Tyler's grandma purchased a savings bond for him when he was born. The bond was bought for $500.00. The value of the savings bond increases by 5% a year. Tyler's grandma wants Tyler to use it for college, so he is not allowed to touch it until he is 18.

How much money will Tyler have when he is 18

Answers

Answer 1

Answer: 950 dollars

Step-by-step explanation:

5% of 500 dollars is 25 dollars, so since 5% is 25 dollars,  multiply that by how many years he can have it (18). So 18 * 25 = 450. 450 added to the starting 500 dollars is 950 dollars. Your welcome, I'm new so glad I could help.


Related Questions

What is the x-intercept of 10x + 4y = -20

Answers

Answer:

(-2,0)

Step-by-step explanation:

When finding the x intercept, substitute 0 for Y. -20/10=-2.

I hope this helps

Answer:

The x-intercepts of that is (-2,0).

x+y=180
x=10y+48
(With Steps Plz)

Answers

Answer:

(168,12)

Step-by-step explanation:

Substitute x = 10y+48 in the first equation.

[tex]10y + 48 + y = 180 \\ 11y = 180 - 48 \\ 11y = 132 \\ y = \frac{132}{11} \\ y = 12[/tex]

We have got the y-value. Our next goal is to find the x-value by substituting y-value in any given equations.

For me, I will be substituting y = 12 in the first equation.

[tex]x + 12 = 180 \\ x = 180 - 12 \\ x = 168[/tex]

Answer Check

Substitute both x-value and y-value in both equations.

[tex]168 + 12 = 180 \\ 180 = 180[/tex]

Our first equation is true for both values.

[tex]168 = 10(12) + 48 \\ 168 = 120 + 48 \\ 168 = 168[/tex]

Our second equation is true for both values.

Thus, the answer is (168, 12)

Help plss I will mark as brainlest if correct

Answers

Answer:

ok

Step-by-step explanation:

Answer:

if im not mistaken it should be y=0x+-3

Step-by-step explanation:

well i took the points -8.,0 an -3,0 an got the slope of 0 , so i did the formula y=mx+b m is slope wich is 0 so y=0x+? so i looked at where the line passes through the y axis an it went through at -3 therefore your answer is y=0x+-3

ANSWER QUICK

Amelia's Reliable Fencing Co. prices fences based on the amount of fencing installed plus a fixed amount of $200. The
company charges S4 per foot of standard fencing. Which of the following scenarios is correct?
It costs $1040 to enclose a 90' by 40' rectangular area.
It costs $560 to enclose a 50' by 40' rectangular area.
ОООО
It costs $2600 to enclose a 10' by 60' rectangular area.
It costs $1480 to enclose an 80' by 80' rectangular area.

Answers

Answer:

It costs $560 to enclose a 50' by 40' rectangular area.

Step-by-step explanation:

50 + 40 = 90

90 x 4 = 360 because of the $4 per foot

360 + 200 = 560, you add 200 because of the flat rate charge.

Colton gave out a survey to some students in his school about their favorite color. 470 of those surveyed said their favorite color was blue. If 94% of the students surveyed said their favorite color was blue, how many students were surveyed in total?

Answers

Answer:

500

Step-by-step explanation:

Convert percent to decimal:

94%=

100

94

=0.94

Move decimal 2 places to the left

Multiplying the decimal by the whole gives us the part:

0.94x=

0.94x=

470

0.94

0.94x = 0.94

470

Divide both sides by 0.94x=

500

I will mark brainlist for this.

Answers

Answer:

Student B

Step-by-step explanation:

Proportional relationship means that it follows a certain pattern or is constant.

Student B was the only relationship to be constant as it goes by multiples of 6.

Ex. 6, 12, 18, 24, 30.

Answer:

Student B

Step-by-step explanation:

Student B's wages increase by 6 each time, but Students A, C, and D do not steadily increase. The steady increase of 6 for Student B is what makes their wages proportional.

Please help me answer this question thank you.

Answers

Answer:

122°

Step-by-step explanation:

10a + 2° + 5a - 2° = 180° [ being linear pair ]

15a = 180°

a = 180° / 15

a =12°

Now

<XYQ = 10a + 2° = 10 * 12° + 2° = 120° + 2° = 122°

Hope it will help :)

I need help:
Justin has a roll of tape 549 centimeters long. he cuts the tape into pieces that are 9 centimeters long. How many 9 centmeter pieces can Justin cut from his roll of tape?

Answers

Answer: 61

Step-by-step explanation: My Teacher told me is Right

The number of the 9-centimeter long tape will be 61. The correct option is C.

What is division?

Discovering the maximum number of equal pieces that can be made by splitting an integer into equal parts.

One of the four fundamental arithmetic operations, or how numbers are combined to create new numbers, is division. The other operations are multiplication, addition, and subtraction.

Given that Justin has a roll of tape 549 centimeters long. he cuts the tape into pieces that are 9 centimeters long.

The number of 9 centimeters tapes will be calculated as below:-

Number = 549 / 9

Number = 61

Therefore, the number of the 9-centimeter long tape will be 61. The correct option is C.

To know more about division follow

https://brainly.com/question/25289437

#SPJ2

Sinister Stan stole 3 3/4 oz of slime from Messy Molly, but his evil plans require 6 3/8 oz of slime. He stole another 2 3/5 oz of slime from Rude Ralph. How much more slime does Sinister Stan need for his evil plan?

Answers

Answer: 1/40

Step-by-step explanation:

Since we are told that Sinister Stan stole 3 3/4 oz of slime from Messy Molly and stole another 2 3/5 oz of slime from Rude Ralph. The total oz of slime stole would be:

= 3 3/4 + 2 3/5

= 3 15/20 + 2 12/20

= 5 27/20

= 6 7/20

We are told that his evil plans require 6 3/8 oz of slime, the amount needed for Sinister Stan for his evil plan would be:

= 6 3/8 - 6 7/20

= 6 30/80 - 6 28/80

= 2/80

= 1/40

15/9 into simplest form will give brainlest

Answers

15/3. = 5

9/3. = 3

5/3 os the answer

Answer:

1 6/9

Step-by-step explanation:

9 can only go into 15 once. So 15 - 9 = 6. 6 goes on top of the 9 and you get your answer of 1 6/9

The function f(x)f(x) is a quadratic function and the zeros of f(x)f(x) are 11 and 55. The y-intercept of f(x)f(x) is 2020. Write the equation of the quadratic polynomial in standard form.

Answers

Answer: [tex]4x^2 -24x+20[/tex]

Step-by-step explanation:

If p and q are zeroes of f(x), then f(x) = k (x-p)(x-q) , where k is a constant.

Given: The function f(x)f(x) is a quadratic function and the zeros of f(x)f(x) are 1 and 5.

f(x) = k (x-1)(x-5)

y-intercept = Value of function at x=0

So, y-intercept =  k (0-1)(0-5)= 5k

Since,  y-intercept of f(x) = 20

so, 5k = 20

⇒ k= 4

Quadratic polynomial [tex]= 4(x-1)(x-5)[/tex]

[tex]=4(x^2-6x+5)\\\\= 4x^2 -24x+20[/tex]

Hence, the equation of the quadratic polynomial in standard form =[tex]4x^2 -24x+20[/tex]

what is the answer for 2/3 z = -6

Answers

Answer:

z=−9

Step-by-step explanation:

Let's solve your equation step-by-step.

2/3z =−6

Step 1: Multiply both sides by 3/2.

(3/2)*(2/3z)=(3/2)*(−6)

z=−9

plz give brainlyest

Solve the following quadratic equation by factorising first x^2 + 5x - 14 =0

Answers

Answer:

Step-by-step explanation:

Here you go mate

step 1

x^2+5x-14=0  equation/Question

step 2

x^2+5x-14=0  factor by setting them equal to zero

(x-2)(x+7)=0

answer

x=2 or x=-7

3x+18=3(x+6)please help

Answers

The correct answer is 0

Answer: X = 4

Step-by-step explanation: Move all the terms besides X to the right side, from there you will divide each term by 3 then simplify.

Solve for x
-56 =8(x - 8)
x=

Answers

Answer:

-56=8(x-8)

-56=8x-64 +64

8=8x :8

1=x

Step-by-step explanation:

prove me wrong

Answer:

x=1

Step-by-step explanation:

You would do distributive property and multiply 8 by the x and -8

-56=8x-64

The add 64 on both sides

8=8x

divide 8

x=1

Use the figure to solve for the missing angles

Answers

m<1:51, m<2:39, m<3:90

A regular octagonal pyramid. Each side of the base is 6 cm long. it has a height of 10cm. Find the surface area of the pyramid​

Answers

9514 1404 393

Answer:

  470.16 cm²

Step-by-step explanation:

The apothem of the base is used for two purposes: to find the area of the base, and to find the slant height of each face.

The apothem of the base for side length s is ...

  s/2 = a·tan(π/8)

  a = s/(2·tan(π/8)) ≈ 7.24 cm

The slant height of a triangular face is found using the Pythagorean theorem. The apothem of the base and the height are legs of the right triangle whose hypotenuse is the slant height. For slant height x, we have ...

  x² = 10² + a² = 100 +52.46

  x ≈ √152.46 ≈ 12.35

__

The area of the 8 triangular faces will be ...

  A = 1/2Px . . . . where P is the perimeter of the pyramid

The area of the base will be ...

  A = 1/2Pa

So, the total surface area is ...

  A = 1/2P(a + x) = (1/2)(8)(6 cm)(7.24 +12.35 cm) ≈ 470.16 cm²

The answer is 470.16 cm²

How would you use distrubutive property for the eqaution 3(x+y)
ANSWER FAST PLSSSSS WORTH 50 BRAINLY POINTS

Answers

Answer:

3(x+y)

=3x+3y

Here he have to multiply 3 with x and y.

Answer:

please mark me brainliest and follow me my friend.

I will give Brainliest Answer !! Please help

Answers

I would help you but i don’t know what the answer is
Answer x = 13 cause math

Phil can run 5½ mph
how far can he run in ⅓ of an hour?​

Answers

Answer:

1 5/6 miles

Step-by-step explanation:

5 1/2 divided by 3

Turn 5 1/2 into improper fraction

Keep, change, flip

(Keep the first fraction as is, change the multiplication sign to division sign, flip the last fraction)

New problem

11/2*1/3=11/6=1 5/6

1 5/6

Hope this helped!!! :)

Stay safe a have a wonderful day/night/afternoon!!!

Brainliest?!?!

please help! its urgent :(

Answers

Instructions is that you should choose C girl! I’m not accurate but that looks right

3Y - 15 LESS THAN 7Y+ 6

Answers

Answer:

y>-9/4

use this site too, put in an any equation itll solve it in a second and give you a step by step thing to show you how to do it.

A chemist is using 348 milliliters of a solution of acid and water. If 14.4% of the solution is acid, how many milliliters of acid are there? Round your answer to
the nearest tenth.
milliliters
Х
5
?

Answers

Answer:

50.1 milliliters

Step-by-step explanation:

hope this helps!

Estimate the unit rate to the nearest hundredth $2.35 12 Grade AA eggs.

Answers

Answer:

2.4

Step-by-step explanation:

PLS I REALLY NEED HELP HEL HELP HELP HELP HELP

Answers

Answer:

Part 1: s+32=187

Part 2: 187-32=s

s=155

Step-by-step explanation:

Answer:

s+32=187 for the first response box. the second is - s=155

Step-by-step explanation:

Sara says, "If you subtract 15 from my number and multiply the difference by -7, the result is -133. What is sara's number

Answers

Answer:

39

Step-by-step explanation:

-133/-7=19+15=39

check:39-15=19

19x(-7)=-133

four less that the quotient of six and two

Answers

(6/2) - 4 would be your answer
6/2 - 4

That should be your answer

The data for three different relay race runners is represented below. Use the representations of each runner to determine which runner starts running closest to the starting line.

Answers

Answer:

It's C or the third option.

Step-by-step explanation: Edge 2021

Answer:

C.

Explaination:

just did on edge 2021

Brainly annie has 2 bags of apples and 5 single apples eva has 1 bag of apples and 11 single apples they have the same amount of apples how many apples so they have in total

Answers

Answer:

34 apples

Step-by-step explanation:

To answer: try setting up each of the equations for Annie and Eva.

Annie: 2(bag) + 5

Eva: 1(bag) + 11

Those two equations equal each other. So set that up:

2(bag) + 5 = 1(bag) + 11

Now solve for the size of the bag.

2(bag) - 1(bag) = 11 - 5

1(bag) = 6 apples

Now substitute 6 back into either equation to determine number of apples.

Annie: 2(6) + 5 = 12+5=17

They each have 17, so there are 34 apples in total.

Answer Choices
A) 1 chance out of 3
B) 3 chances out of 9
C) 3 chances out of 12
D)9 chances out of 12

Answers

Answer:

C) 3 chances out of 12

Step-by-step explanation:

Total balls: 5 + 3 + 4 = 12

Number of white balls: 3

Answer is 3/12.

Other Questions
The function of a retail of purchasing cooperative or "co-op" is toCorrect answer A. obtain lower prices for members.Incorrect answer B. work to improve the image and working conditions of members.Incorrect answer C. save income taxes for members.Incorrect answer D. sell the goods or services produced by members. What does it mean to "Psych yourself up?" How does this term affect the meaning of the text Find three ratlos equivalent to the ratio described in the situationThe ratio of cups of water to cups of milk in a recipe is 1 to 4Three equivalent ratlos are 2 to3 to4 to When a cricket ball is thrown vertically upwards, it reaches a maximum height of 15 metres. (a) What was the initial speed of the ball ? (b) How much time is taken by the ball to reach the highest point ? (g=10 ms -2 What caused president roosevelt to sign into law meat Inspection act? who is a better band1:One direction2: 5 seconds of summer 3: BTS4:Little mix5: other Which of the following describes hetereogeneous mixture... 1)A mixture that is easily separated, the components are different sixes and unevenly mixed. 2) A mixture that is very difficult to separate, the contents are evenly mixed and the mixture looks like a substance Light rays from the sun are called: solar energy heat energy chemical energy a circle has a center at (-2,7). if a point on the circle has coordinates (3,-1) then which of the following would be the length of the radius of the circle write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC if you answer some of them ill appreciate it ( you don't have to answer all of them ) What can cause a significant change in someones life Which value is in the domain of f(x)?f(x) = StartLayout Enlarged left-brace 1st row 1st column 2 x + 5, 2nd column negative 6 less-than x less-than-or-equal-to 0 2nd row 1st column negative 2 x + 3, 2nd column 0 less-than x less-than-or-equal to 47645 How is the idea of freedom presented in Martin luther kings speech? Explain what is meant by "majority opinion".Your answers Lieutenant Patrick O'Bannon defeated the Pasha of Tripoli at ___.ItalyWeehawkenEgyptNew OrleansDerna Explain the role that King George III played during the American Revolution. WILL MARK BRAINLIEST:> IF YOU ARE LUCKY pick a number from 1 to 20 CLOSEEST NUMBER TO THE NUMBER I PICK WILL BE THE BRAINLIEST GOOD LUCK How do you make someone brainliest In the 1800s, unmarried women hadmore rights than married women.the same rights as married women.fewer rights than married women.no rights, just like married women.