The question was “what does this graph show about the international cotton trade?” Any type of help works :)

The Question Was What Does This Graph Show About The International Cotton Trade? Any Type Of Help Works

Answers

Answer 1
over time, both the US and Britain increased in their consumption of cotton, but after 1820, lead consumer switched from the US to Britain.

this was just what came up off the top of my head after looking at the picture attached. let me know if this helped or at least made sense <3

Related Questions

What is the main idea of the article "Biden takes the helm as president: "Democracy has prevailed""? Please read the passage if you can on Newsela and get the answer here as quickly as possible. First to answer gets Brainliest and 15 points!

Answers

Joe Biden was sworn in as the 46th president of the United States on Wednesday, summoning American resilience to confront a historic confluence of crises and urging people to come together to end an “uncivil war” in a nation deeply divided after four tumultuous years

Declaring that “democracy has prevailed,” Biden took the oath at a U.S. Capitol that had been battered by an insurrectionist siege just two weeks earlier.

On a chill Washington morning dotted with snow flurries, the quadrennial ceremony unfolded within a circle of security forces evocative of a war zone and devoid of crowds because of the coronavirus pandemic. Instead, Biden gazed out over 200,000 American flags planted on the National Mall to symbolize those who could not attend in person.

“The will of the people has been heard, and the will of the people has been heeded. We’ve learned again that democracy is precious and democracy is fragile. At this hour, my friends, democracy has prevailed,” Biden said. “This is America’s day. This is democracy’s day. A day in history and hope, of renewal and resolve.”

Digital citizens are creators and consumers of:

Answers

Answer:

what is this for

Explanation:

and what consumers u have to say more dude

Answer: digital media

Explanation:

What happens if an industry or company has negatively impacted the public?

Answers

Answer:

In general, bad publicity negatively affects sales. Companies that are virtually unknown can at times experience a boom in business after bad publicity, but they are the exception. In general, bad publicity damages the long-term success of larger established businesses.

Explanation:

The Fertile Crescent refers to:
an area of settlements that were impacted when the moon took on a
civilizations which developed along rivers from the Mediterranean Se
the aid organization
the ability to irrigate crops

Answers

The answer to this quietion is a

Answer:

civilizations which developed along rivers from the Mediterranean Sea to the Persian Gulf

Explanation:

The definition of The Fertile Crescent is- An area of land that is shaped like a crescent moon that extends from the Persian Gulf o the Mediterranean Sea

on ody ssey ware in which i am pretty sure  you are on for this question

next time you should probably look a little closer at the definitions it will help so you don't get confused trust me, but anyway hope this helps.

what is the pronuon agreement




Answers

Answer:

A pronoun must match its antecedent in number. In other words, if the antecedent is plural, the pronoun must be plural, and if the antecedent is singular, the pronoun must be singular.

Explanation:

A group of lists titled United States History, table of contents. The first list is labeled Unit 1, Colonial America with entries Spanish exploration and settlement, French colonization, English/British Colonial America. Second list is labeled Unit 2, Civil War Era with entries Causes of the war, Secession, The Confederacy, The war begins, Reconstruction. What features in the visual would help you when previewing? a. Bold font c. Bullets b. Titles d. All of the above

Answers

Answer:

d

Explanation:

all of them help

Answer:

d

Explanation:

. How many states were there in Kathmandu Valley in the Mediewer
th
Name them.
А.​

Answers

Answer:

Kantipur, Patan and Bhadgaon

Explanation:

Select the correct text in the passage.
What is the opportunity cost in this scenario?
Mikael has saved $4,000 for his trip to Brazil. He has calculated that his total transportation expenses will be $1,000. The hotel will cost him
another $1,500. He will spend about $500 on food. He plans on spending the remaining $1,000 for sightseeing and buying souvenirs.
While booking his plane ticket, he realizes that the price has gone up. His total transportation expenses will go up by $200. He realizes that he
cannot cancel his hotel reservation. He also doesn't want to go cheap on food. Finally, he decides to give up visiting the popular Ouro Preto
during his stay in Brazil.

Answers

Answer:

All the cost sums up to $4,000 when there is no extra charge. In this case, the opportunity cost is the same with the total cost. In this case Mikael is willing to forgo $4,000 for this opportunity and it makes his opportunity cost. However, since the transportation expenses become $1,200 instead of $1,000. We don't know exactly he buys this ticket or not, but since it is said that "while he was booking", we have to consider that he buys the ticket. The hotel costs $1,500 and it cannot be redeemed. However, $2,700 is a sunk cost, not an opportunity cost. Because in this case, Mikael does not have any alternative. He gave up from his decision in the end.

Explanation:

The opportunity cost in this scenario is giving up visiting the popular Ouro Preto during his stay in Brazil. Mikael decides against going to the well-known Ouro Preto since he cannot change his hotel reservation and will not forgo good food.

Opportunity cost is the price of the next best option that is given up while making a choice. In this instance, Mikael has set aside a specified amount for travel, lodging, meals, and sightseeing/souvenirs as part of his vacation to Brazil. But his travel costs will increase by $200 as a result of the higher plane ticket price. Mikael needs to decide where to make budget cuts in order to account for this rise.

Learn more about Opportunity cost here:

https://brainly.com/question/31580865

#SPJ2

In your opinion, what is the greatest benefit of living in a capitalist economy?

Answers

Answer:

Freedom to choose.

Explanation:

Both command and socialist economy require government to assert high level control over the economy. Including the decisions regarding which economic activities should be conducted along with the type of resources that the people can own

Capitalists economy provide the freedom for the people to do whatever economic activities they want and accumulate the ownerships over resources that they obtain from those activities. This encourages innovations and motivation to put in extra work that help improve the economy.

Is the following statement true or false? The Federalists opposed the ratification of the Constitution. Select one: O True O False Check​

Answers

Answer:

False

Explanation:

The Federalists supported the constitution while the Anti-Federalists did not.

Answer:

False

Explanation:

I got it right on prepworks

what are highway's and which are hhe famous highway's in the world​

Answers

Answer:

A highway is a main road, especially one that connects towns or cities.

famous highways are Pan American Highway,Great River Road.

Blue Ridge Parkway. etc

In what ways did South Carolina participate in the events leading up to the American revolution

Answers

Answer:

South Carolina rallied to support the American Revolution. Loyalists and Patriots of the colony were split by nearly 50/50.

Explanation:

By the way, I really like your pfp.

Answer:

When the British attacked Lexington and Concord in the spring of 1775 and were beaten back by the Massachusetts Patriots, South Carolina rallied to support the American Revolution. Loyalists and Patriots of the colony were split by nearly 50/50.

Explanation:

How would you describe the character of Julius Caesar and what brought about his fall
from Power?

Answers

Answer:

Julius Caesar was a smart, brave, ambitious, and megalomaniac. He had many positive qualities that made him a succesful, powerful, and popular man, but also some flaws that ultimately contributed to his downfall.

Explanation:

He was smart because his military intelligence allowed him to defeat many enemies, including those in Gauls. He was ambitious because he concentrated lots of power in himself. He was megalomaniac because he wanted to end the Republic and become dictator for life.

This last aspect is what brought his downfall. He gained the repulsion of most of the Senate, who deemed him to be an existential threat to the Roman Republic, and a public danger, so much that they plotted to kill him, and succeeded in doing so.

What is the difference between creative and team working skill

Answers

Some of the best examples of creative thinking skills may include: lateral-thinking, visual reading, out-of-the-box thinking, copywriting, artistic creativity, problem-solving, analytical mind, and divergent thinking. Here are the best creative thinking techniques you can use.

Here are seven teamwork skills that are essential for your academic and professional success:

Communication. Communication is the foundation of effective teamwork. ...

Time management. ...

Problem-solving. ...

Listening. ...

Critical thinking. ...

Collaboration. ...

Leadership.

Hope it helps

Type an actual answer please.

Last week your laptop crashed. You have been saving money from holiday gifts and, because you are using your own money, can choose which type of computer you want to buy. You have decided to buy a tablet instead of a traditional laptop. Explain what you will take into consideration when purchasing your new tablet. What are some tools that you would use to help make your decision; for instance who’s advice would you take before purchasing your tablet?

Answers

Answer:

Your family, YOU, the people who is selling the item.

Explanation:

Sorry if this does'nt help :(

Answer:

Explanation:

I would research the best tablets that are capable of doing what my laptop did or find one that does most of it. I would do online shopping first because sometimes the stores don't always have whay you need. If online doesn't have it then I would go in store and see what tablets could best fit my needs. To find it in store I would ask the worker that runs the electronics department which tablet they believe would be best capable. I would also see if it has the cheapest price since I'm still buying holiday gifts. These ate the steps I would take to get a new tablet.

I need help on this edpuzzle please help! Thanks!

Answers

Answer:

Allowed for black Africans to seperate and form thier own country

Explanation:

Which profession do you feel are doing a great job in this pandemic?

Situation? Write a brief account how according to your point of view

Answers

The correct answer to this open question is the following.

The profession that I feel is doing a great job in this pandemic is medical doctors. However, I would like to include the nursers, first responders, and emergency people because they are also doing a marvelous job in trying to provide the best aid for the people in need.

These people are completely above politics that say many things about the pandemic. Although some say this is a conspiracy of the government, or that they trying to force the vaccine to control us, and more, the medical profession is dedicated to providing the best service that is in their hands.

who is the president of America​

Answers

Answer:

It's Joe Biden

According to the video, what business are Manicurists and Pedicurists really in?

The self-esteem business
the performance business
the marketing business
the fashion design business

Answers

Answer:

A

Explanation:

got it right on edge

Answer:

Yea A

Explanation:

According to the Conflict theorists, ____ is a condition in which the beliefs, ideals or ideology of a person are not in his/her own best interests.

Answers

Answer:

False Consciousness

Explanation:

According to conflict theorists, ____ is a condition in which the beliefs, ideals or ideology of a person are not in his/her own best interests.

False Consciousness

How did the Northwest Ordinance of 1787 affect the formation of the United States? 8.10 C
A
It established a system for dividing the Western Territory.
B-It allowed slavery in the Northwest Territory.
C-It established procedures for settlement of the Northwest Territory.
D-It allowed states east of the Appalachian Mountains to become states,

Answers

Answer: The Northwest Ordinance of 1787 affected the united states because it set the standard for how the USA would bring new states into the Union.

Explanation:

Wanted a strong central/national government (Federalist or Anti Federalist)

Answers

Answer:

Federalist

Explanation:

federalists are in support of a strong government. The word federal means national government.

anti did not want a strong central government

Which country separates the Bay of Bengal from the Arabian Sea?

Answers

Answer:Republic of India

Explanation:

The Indian peninsula is separated from mainland Asia by the Himalayas. The Country is surrounded by the Bay of Bengal in the east, the Arabian Sea in the west, and the Indian Ocean to the south.

Which of the following belongs in the empty box

Answers

Answer:

Reason why people fail to vote

Explanation:

why people fail to vote

how would you verify whether a silk dress both by your mother is made from pure silk and artificial one...​

Answers

Answer:

Silk, as one of the better and better fabrics, is susceptible to mixing with other fabrics that are similar to it.

Explanation:

The first way to recognize real silk is to rub it between your hands. Real silk would become warm by rubbing between your hands. In addition, rubbing silk between the hands produces a sound.  

Another way to recognize real silk is to crumple it. Real silk should not immediately return to its original shape and wrinkles should remain.

Also, you can push the fabric you plan to buy through the ring. If the silk is real, you should simply do it because real silk is smooth and flexible.

The simplest way to recognize real silk is to light it, Take a piece of thread, and light it. If it is real silk, the thread will burn slowly and the flame will not be visible, and it will smell like burnt hair.

Given what culture means, given an examples of what might count as a cultural achievement.

Answers

Answer:

In general, cultural achievements are those taught informally within a culture, through socialization, as opposed to achievements mastered formally through schooling. ... Some examples of cultural skills expected in most of the United States today include speaking English, handling money, and using a telephone.

hope this helps! :)

Explanation:

Answer:Rubbish question no use u are in the wrong way

Explanation:

What branch has the power to Impeach/convict the president?

Answers

Answer:The constitution gives congress the authority to impeach and remove

Explanation:

Answer:

The Constitution gives Congress the authority to impeach and remove "The President, Vice President, and all civil officers of the United States" upon a determination that such officers have engaged in treason, bribery, or other high crimes and misdemeanors.

Define each of the following terms in a complete sentence: annulment, armada, federalism.

Answers

Answer:

Explanation:

Annulment is a legal procedure or proceedings make by the court that cancels marriage or render it invalid or null and void.

Armada is word from Spanish and Portuguese which refer to many naval ships or fleet of war ships.

Federalism is a political organization that distribute power or authority and unit general government and regional government. It United States that separated within a political system.

Old, Middle, and New were used to describe Egypt's

Answers

if its question so this
The history of ancient Egypt is divided into three main periods: the Old Kingdom (about 2,700-2,200 B.C.E.), the Middle Kingdom (2,050-1,800 B.C.E.), and the New Kingdom (about 1,550-1,100 B.C.E.). The New Kingdom was followed by a period called the Late New Kingdom, which lasted to about 343 B.C.E.

if true or false
answer is true

uwu

There are four main presidential powers, which one do you think is the most important and why?

Answers

Answer:

To sign or veto legislation

Explianation: To sign or veto legislation keeps other governments factions to stay a minimal power from one another, so one party doesn't trample over the others. It also constricts unlawful laws passed down by legislation.

Other Questions
Which of the following describes hetereogeneous mixture... 1)A mixture that is easily separated, the components are different sixes and unevenly mixed. 2) A mixture that is very difficult to separate, the contents are evenly mixed and the mixture looks like a substance Light rays from the sun are called: solar energy heat energy chemical energy a circle has a center at (-2,7). if a point on the circle has coordinates (3,-1) then which of the following would be the length of the radius of the circle write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC if you answer some of them ill appreciate it ( you don't have to answer all of them ) What can cause a significant change in someones life Which value is in the domain of f(x)?f(x) = StartLayout Enlarged left-brace 1st row 1st column 2 x + 5, 2nd column negative 6 less-than x less-than-or-equal-to 0 2nd row 1st column negative 2 x + 3, 2nd column 0 less-than x less-than-or-equal to 47645 How is the idea of freedom presented in Martin luther kings speech? Explain what is meant by "majority opinion".Your answers Lieutenant Patrick O'Bannon defeated the Pasha of Tripoli at ___.ItalyWeehawkenEgyptNew OrleansDerna Explain the role that King George III played during the American Revolution. WILL MARK BRAINLIEST:> IF YOU ARE LUCKY pick a number from 1 to 20 CLOSEEST NUMBER TO THE NUMBER I PICK WILL BE THE BRAINLIEST GOOD LUCK How do you make someone brainliest In the 1800s, unmarried women hadmore rights than married women.the same rights as married women.fewer rights than married women.no rights, just like married women. List and explain the major features that the following building designs must have to relate directly to their functions.-Hospital-Airport-Courthouse A student observes a difference in the activity level of fish at a pet store. The fish in an aquarium near the window are swimming around more quickly tha the fish in an aquarium placed in the back of the store. The student forms a hypothesis about the effect of sunlight on fish activity levels and arranges to conduct an experiment. Which variable could be an independent variable in the student's experiment? types of fish sold speed of swimming fish amount of time fish were active temperature of water in fish tank how do you do this equation ?solving inequalities 8 2x < x + 7 Need help with this math problem Bacteria reproduce in a process called binary fission which of the following is true about binary fission? The expression 17x is equivalent to the expression x 7.