Answer: false
Explanation: the correct complementary strand would be ATGCAA
Why do you get a sugar rush immediately after
eating candy?
A. because your LIVER is working to detoxify the candy before it
poisons you
B. because candy is composed primarily of STARCHES which are
quickly broken down by enzymes
C. because your taste buds are reacting to the candy and are
overwhelmed by how good it tastes
D. because candy is composed primarily of SIMPLE SUGARS which
are quickly broken down by enzymes
Answer: D because candy is composed primarily of SIMPLE SUGARS which are quickly broken down by enzymes
Explanation: The sugar in it -- called a simple carbohydrate -- is quickly turned into glucose in your bloodstream. Your blood sugar levels spike. Simple carbs are also found in fruits, veggies, and dairy products.
Answer:
Your answer is D.
Explanation:
If a blue nose baboon had 50 chromosomes in a body cell how many are in a gamete?
Answer:
23 chromosomesIn humans, gametes are haploid cells that contain 23 chromosomes, each of which a one of a chromosome pair that exists in diplod cells. The number of chromosomes in a single set is represented as n, which is also called the haploid number.
Help me please I’m takin a test
Earth and space
Help me please
Earth and space
True. Igneous rocks are formed by cooling and solidification of magma or lava.
1. What are the methods by which fossils are preserved?
Answer:
unaltered software or Hard parte, altered Hard parte, and trace fossils.
The nose plays many important roles in the conduction of air into the lungs. Air entering the nose from the body’s exterior is very different from the air within the body and lungs. All BUT ONE describes how incoming air is changed by the structure of the nose and nasal passages.
A) As air passes over the mucous membranes, it is warmed and humidified.
B) The olfactory epithelium contain neurons, which conduct sensory signals to the brain.
C) Hairs and mucus on the interior of the nose also catch any solid debris before it can enter the lungs.
D) The convoluted inner structure of the nose increases the surface area of the respiratory tract and forces air to contact the mucous membranes lining the nasal cavity.
C) Hairs and mucus on the interior of the nose also catch any solid debris before it can enter the lungs.
if a molecule of DNA has 200 pairs how do the DNA molecules fit into the cell?
I do not know but does it depend on how big or what the temperature is
10 Elements with symbols other than their first two letters
Answer:
Sodium (Na – Natrium)
Potassium (K – Kalium)
Iron (Fe – Ferrum)
Copper (Cu – Cuprum)
Silver (Ag – Argentum)
Tin (Sn – Stannum)
Antimony (Sb – Stibium)
Tungsten (W – Wolfram)
Gold (Au – Aurum)
Mercury (Hg – Hydrargyrum)
Explanation:
The possible consequences of deficiencies or excesses of
various nutrients?
Answer:
People who are undernourished may experience weight loss, fatigue and mood changes or develop vitamin and mineral deficiencies. Overnutrition can lead to overweight, obesity and inadequate micronutrient intakes and deficiencies. Both types can lead to health issues if not addressed.
Explanation:
please help me in this question thank yoy
what is defination of spirometer?
Answer:
A spirometer is a device that measures the amount of air you take in per breath.
Explanation:
The spirometer measures the air from volume, and can compare it to someone of your same age, height, and gender. This is helpful to tell if your lungs aren't working properly to help doctors help you with your problems.
One strand of a DNA molecule has the base sequence ATAGGT. The complementary base sequence on the other strand of DNA will be..
Answer:
"If one strand of a DNA molecule has the base sequence ATAGGT, then the complementary base sequence on the other strand of DNA will be TATCCA."
NOTE: Please thank the other user responsible for this answer. Go to their post. I will link their post. As this has been answered before.
Explanation:
https://brainly.com/question/24547936
"If one strand of a DNA molecule has the base sequence ATAGGT, then the complementary base sequence on the other strand of DNA will be TATCCA.
DNA is a double helix molecule composed of two long chains of nucleotides. The complementary nucleotides in opposite DNA strands are paired together by hydrogen bonds.
In DNA, there are four types of nucleotides, each one containing a different nitrogenous base (i.e., Adenine, Guanine; Cytosine and Thymine).
According to the base pair rules, Adenine always pairs with Thymine by two hydrogen bonds, whereas Guanine pairs with Cytosine by three hydrogen bonds.
In conclusion, if one strand of a DNA molecule has the base sequence ATAGGT, then the complementary base sequence on the other strand of DNA will be TATCCA."
where is glucose stored or found in the leaf?
draw the diagram of self pollination
Answer:
Hope It'll Help You....The diagram of self pollination is given in the attachment of this sheet.
However, self pollination is the transfer of pollen grains from the anther of a flower to the stigma of the same flower
What is pollination?This is the transfer of pollen grains to a stigma of a flowering plant.
The pollen grains transfer could be to the stigma of the same or different flower.
There are two types of pollination. These are given below:
Self pollinationCross pollinationThe essence of pollination is fertilization.
Learn more about pollination:
https://brainly.com/question/19814108
Which object can an S wave travel through?
air
magma
soil
water
Answer:
soil
Explanation:
example : earthquakes
Secondary waves, which are called S waves, usually travel through solids such as the crust, granite and soil
quizlet usgs
Answer: Option C
Explanation:
Gene A is 10 mU from Gene B on chromosome 2, and the alleles are in coupling. An individual with the genotype AaBb is testcrossed. What fraction of the offspring would be expected to have genotype aabb?
The answer is supposed to be 45% but I'm unclear on how to get there. Thanks!
Answer:
Parental chromosomes A----b and a-----B when fertilized with ab will produce AabB and aaBb - these will be progeny with parental chromosome --- so no recombination.
You are told that map distance is 20cM which is also telling you that recombination frequency is 20% , so % progeny showing recombination = 20%, so % progeny not showing recombination is 100= 20 = 80%. This will be composed of the 2 parental categories, as above so % aaBb = 40%
Explanation:
List 3 Functions of translocation
substances
List 3 functions of translocations
Answer:
function of translocation
ans- function to deliver nutrients and other molecules over long distance throughout the organism
If anyone answers this ill give you 10,000 points guaranteed
A population of 137 prairie dogs have taken up home in a school football field! The area of a football field is 7140 m2 (1.8 acres). What is the population density of prairie dogs in the football field in m2 and acres?
Explanation:
no need for the 10k points, it was really easy!
In the above diagram of a plant cell, what is the function of structure 1?
A.
captures light energy and performs photosynthesis
B.
is the site of protein and lipid synthesis and controls cell transport
C.
contains genetic information and serves as the control center of the cell
D.
serves a variety of secretory, excretory, and storage roles
Answer:
C.
contains genetic information and serves as the control center of the cell
Explanation:
i hope it's help
What are the subareas of the kidney?
Which is a risk factor for CAD?
blood clot
embolism
angina
high blood pressure
If an mRNA codon reads GAU, its complementary
anticodon on the tRNA will be
A. TUC
B. CUA
C. AUG
D. CAG
Which of the following is a product of respiration resulting from the breaking of carbon-carbon bonds?
a.
a. glucose
b. oxygen
C. carbon dioxide
d. all of the above
Please select the best answer from the choices provided
Ο Α
ОВ
Ос
OD
Answer:
Carbon Dioxide
Explanation:
Its what we breathe out.
The product of respiration resulting from the breaking of carbon-carbon bonds is carbon dioxide. Thus, option C is correct.
What is Hydrogen Fuel Cell?A hydrogen fuel cell uses the chemical energy of hydrogen to produce electricity. It is a clean form of energy with electricity, heat and water being the only products and by-products. Hydrogen is the main fuel, but fuel cells do require oxygen.
One of the main appeals of fuel cells is that they generate electricity with very little pollution – much of the hydrogen and oxygen used to generate electricity ultimately combine to form a by-product, namely water.Hydrogen fuel cells burn with oxygen and produce water.
Chemical equation has been known as a symbolic representation of a chemical reaction which has been written in the form of the symbols and chemical formulas.
Thus, option C is correct.
Learn more about chemical reaction on:
https://brainly.com/question/29039149
#SPJ7
Earth Science B Cumulative Exam review
i got 100% on this
Which statement describes indoor air pollution?
B
Which event is associated with tornados?
C
Which describes one feature of deep ocean currents?
D
What would be affected negatively by contaminated watersheds?
A
Which correctly list the three gases that each make up less than 1 percent of Earth’s atmosphere?
A
A scientist observes a geyser erupting. Which two objects must be interacting beneath the surface?
C
Which is a cause of desertification?
C
Which phrase defines altitude?
D
Where does warm water accumulate in the Pacific Ocean during El Niño?
A
Which statement describes watersheds?
A
How do oxbow lakes form?
C
Which is one benefit that mangrove trees provide to surrounding coastal wetlands?
A
Which resource is renewable?
D
Which is one function of a weather balloon?
B
Which major type of air mass forms over warm water?
C
In which direction does wave energy travel?
D
Which type of deposition creates sandbars?
C
Energy output readings from tidal power plants in the ocean are low one day compared to the rest of the month.
Which event is the most likely cause?
A
Which type of cloud forms close to the ground when the temperature is just above the dew point?
C
A loose pile of rocks and soil travels in a single large mass. The mass moves a short distance downhill.
Which mass movement does this describe?
D
Which correctly lists the three land uses that the Bureau of Land Management was originally created to manage?
C
What happens when the atmosphere interacts with the lithosphere?
A
A scientist is observing surface groundwater features to determine sources of groundwater.
Which is one surface feature that the scientist can observe and map?
A
Which belt is a global wind belt found in the middle latitudes?
D
What leads to the formation of a windchill factor?
D
Answer:
ok good job! im so proud of youuuu!!!!
Explanation:
dust, dirt and gases are the examples of indoor air pollution whereas carbon dioxide, methane and neon are the gases that make up the remaining 0.1 percent.
What is indoor air pollution?Indoor air pollution is dust, dirt and gases in the air inside home or workplace that could harm to the health of people. It causes lung diseases like asthma, COPD, lung cancer, heart disease and stroke.
Carbon dioxide, methane and neon are the gases that make up the remaining 0.1 percent. This means that these gases are present in very minute concentration in the atmosphere.
So we can conclude that dust, dirt and gases are the examples of indoor air pollution whereas carbon dioxide, methane and neon are the gases that make up the remaining 0.1 percent.
Learn more about pollution here: https://brainly.com/question/24704410
#SPJ2
CSI Miami: Using DNA to Solve a Robbery
The year is 2023. You are a detective for the Miami Dade Police Department. You’re on the scene of a crime where a man single-handedly just robbed a bank. Luckily, being the ingenious detective that you are, you were able to find a little spot of the man’s blood where he cut his arm as he made his escape through a broken window. You take the blood to the lab so tests can be run.
Unfortunately, no one was able to see the face of the man, so there are no suspects yet. Thanks to a study done in 2022, scientists have now figured which genes in DNA code for which characteristics in a person.
On the next page is a strand of the sample of DNA extracted from the blood at the crime scene. Follow the steps below to help you come up with a sketch of the man who perpetrated this crime.
methionine-leucine-proline = Protein that causes DARK SKIN
methionine-leucine-leucine = Protein that causes LIGHT SKIN
valine-proline-proline-lysine = Protein that causes GREEN EYES
proline-leucine-valine-proline = Protein that causes BLUE EYES
proline-lysine-proline-proline = Protein that causes BROWN EYES
lysine-arginine-threonine-valine-serine-serine = BLOND HAIR
lysine-arginine-threonine-valine-serine-cystine = BLACK HAIR
lysine-arginine-threonine-valine-serine-valine = BROWN HAIR
asparagine-isoleucine-arginine = CURLY HAIR
asparagine-asparagine-isoleucine = STRAIGHT HAIR
leucine-arginine-glutamic acid-arginine = BIG NOSE
leucine-asparagine-arginine-glutamic acid = SMALL NOSE
leucine-asparagine-asparagine-glutamic acid = MEDIUM NOSE
proline-tyrosine-tyrosine-(stop) = SMALL EARS
proline-proline-tyrosine-(stop) = MEDIUM EARS
proline-tyrosine-phenylalanine-(stop) = BIG EARS
Step 1: Decode the DNA into mRNA
Step 2: Decode the mRNA into the corresponding amino acids from pg. 211 of your book. Write the amino acids in the order of the codons from the mRNA.
Step 3: On a separate sheet of paper, draw a sketch of what this person might look like based on the traits you came up with.
DNA: TACGATGAAGGCAATCAAGGGTTCTCCTGTCAAAGTACATTATAGGCAGACTTAGCGGTTGGAATGAAAATC
| | |
AUG
mRNA:
Protein Sequence:
1. Methionine 2. 3.
4. 5. 6.
7. 8. 9.
10. 11. 12.
13. 14. 15.
16. 17. 18.
19. 20. 21.
22. 23. 24.
Step 4: Change the underlined nucleotide to a G. Refigure out your mRNA sequence and resulting amino acids. How would this mutation affect your picture? What kind of mutation did you just create?
Step 5: Answer the following wrap-up questions:
1) When you performed step 1, what enzyme were you imitating?
2) In step 2, what molecule would have brought the amino acids that the codons asked for?
3) In step 2, what molecule would have helped the amino acids line up and attach to one another?
4) In step 2, what connected the amino acids together?
What organisms are not classified into kingdoms of living things?
Select 3 that apply.
A. Prions
B. Photosynthetic organisms
C. Viruses
D. Animals
E. Noncellular organic entities
Growth is the process of change that occurs during an organism’s life to produce a more complex organism.
Please select the best answer from the choices provided
T
F
Answer:
F
Explanation:
Growth refers to the increase in mass and size of a body or organs. It typically occurs through the multiplication of cells and an increase in intracellular substance. Development refers to the physiological and functional maturation of the organism.
How do green plants produce their own food?
Answer:
Photosynthesis
Explanation:
The process by which land plants produce their own food using sunlight and carbon dioxide is known as photosynthesis. The leaves of green plants contain chlorophyll, which absorbs sunlight for producing food. This food is then used by the plant itself as well as other animals, including humans.
Evidence for coordinated stasis is found in _____.
Answer:
Evidence for coordinated stasis is found in the fossil record.
Explanation:
i hope it's help
What happens to the number of chromosomes during meiosis?
A. The number of chromosomes in the daughter cells becomes double that of the parent cell.
B. The number of chromosomes in the daughter cells remains the same as that of the parent cell.
C. The number of chromosomes in the daughter cells becomes one-fourth that of the parent cell.
D. The number of chromosomes in the daughter cells becomes half that of the parent cell.
Answer:
I think it's C sorry if it wrong but I do know that A and B are definitely wrong
Explanation: