Triangle BCD, with vertices B(-2,-7), C(-4,-2), and D(-7,-4), is drawn on the coordinate grid below.

What is the area, in square units, of triangle BCD?

(Geometry)

Triangle BCD, With Vertices B(-2,-7), C(-4,-2), And D(-7,-4), Is Drawn On The Coordinate Grid Below.What

Answers

Answer 1

Answer:

[tex] \frac{4}{15} [/tex]

in percentages


Related Questions

8) You and your friends go out for lunch. You decide to tip the waiter 25%. The total bill is . $78.52.​

Answers

$19.63 would be 25% of the bill

Kiara invested $3,500 into two accounts. One account paid 5% interest and the other paid 7. 5% interest. She earned 6% interest on the total investment. How much money did she put in each account?.

Answers

The amount invested in the account that pays a 5% interest is $2100 and the amount invested in the account that pays a 7.5% interest is $1400.

What are the simultaneous equations that can be used to represent the question?

0.05a + 0.075b = (0.06 x $3500)

0.05a + 0.075b = $210 equation 1

a + b = $3,500 equation 2

Where:

a = amount invested in the account that paid a 5% interest

b = amount invested in the account that paid a 7.5% interest

How much was invested in the account that pays a 7.5% interest?

In order to determine this value, multiply equation 2 by 0,05

0.05a + 0.05b = 175 equation 3

0.025b = 35

b = $1400

How much was invested in the account that pays a 5% interest?

a + $1400 = $3500

a = $3500 - 1400

a = $2100

To learn more about simultaneous equations, please check: https://brainly.com/question/25875552

Please help me with this

Answers

Answer:

I think -1 cuz 2+1--1 so yh I guess

please help! with explanation please

Answers

Answer:

x = 13.773

Step-by-step explanation:

cos(∠ABC) = [tex]\frac{BC}{AB}[/tex]

cos(37°) = [tex]\frac{11}{x}[/tex]

x = 13.773

How to figure out the volume for a 3/4 cylinder
With height of 28

Answers

Multitasking both nunber together and then all of them together

Write an exponential function to represent a person consuming a bag of candy in which the initial value in an is 175 pieces and the rate of decay is 20%.

Answers

We will see that the exponential decay function is:

f(x) = 175*(0.8)^x

How to find the exponential decay?

The general exponential decay is:

f(x) = A*(1- r)^x

Where:

A is the initial value.r is the rate of decay in decimal form.x is the variable, in this case is the time.

Here we know that the initial value is 175, and the rate of decay is 20%. To get this in decimal form, we just divide it by 100%.

20%/100%  = 0.2

Replacing that in the exponential function, we get:

f(x) = 175*(1 - 0.2)^x

f(x) = 175*(0.8)^x

If you want to learn more about exponential functions, you can read:

https://brainly.com/question/11464095

probability

pls help

Answers

Answer:

inbox I think maybe I can help

whats the answer for this oneeeeeeb

Answers

Answer:

x ≈ 229.8

Step-by-step explanation:

using the cosine ratio in the right triangle

cos72° = [tex]\frac{adjacent}{hypotenuse}[/tex] = [tex]\frac{LM}{KM}[/tex] = [tex]\frac{71}{x}[/tex] ( multiply both sides by x )

x × cos72° = 71 ( divide both sides by cos72° )

x = [tex]\frac{71}{cos72}[/tex] ≈ 229.8 ( to the nearest tenth )

Joshua has a ladder that is 18 ft long. He wants to lean the ladder against a vertical wall so that the top of the ladder is 17.7 ft above the ground. For safety reasons, he wants the angle the ladder makes with the ground to be no greater than 78°. Will the ladder be safe at this height?

Answers

For safety reasons \theta should not be greater than 70 and with the current scenario\theta= 79.52

the ladder will not be safe at this height

\theta= 79.52

Arithmetic

Question Parameters:

Joshua has a ladder that is 18 ft long.

He wants to lean the ladder against a vertical wall so that the top of the ladder is 17.7 ft

Generally the equation for the angle ABC is mathematically given as

Let ∠ABC = \theta

In the right angle triangle ACB,

Hence

sin ∠ABC  = AC / AB

sin \theta = 17.7 / 18

[tex]\theta = sin-1 (17.7 / 18)\\\\\theta = 79.52[/tex]

For more information on Arithmetic

https://brainly.com/question/22568180

What is the volume of the sphere in terms of 17
1 =
Itin.
6 in.

Answers

Answer:

V = 288π in³

Step-by-step explanation:

[tex]V = \frac{4}{3}\pi r^3[/tex]

The radius is 6 in

[tex]V = \frac{4}{3} \pi (6)^3[/tex]

[tex]V= \frac{4}{3} \pi (216)[/tex]

[tex]V = \frac{4}{3} (216)\pi[/tex]

[tex]V=\frac{864}{3} \pi[/tex]

[tex]V = 288\pi in^3[/tex]

Put the following equation of a line into slope-intercept form, simplifying all fractions.
12x-20y= 60

Answers

Answer:

[tex]y=\frac{3}{5} x-3[/tex]

Step-by-step explanation:

Slope-intercept form: y = mx+ b

m = slope

b = y-intercept

Rearrange the equation:

[tex]-20y=-12x+60[/tex]

Divide each side by -20:

[tex]\frac{-20y}{-20} =\frac{-12x}{-20} +\frac{60}{-20}[/tex]

[tex]y=\frac{3}{5} x-3[/tex]

[tex]y=\frac{3}{5} x-3[/tex] is your simplified, slope-intercept form equation.

Reflect about the line x=5

Answers

Hope it helps you mate

have a good night

If it is reflected about the line x = 5, the new point is (3, 2), (3, 6), (1, 1) and (1, 8)

Transformation

Transformation is the movement of a point from its initial location to a new location. Types of transformation are rotation, reflection, translation and dilation.

Given the figure with vertices at (7, 2), (7, 6), (9, 1) and (9, 8). If it is reflected about the line x = 5, the new point is (3, 2), (3, 6), (1, 1) and (1, 8)

find out more on Transformation at: https://brainly.com/question/1462871

According the contract, which of the following is not a responsibility of the HOA? a. Monitor overnight parking at least once a week b. Give a written warning for the first infraction of overnight parking c. Give a written warning for the second infraction of overnight parking d. Tow the car of a homeowner who has parked in the street overnight five nights in a row.

Answers

Answer:

The correct answer is letter D: tow the car of a homeowner who has parked in the street overnight five nights in a row.

This rule was not mentioned in the said contract. HOA specifically notified that if a person violates the rule more than three times, fines will be given to this violator.

Step-by-step explanation:

Answer:

its c

Step-by-step explanation:

did the test got it wrong but it showed the answer

Graph 0.04x+0.02y=0.08.

Answers

Answer: Graph attached

Answer:

view attached graph.

Step-by-step explanation:

0.04x + 0.02y = 0.08.

0.02y = -0.04x + 0.08

/0.02    /0.02

y = -2x + 4

Hope this helps!

Anna and Sal purchased two tickets at Urban Air Adventure Park for $30.00 each. Both bought a
Gatorade afterwards. Sal used a gift card for $25.00 that he received from his aunt for his birthday.
After using the gift card, their total cost was $40.90.

What is the cost of one Gatorade? ( I mainly need the equation that would be used )

Answers

The cost of one Gatorade is $32.95.

What is the cost of one Gatorade?

The total cost of both gatorade is the sum of the value of the gift card and the total cost.

Total cost of both gatorade = value of the gift card + total cost  

$25 + 40.90 = $65.90

In order to determine the cost of one gatorade, divide $65.90 by 2

The cost of one gatorade = Total cost of both gatorade / 2

$65.90 / 2 = $32.95

To learn more about division, please check: https://brainly.com/question/13281206

Suggest why an increasing number of megacities are located in lower income countries or newly emerging economies.

Answers

Answer:

miami

Step-by-step explanation:

(–3f – 4g + 9) – (2 – 6f + 5g)

Answers

The answer is 3f - 9g + 7

Collect like terms
-3f + 6f = 3f
-4g - 5g = -9g
9 - 2 = 7

3f - 9g + 7

Please mark Brainliest!

Write a sine function that has a midline of 5, an amplitude of 2 and a period of 3pi

Answers

I hope this helps (:

(1 point)
1. A model is made of a car. The car is 9 feet long and the model is 6 inches long. What is the
ratio of the length of the car to the length of the model?
O 18:1
01:18
09:6
06:9

Answers

Answer:

9:6

Step-by-step explanation:

Given:

Length of car = 9 feet

Length of model of car = 6 inches

Let's find the ratio of the length of the car to the length of the model.

To find the ratio of the length of the car to the length of the model, apply the formula:

Ratio ==> Length of car : Length of model

Ratio ==> 9 : 6

Therefore, the ratio of the length of the car to the length of the model is = 9 : 6



What is the area of the model

Answers

The area of the model is 100.25in^2
So, letter D

Factor each expression. 1. 63a − 42b

Answers

Answer:

[tex]63a - 42b \\ \\ = 21(3a - 2b)[/tex]

# be care#

Maribel is offered a job as a paralegal at an annual base salary of $47,000. In addition, the company will pay the following benefits: a retirement contribution that is 10.5% of Maribel’s base salary, disability insurance totaling $338, medical insurance totaling $6,500, and a year-end bonus of 17% of her base salary. What is the annual value of this job to Maribel?

Answers

Answer:

66763

Step-by-step explanation:

47000*(1+0.105+0.17)+338+6500

When adding like fractions, why is the numerator the only part of the fraction that changes

Answers

If you have the same denominator then only the numerator changes but if the denominators are different then the denominator and the numerator will change

a jewerly shop shop sells 240 necklaces in a month. 180 of the necklaces were sold via the shops, website, the rest were sold in a high street shop. work out the ratio of online sales. give your answer in its simplest form

Answers

Answer:

The workout ratio of the online sales to shop sales is 1:3.

A teacher writes the expression 3 (6m + 3) and asks for students to write equivalent expressions. The table shows the students' responses.
Student
1
2
3
4
Response
9m + 6
18m + 3
18m + 9
21m
Select the best answer from the choices below:
Student 1 is correct because distributing the 3 in the teacher's expression yields Om + 6
Student 2 is correct because distributing the 3 in the teacher's expression yields 18m + 3
Student 3 is correct because distributing the 3 in the teacher's expression yields 18m + 9
Student 4 is correct because distributing the 3 in the teacher's expression, and then adding the two terms together yields 21m

Answers

Student 3 is correct. This is because you can distribute 3. You would do 3x6m, or 18m, and you can do 3x3, or 9. This means that Student 3 is correct. Since m is not defined as an integer, it can’t be any of the other choices.
Student 3 is correct because distributing the 3 in the teacher's expression yields 18m+9. Basically, everything in the parentheses was equally multiplied by 3, and you cankt add a variable and a number without one together, so it is the final and correct answer.

Please educated people solve my question.. i asked it an hour ago nobody knows it

Answers

AB = AX+XB = 6+18 = 24

The ratio of AB to AX is AB/AX = 24/6 = 4

AC = AY+YC = 10+25 = 35

The ratio of AC to AY is AC/AY = 25/10 = 3.5

The results of each division are 4 and 3.5

We do not get the same result, which means that the proportion [tex]\frac{AB}{AX} = \frac{AC}{AY}[/tex] is not true. This is sufficient to prove that the triangles aren't similar. We need them to be in proportion so that we can use the SAS similarity rule.

Answer: The triangles aren't similar

(Please answer ASAP) A bag contains three red marbles, five green marbles, and two blue marbles.

a. What is the probability of getting a red marble?

b. What is the probability of NOT getting a red marble?

Answers

Answer:

a. 3/10

b. 7/10

Step-by-step explanation:

a. Total number of marbles = 10

Number of red marbles = 3

Probability = Number of outcomes/ Total number of outcomes

= 3/10

b. Total number of marbles = 10

Number of red marbles = 3

Number of marbles excluding the red marbles

= 10 - 3 = 7

Probability = Number of outcomes/ Total number of outcomes

= 7/10

Graph 0.04x+0.02y=0.08.

Answers

Answer:

see below

Step-by-step explanation:

let's convert it into slope intercept form first as it will get rid of the decimals. so we must get it to follow the form of y = mx + b.  

so we must isolate the y variable:

- subtract 0.04x from both sides

- now we have 0.02y = 0.08 - 0.04x, and to follow the form this can also be 0.02y = -0.04x + 0.08

- divide both sides by 0.02

- now we have y = -2x + 4, so we know the slope is -2

now lets find the intercepts:

y intercept => set x=0

y = -2(0) + 4

y = 4

so we have (0,4)

x intercept => set y=0

0 = -2x + 4

-4 = -2x

x= 2

now we have (2,0)

graph it:

with two points (the intercepts) and the slope we can find a graph that looks like this

Using derivatives+optimization, find the dimensions of the rectangle of largest area that can be inscribed in an equilateral triangle of side 12.

Answers

Check the picture below atop.

we know is an equilateral triangle, meaning that all its interior angles are 60°, and thus if we run a line from the top vertex as you see there, we end up with a 30-60-90 triangle, either way there's an equation to get its height, and anyhow the altitude of it is 6√3.

As the rectangle moves up and down the triangle, with the rectangle having a width of "w" and a length of "L", the triangle that it forms above itself is a triangle, always with a base of "L" and a height of 6√3 - w.

BTW we laid the rectangle as you see on the bottom side, but laying it anywhere else it'd have ended up in the same arrangement.

well, with the bottom of the rectangle beign parallel to that of the side of the circumscribing triangle, the small upper triangle is similar to the containing triangle by AAA, and since we have similar triangles, we can say that.

[tex]\cfrac{6\sqrt{3}}{12}=\cfrac{6\sqrt{3}-w}{L}\implies \cfrac{\sqrt{3}}{2}=\cfrac{6\sqrt{3}-w}{L}\implies L\sqrt{3}=12\sqrt{3}-2w \\\\\\ L=\cfrac{12\sqrt{3}-2w}{\sqrt{3}}\implies L=12-\cfrac{2w}{\sqrt{3}}\implies L=2\left(6-\cfrac{w}{\sqrt{3}} \right) \\\\[-0.35em] ~\dotfill\\\\ \stackrel{\textit{Area of the rectangle}}{A=wL\implies A(w)=w\cdot 2\left(6-\cfrac{w}{\sqrt{3}} \right)}\implies A(w)=2\left(6w-\cfrac{w^2}{\sqrt{3}} \right)[/tex]

[tex]\cfrac{dA}{dw}=2\left(6-\cfrac{2w}{\sqrt{3}} \right)\implies \cfrac{dA}{dw}=4\left(3-\cfrac{w}{\sqrt{3}} \right) \\\\[-0.35em] ~\dotfill\\\\ 0=4\left(3-\cfrac{w}{\sqrt{3}} \right)\implies \boxed{w=3\sqrt{3}}[/tex]

hmmm the way I usually run a 1st derivative test is, by using the critical point and slicing from it just a tiny bit, like say 3√3 - 0.000000001 to check the region on the left and then 3√3 + 0.000000001 to check the region on the right.

Check the picture at the bottom, the 1st derivative test more or less gives us those values, positive on the left-side and negative on the right-side, meaning as you can see in the arrows, is a maximum at that point.

[tex]\stackrel{\textit{we know that}}{L=2\left(6-\cfrac{w}{\sqrt{3}} \right)}\implies L=2\left(6-\cfrac{3\sqrt{3}}{\sqrt{3}} \right)\implies \boxed{L=6}[/tex]

Which statements are true? Check all that apply.
0 6>4
10 9
0 2>7
O 7 < 5
10 12
O 2 < 5
11

> 11
20

Answers

Answer:

06>4

Step-by-step explanation:

yes that. is the answer because 06 is greater than 4

Other Questions
A field is a rectangle with a perimeter of 960 feet. The length is 400 feet more than the width. Find the width and length of the rectangular field. CSI Miami: Using DNA to Solve a RobberyThe year is 2023. You are a detective for the Miami Dade Police Department. Youre on the scene of a crime where a man single-handedly just robbed a bank. Luckily, being the ingenious detective that you are, you were able to find a little spot of the mans blood where he cut his arm as he made his escape through a broken window. You take the blood to the lab so tests can be run. Unfortunately, no one was able to see the face of the man, so there are no suspects yet. Thanks to a study done in 2022, scientists have now figured which genes in DNA code for which characteristics in a person. On the next page is a strand of the sample of DNA extracted from the blood at the crime scene. Follow the steps below to help you come up with a sketch of the man who perpetrated this crime.methionine-leucine-proline = Protein that causes DARK SKINmethionine-leucine-leucine = Protein that causes LIGHT SKINvaline-proline-proline-lysine = Protein that causes GREEN EYESproline-leucine-valine-proline = Protein that causes BLUE EYESproline-lysine-proline-proline = Protein that causes BROWN EYESlysine-arginine-threonine-valine-serine-serine = BLOND HAIRlysine-arginine-threonine-valine-serine-cystine = BLACK HAIRlysine-arginine-threonine-valine-serine-valine = BROWN HAIRasparagine-isoleucine-arginine = CURLY HAIRasparagine-asparagine-isoleucine = STRAIGHT HAIRleucine-arginine-glutamic acid-arginine = BIG NOSEleucine-asparagine-arginine-glutamic acid = SMALL NOSEleucine-asparagine-asparagine-glutamic acid = MEDIUM NOSEproline-tyrosine-tyrosine-(stop) = SMALL EARSproline-proline-tyrosine-(stop) = MEDIUM EARS proline-tyrosine-phenylalanine-(stop) = BIG EARS Step 1: Decode the DNA into mRNAStep 2: Decode the mRNA into the corresponding amino acids from pg. 211 of your book. Write the amino acids in the order of the codons from the mRNA.Step 3: On a separate sheet of paper, draw a sketch of what this person might look like based on the traits you came up with. DNA: TACGATGAAGGCAATCAAGGGTTCTCCTGTCAAAGTACATTATAGGCAGACTTAGCGGTTGGAATGAAAATC | | |AUGmRNA:Protein Sequence: 1. Methionine 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. Step 4: Change the underlined nucleotide to a G. Refigure out your mRNA sequence and resulting amino acids. How would this mutation affect your picture? What kind of mutation did you just create?Step 5: Answer the following wrap-up questions:1) When you performed step 1, what enzyme were you imitating?2) In step 2, what molecule would have brought the amino acids that the codons asked for?3) In step 2, what molecule would have helped the amino acids line up and attach to one another?4) In step 2, what connected the amino acids together? What does In Truth's day-star mean in Edgar Allan Poe poem A Dream Which quotation from "Harrison Bergeron" by Kurt Vonnegut Jr. Best develops the theme that attempting to make people "equal every which way" is a dangerous and harmful goal? Question 3 options: "All this equality was due to the 211th, 212th, and 213th Amendments to the constitution, and the unceasing vigilance of agents of the United States. " "Then other people'd get away with it and pretty soon we'd be right back to the dark ages again, with everybody competing against everybody else. " The musicians scrambled back into their chairs, and Harrison stripped them of their handicaps, too. " "Every twenty seconds or so, the transmitter would send out some sharp noise to keep people like George from taking unfair advantages of their brains. ". PLSSS HELP IF YOU TURLY KNOW THISS You sell triangular flags made from felt. How much felt do you need to make 60 flags? Bill's chocolate bar is 69% cocoa. If the weight of the chocolate bar is 83 grams, how many grams of cocoa does it contain? Round your answer to the nearest tenth. Le dimanche 27 aot, Katy Perry (1)(donner) un concert au stade de France. a/C' (2)(tre) son premier concert parisien-Il y en a trois autres au programme, et il n'y (3)(avoir plus une seule place de libre l'intrieur, le public (4)(attendre) la star avec impatience quand tout coup, Katy Perry (5)(faire) son apparition. Elle(6)(sortir) d'une boule disco et elle (7)(commencer) sonspectacle. Les fans (8)(adorer)!Verbs in pass compose or imparfait. President Woodrow Wilson a. promoted racial equality. b. promised to respect Latin Americas independence. c. stopped U.S. investment in Latin America and the Caribbean. d. aligned with Dollar Diplomacy. e. designed a program to instill American values in Latin American schools. List three reasons why a study may be considered invalid. A neutral atom of Fluorine has seven valence electrons. How many valence electrons are present in the ion F-1? Conflict avoidance in relationship can someone explain the answer plz Which of the following is formed when minerals and extreme heat and pressure are combined? PLS I WILL GIVE YOU 23 POINTS IF YOU ANSWER ME CORRECTLYThe diagram shows 3/4 of a fraction strip shaded. Mary erases some of the shadings to show 5/8. Explain the steps she took to shade 5/8 of the fraction strip. Sean is filling his truck with gasoline. He knows the total cost, C, will be proportional to thenumber of gallons of gasoline, g, that he puts into the gas tank. After putting 8.5 gallons in.the tank, the cost is $23.63.(a) Find the ratio of the cost to the gallons as(b) What is the real world meaning of youra unit rate. Show the division as a fraction answer in (a)?and then state the answer with appropriateunits.(c) If c is the cost and g is the number ofgallons bought, write a proportioninvolving c and g and then solve it for c.(d) If Sean puts 17 gallons of gasoline intohis truck, what is his cost? Justify. 57 women make up an all female choir in a church.Two women are chosen to sing together for a duet.How many possible pairs could be chosen for the duet? Why is physical activity so important in preventing heart disease? Svetlana and her mother are very similar. Both have blonde hair, a love of scrapbooking, blue eyes, and a thin nose. Which statement most likely describes Svetlanas traits? Svetlana inherited her love of scrapbooking from her mother, but her blue eyes come from her environment. Svetlana inherited her blue eyes from her mother, but her love of scrapbooking comes from her environment. Svetlana inherited her thin nose from her mother, but her blonde hair comes from her environment. Svetlana inherited her blonde hair from her mother, but her thin nose comes from her environment. German troops could have entered France by going through Switzerland. Use what you know about both political and physical geography to explain why it made more sense for them to go through Belgium