Use “rucksack” in a sentence.

Answers

Answer 1

Answer:

Lana approached the couch, where the large rucksack sat. When Mrs. Watson released the rucksack, it felt better balanced, though no lighter.

Answer 2

Answer:

I was glad I had bought a good rucksack

Explanation:


Related Questions

what does this quote mean to you "Sometimes in the most repressive times, we create the most extraordinary things."​

Answers

It means that we can create amazing things when we are in tough situations.

What social commentary about communist Russia does Orwell make with this excerpt?
Russians faced many challenges and struggles working on collective farms.
Russians lacked the creative abilities to innovate solutions to problems. Russians were able to predict and avoid potential struggles.
Russians lacked knowledge of basic modern agricultural practices.

Answers

Answer:

A

Explanation:

Answer:

A. Russians faced many challenges and struggles working on collective farms.

Explanation:

edge2021

please urgent please beg

Answers

Answer:

2. maggie is sleeping

3. we are having breakfast

4. the kids are tiding

5. joshua is writing

second question

2. melissa is listening to music.

3. ryan and eric are playing basketball

4. bob and lisa are watching a movie

5. heather is making breakfast

6. victor is jogging

Explanation:

Answer:

is sleeping are having are tidingam shoppingis writingis listening to a songare playing basketballare watching a movieis beating an eggis jogging

pls help ill mark brainliest and 25 points

Answers

Answer:

i think it is simile

Explanation:

undertale chara toriel undyne papyrus frisk mettaton alphys/////////////////////////////

Answers

Answer:undertale chara toriel undyne papyrus frisk mettaton alphys /////?? Am confused

Explanation:

Answer:

ok imma order them into ships

Explanation:

chara and frisk

papyrus and mettaton

alphys and undyne

toriel is single TmT

What is happening to Cathrines health?

Answers

i have no clue , what’s the question

Answer: her body is dieing on her

Explanation:

Give me a school appropriate word and I'm pretty sure I can rap to it (no religion tho )

Answers

Answer:

pencel try itttttt ...

By the end of the story, what does ponyboy realize about the socs?​

Answers

Ponyboy begins to realize that Socs are human just like greasers.

There is tears for his love, joy for his fortune, honor for his valor, and death for his ambition. Who is here so base that would be a bondman? If any, speak, for him have I offended. Who is here so rude that would not be a Roman? If any, speak, for him I have offended! What describes the structure of the excerpt above best?

Answers

Answer:

Problem-Solution best describes the textual structure applied in the above excerpt.

Explanation:

Problem-Solution is the textual structure responsible for defining a question and then pointing out the answer to that question, or pointing out a problem and pointing out its solution afterwards.

In the excerpt shown in the question above, we can see a series of questions asked by the narrator, which, himself, presents a solution or supposed answer to them.

words to describe simon in lord of the flies chapter 9

Answers

Answer:

Scared, disgusted, distressed, worried, wounded, killed, dead

Explanation:

What is the theme of the short-story Hair Love.

Answers

Answer:

Hair Love is a beautiful and refreshing story that touches on topics around family, self esteem, pride, style, identity and culture.

What could be a good conclusion sentences about video games??
PLEASE HELP!!!!​

Answers

Answer:

here ya go lad

Explanation:

   Like many popular, entertaining, and addicting kid activities, video and computer games are looked down upon by many parents as time-wasters, and worse, and parents think that these games rot the brain. Also, the media and some experts are readily blamed for violent video games as the reason why some youth become violent or commit extreme anti-social behaviour. But many scientists and psychologists find that video games have many benefits – the main one being making kids smart. Video games may teach kids high-level thinking skills that they will need in the future.

   A new study compiled by scientists at Yale University has found that video games are not harmful as long as those who play do not spend most of their time engaged in them. The Yale study says that the boys who played video games had better grades than those who did not, on average, and were less like to smoke cigarettes and engage in the consumption of banned substances like marijuana. Only 5 per cent of them had behaviour patterns like relieving tension only through gaming, having powerful urges to game that they cannot control, trying to limit time spent on video games, and failing. (Peart)

   From the study, we can see that video games teach many skills to the developing child. Examples of these skills include problem-solving abilities, perseverance, pattern recognition, hypothesis testing, estimating skills, inductive reasoning, resource management, logistics, mapping, memory, quick thinking, and reasoned judgments (Sheff, 1994). Many of these skills are abstract and require higher-level thinking, which schools do not often teach children. By including a way to choose one's level of difficulty in most, if not all, video games, one can tailor the degree of intricacy of the game's tasks to meet one's skills. After the tasks are completed at a comfortable level, a child will feel motivated to attempt a higher degree of difficulty. By slowly ramping up the problem, the child can accomplish goals and learn while increasing their self-efficacy.

   Sometimes the player does this almost every second of the game, giving the brain a real workout. According to researchers at the University of Rochester, Daphne Bavelier, a cognitive scientist, games simulating stressful events such as those found in battle or action games could be a training tool for real-world situations. The study suggests that playing action video games primes the brain to make quick decisions. Video games can be used to train soldiers and surgeons, according to the survey. (Benson)

Important note: You will submit your introduction and body in this assignment.

View the grading rubric as you complete your assignment. This is your guide to a super submission.

Using the ideas from your Narrative Organization Chart, write the body of your narrative.
Review the writing prompt on which your chart was based.
Review the ideas you created in your Narrative Organization Chart and the exposition of your story.
In your body, be sure to include:
rising action (two events) and climax
sensory language to make your story vivid
dialogue to make your characters more realistic and advance the story
300 words or more
Save your work to your computer or drive.
Submit your work (including both your introduction and body) in 03.06 Your Narrative Voice.

Answers

Answer:

a narrative piece of writing tells a story. Narratives can be essays, fairy tales, movies and jokes. A narrative should have 5 key elements: a plot, setting, character, conflict, and theme. Make sure you use chronological order to tell your story.

Explanation:

A celebrity’s image is not real. It is an illusion created by makeup, publicists, professional photographers, and the media. The number of young people who look up to celebrities as role models shows how ignorant they are.

Which word in the excerpt creates a tone that is not respectful?

illusion
media
young
ignorant

Answers

Answer:

Illusion and Ignorant would fit

Explanation:

media is the answer mark brainliest plzz

Based on the foreshadowing of Algernon's life, the reader can infer that the story stops because...

A. Charlie's intelligence is so low that he can't write anymore.
B. They stop the experiment.
C. Charlie dies.
D. Charlie is angry about the experiment and doesn't want to write about it anymore.

Answers

Answer:

C: charlie dies

Explanation:

algernon died from effects of the surgery so will charlie

According to the speaker, what is mainly the thing that love cannot do?
U A. Change the course of events
B. Bring the dead back to life
O C. Cure or aid physical ailments
D. Make people annoyed

Answers

B. Bring the dead back in life, no matter how much you can love a person it doesn’t matter because their fate doesn’t lay in your love

Bring the dead back to life is mainly the thing that love cannot do, According to the speaker. Hence, option B is correct.

What is speaker opinion?

A speaker who addresses a multitude in a formal manner; an orator. Any other comparable legislative body, such as the U.S. president, House of Commons in Britain or the US House of Representatives also referred to as a speaker.

We queried them on their opinions on the brand-new stadium. A viewpoint, conclusion, or assessment made with reference to a particular problem. Esteem, approval His work doesn't really impress me. A person with tight opinions has beliefs that are stronger than impressions but weaker than knowledge that is favourable.

Speakers include both spokespersons and those who give speeches. The person who is being listened to by everyone.

Thus, option B is correct.

For more information about speaker opinion, click here:

https://brainly.com/question/5870032

#SPJ5

PLEASE SOMEONE HELP IN THIS, 30 POINTS


WRITE AN ESSAY less than 150 WORDS, why is a hero a courageous person. What does he do that makes him/her courageous and why should a hero be a courageous person...

Answers

Answer:

“A hero is someone who has given his or her life to something bigger than oneself” (Campbell 1). When we think of heroes most of us think of movie stars or professional athletes, but it’s not always about your popularity or talent it can also be about how you help society. What I think make a great hero is someone who is able to overcome his or her obstacles in life, is highly motivated, and has plenty of bravery.

    Overcoming obstacles may be one of the hardest parts of being a hero. I think it’s the hardest because a lot of people are blocked from doing something and just quit. A great example of this trait is Jackie Robinson. He was discriminated against because he was African-American. Even though…show more content…

In order to be a successful hero you must be a highly motivated person. Without motivation you would not be very successful because you would have no ambition to try and make a difference in the world. I think Rodney Dangerfield is a great example of this because he started he career at just 15 and he died while he was in the middle of a movie. Also when his wife tried to make him quit he just blew their many years of happiness and divorced her. In one of his quotes he stated, “At twenty a man is full of fight and hope. He wants to reform the world. When he’s seventy he still wants to reform the world” (Dangerfield 3).

    Bravery is a great trait for a hero to posses. I think bravery is a key quality because you don’t always know what lies ahead of you and you have to be brave to continue. A good example of this is Charles Lindburgh. He was the first person to fly across the Atlantic Ocean. I believe that took a great amount of bravery because no one had ever made it across, so he didn’t know what lie ahead of him. One of his many good quotes he said, “The most effective way to do it, is to just do it”,

Explanation: i don't if this is less than 150 words

A strong claim needs to , need it NOW

Answers

Answer:

Have something supporting it why you claim it

Explanation:

Kind of like Main Idea

A strong claim needs supportive evidence that can justify and/or promote the discussion, it has to be able to express an idea with given fact

Which TWO statements accurately describe the culture of
Okonkwo's compound?
A. People are tolerant of their neighbors.
B. Possessions are shared freely.
2
7.
C. Routines are subject to frequent change.
D. Children have important duties.
mp
o
E. Stories and songs provide entertainment.
mt

Answers

Answer: a I think

Explanation:

hey there!
Write a paragraph on Henry Cuyler Bunner. Also mention any two of his famous poems.
help please:)​

Answers

Answer:

his famous poem is:

A Pitcher of Mignonette.Behold the Deeds!Feminine.

Explanation:

Henry Cuyler Bunner was born in Oswego, New York to Rudolph Bunner, Jr. (1813–1875) and Ruth Keating Tuckerman (1821–1896) and was educated in New York City. His paternal grandparents were Rudolph Bunner (1779–1837) and Elizabeth Church (1783–1867), the daughter of John Barker Church (1748–1818) and Angelica Schuyler (1756–1814).

i hope this is helpful!

Read this excerpt from Rupert Brooke’s "The Soldier." What does the word dust refer to?
If I should die, think only this of me:
That there's some corner of a foreign field
That is for ever England. There shall be
In that rich earth a richer DUST concealed;A dust whom England bore, shaped, made aware,
Gave, once, her flowers to love, her ways to roam,
A body of England's, breathing English air,
Washed by the rivers, blest by suns of home.

A dust whom England bore, shaped, made aware,
buried treasure
B.
the speaker's body
C.
fertile soil
D.
deceased foreigners
E.
dreams and wishes


ILL GIVE BRAINLLEST

Answers

Answer:

the speakers body

Explanation:

Answer:

The speakers body

I hope this helps

please help i’ll give brainliest if you give a correct answer tysm

Answers

It’s the 3rd one
Hope this helped:)

We often (spend)_______our summer holiday abroad.Last yeat we (go)_______to Spain but this year we (go)_______ to Greece.My mother (book)______a hotel on Crete last week.​

Answers

Answer:

we often *spend* our summer holiday abroad. last year we *went* to spain but this we *went* to Greece. my mother *booked* a hotel on Crete last week?? i hope that helped a little??

Explanation:

We often spent our summer holiday abroad. Last we we got to go to Spain but this year we went to Greece. My Mother booked a hotel on Crete last week.

What important information is omitted from this ad?
"Flippo soap is 99.44 percent pure."


how much the soap suds lather

how many cases of Flippo soap sell yearly

what ingredients are contained in 0.56 percent that are impure

ill give you brainlest

Answers

What ingredients are contained in 0.56 percent that are impure

How does Ponyboy’s perspective on Dally differ from Johnny’s perspective?

Answers

Answer:

I don't remember I haven't read the book in so long. Also thats a question u have to solve cuz u read the book also you didn't put the whole question.

Explanation:

I really need help. Please rewrite the last sentence with consistent tenses please.

Answers

Answer:

the sun will be hot tomorrow, so I'll take extra sunscreen and water

what does amiable mean

Answers

Answer:

Having or displaying a friendly and pleasant manner.

Explanation:

Synonyms: friendly, affable, cordial, nice, warm.

My sisters screaming woke up the whole neighborhood is a example of

Answers

Answer:

someone screaming loud as a bi..t.ch

Hyperbole about lockdown:

Answers

Answer:

This lockdown feels like its been going on for years!

Explanation:

PLEASE ANSWER ASAP


Read the sentence below.
The success of the meeting will depend on whether Timothy has
decided to be Dr. Jekyll or Mr. Hyde today.
The allusion in this sentence connects two ideas in order to make the point
that Timothy is:
A. a person who is tough but fair.
B. a person who behaves inconsistently.
C. a person who always acts inappropriately.
D. a person who stands up to authority,

Answers

Answer:

The allusion in this sentence connects two ideas in order to make the point that Timothy is:

B. a person who behaves inconsistently.

Explanation:

The sentence we are analyzing here alludes to the book Strange Case of Dr Jekyll and Mr Hyde. The character in the story, Dr. Jekyll, is in a way haunted by the evil inside him. He is, in general, a nice, amiable person. But, after creating a serum that enhances his evil personality, he becomes Mr. Hyde, a cruel and violent man.

Saying someone will choose between being Jekyll or Hyde means this person behaves inconsistently, sometimes being good, sometimes evil. It refers to someone who has a dual personality. Having that in mind, the best option is letter B. a person who behaves inconsistently.

Answer:

B

Explanation:

Ap3x

Other Questions
Let f(x) = 9x and g(x) = x + 7. What'sthe smallest number that is in the domain offg?Enter the correct answer.OOOODONEClear all what was the strength and weakness of Adam Smith and David recardo A man travels 320 miles in 8 hours. If he continues at the same rate, how many miles will hetravel in the next 2 hours? what is the largest prime number? what should be added2x ^3+ 3x^2+8x-4to get 0 ? pls help asap! This homework is really hard what is the meaning of zest Which outcome was a benefit of the Pax Romana?The citizens of Rome were allowed to participate in government.AThe Roman Empire entered a period of economic prosperity.BThe citizens of Rome were encouraged to move up in classThe Roman Empire encouraged religious freedom.D Newspaper Article #3 Planning and Rough Draft:Directions: Using the prompt below, you will brainstorm and draft your second article for your magazine. Make sure to complete each days tasks on time, so that you dont fall behind. On Friday, you will be creating your final draft of this article and putting it in your newspaper. ________________________________________Monday: Read the prompt below and write a hook, transition sentence, and thesis. brainstorm one example per HELPS for each of your reasons that you could use to support your stance.Informational Essay Prompt = Cause and EffectThe medical advances of the Twentieth Century have many beneficial effects for humanity.Prompt: Think about an important medical breakthrough. How has the discovery/invention of __________________ affected society?Paragraph 1Hook:Transition sentence:Write thesis (restate prompt + 2 reasons): DIRECTIONS: use a computer to find examples with LOTS of details for the HELPS chart to support the above prompt. You must have AT LEAST 3 examples for each reason in your thesis (total of 6).HHistorical Examples**EEveryday News -Current Events**LLiterature/ Magazines/ Movies/ TV Shows**PPerson you know / Personal Experience**SSports / Science**________________________________________Tuesday: Use the Description text structure to write your essay. Plan which HELPS best support your thesis and where they will be in your essay. Use an outline or the shapes tool to create the graphic organizer here.Example: Outline TemplateI. CauseA. Effect (reason 1)i. Support (HELPS)ii. Support (HELPS)II. CauseA. Effect (reason 2)i. Support (HELPS)ii. Support (HELPS)_______________________________________________________________________CREATE IT HEREUsing your organizer above, draft your 1st body paragraph (paragraph 2). Remember, in your 1st body paragraph, focus on the 1st of your two reasons from your thesis statement and use HELPS to support it. Your conclusion should remind your reader of your points without repeating and include a reworded thesis statement. Draft your first body paragraph here: ________________________________________Wednesday:Continuing to use your organizer above, draft your 2st body paragraph (paragraph 3). Remember, in your 2nd body paragraph, focus on the 2nd of your two reasons from your thesis statement and use HELPS to support it. You will also write your conclusion (paragraph 4). Your conclusion should remind your reader of your points without repeating the information and should include a reworded thesis statement. Draft your second body paragraph here:Draft your concluding paragraph here:Thursday: Today you will put together all of your four drafted paragraphs into one solid article below. You will then use your ARMS and CUPS checklist and tasks below to revise and edit your article. Copy and paste your full article here:ARMS and CUPS:1. Highlight in yellow a sentence/word you added. 2. Highlight in blue a sentence/word you need to remove. 3. Highlight in green a sentence/word you need to move.4. Highlight in pink a sentence/word that you need to substitute.5. Highlight in purple word(s) that you need to add capital letters to.6. Highlight in dark blue words that are used too much and need to be replaced.7. Highlight in grey where punctuation marks need to be added. 8. Highlight in teal words that need to be spelled correctly.________________________________________Friday: You will follow the directions in your newspaper template PowerPoint to add your second article to your newspaper. Please give me the correct answer *20 POINTS*What took place off the coast of Brazil that would lead to Ferdinand Magellans fleet of five ships being reduced to four ships? Why do you think this happened? Sale! 25% OFF of the original price! Laura wants to buy a sleeping bag. The original price is $56. How much will Laura pay if she buys it during the sale. A certain first-row transition metal ion forms many different colored solutions. When four coordination compounds of this metal, each having the same coordination number, are dissolved in water, the colors of the solutions are red, yellow, green, and blue. Further experiments reveal that two of the complex ions are paramagnetic with four unpaired electrons and the other two are diamagnetic. What can be deduced from this information about the four coordination compounds Describe how chimpanzees use touch to communicate.No searching please. I already tried that and it wasnt the answer you need for the question. Give brainliest! 25 points! pls show work if can!!!!!!!! Why would more food lead to more jobs? Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo should the fact that a person has children in the UK over-rule their deportation after the have served a prison sentence ? What Solutions to population growthmight a penson from Europe suggest? What is 12x 9x 4x + 3 in factored form? hurry...