many biological processes, including the synthesis of new cell material and the removal of waste products.

Optimal temperature: Different types of bacteria have different temperature requirements for growth. Some bacteria can grow at a wide range of temperatures, while others are very sensitive to temperature changes. In general, bacteria tend to grow best within a narrow temperature range that is specific to each species.

It's worth noting that while these three things are necessary for bacterial growth, they are not always sufficient. Bacteria can also be affected by other factors, such as pH, oxygen levels, and the presence of other microorganisms or chemicals in their environment.

Explanation:

which statement is true regarding the activation of pyruvate carboxylase by acetyl coa? a)feedback activation enhances flux through glycolysis. b)feedforward activation enhances the entry of pyruvate through the tca cycle as acetyl-coa. c)ensures that gluconeogenesis occurs rather than pyruvate conversion to acetyl-coa. d)ensures that atp is not wasted in the production of oxaloacetate. e)feedback inhibition

Answers

The statement that ensures that gluconeogenesis occurs rather than pyruvate conversion to acetyl-CoA is true regarding the activation of pyruvate carboxylase by acetyl CoA (Option C).

What is the process of gluconeogenesis?

The process of gluconeogenesis refers to a metabolic signaling pathway capable of generating glucose from non-carbohydrate compounds, which is in this case produced by the activation of pyruvate carboxylase via acetyl CoA.

Therefore, with this data, we can see that the process of gluconeogenesis can be achieved by activating the enzyme pyruvate carboxylase by acetyl CoA which participates in many reactions.

Learn more about the process of gluconeogenesis here:

https://brainly.com/question/1425339

#SPJ1

Other Questions
Malala discusses how the Taliban perceives women during her speech. This perception may appear very different from how women are viewed in America, but it could be argued that there are similarities between how some Americans and some Pakistanis view the roles of women. What claim would a person make to prove this point? Escribe las palabras o frases que se definen o se describen a continuacin.__: es la accin de ser discreto y mantener la informacin confidencial y privada de los dems__: es alguien que no es discreto y que les habla a los dems sobre las cosas privadas y personales de sus amigos__: es una pelea verbal__: es el sinnimo de ser honesto; que siempre dice la verdad __: es el sinnimo de ayudar__: es alguien que es hace muchas preguntas sobre la vida privada de los dems; es demasiado curioso y quiere saber qu pasa en la vida de la gente__: es alguien que no le gusta compartir sus cosas y que siempre piensa primero en s mismo __: es el sinnimo de la pelea y el problema__: es alguien que se mira en los espejos demasiado y que piensa que es el ms guapo, el ms inteligente y el mejor__: es la accin de ponerse feliz, sentirse contento por algo__: es el sinnimo de la paz, la tranquilidad, la calma Please help me Due 12:00 PM hurry what happens to the current in a circuit if a 1.5 volt battery is removed and is placed by a 9 volt battery? Need answer please ty what is a characteristic of a strong acid If you draw a card out of a deck of cards at random,what is the probability that you will draw a 6 ofhearts?A. 4:52B. 1:1O C. 1:52O D. 6:52SUBMIT please help! I've got till the end of the day and I'm scrambling trying to get this done and my brain is fried!! You are stuck in a big traffic jam on the freeway and you are wondering how long it will take to get to the next exit, which is 1 1/2 miles away. You are timing your progress and find that you can travel 2/3 of a mile in one hour. If you continue to make progress at this rate, how long will it be until you reach the exit? Solve the problem with a diagram and explain your answer. Bonjour, je suis bloqu cet exercice, vrai je n'ai rien compris de la consigne...On considre les nombres A=631172175 et B=63117+2175.1) crire A et B sous la forme a7 avec a un entier.2) Simplifier A/B.Merci d'avance What did you include in your response? Check all that apply Longitudinal and transverse waves are mechanical waves, so they both carry energy through particles of matter. Longitudinal waves are waves that transfer energy parallel to the direction of wave motion. Transverse waves are waves that transfer energy perpendicular to the direction of wave motion. If you roll a single six-sided die, what is the probability of rolling an odd number? The area of the surface of a pool table is 24 square feet. The pool table is 6 feet long. How wide is it?No procedure On five sentences, you write all ideas that come in your mind when you see the objects in and out of the box RAM IS often referred to as1 SECONDARY STORAGE2 . READ ONLY MEMORY3. RATIO ACTIVE MEMORY4. PRIMARY STORAGE Alexis has a bag of starbursts. After giving half of the candy to her best friend, she ate 6 starbursts.Now, she only has 10 starbursts left. How many starbursts did Alexis start with? Need help plssss!!!!! Which statement is true about how early humans met their needs? a=1/2 bh (base/height) =.5(12)4a=24fthow did i get the answer a=24? im really confused 2 2/ 3 + 4 4/ 5 Los muchachos perezosos_____ a las once y media.a. nos despertamos b. se despertamos. c. me despierto d. se despiertan