what african city has been a major trans-saharan trade center for over a millennium?

Answers

Answer 1

Answer:

Timbuktu. Located on the southern edge of the Sahara in what is now Mali, the city of Timbuktu has historical significance for being a trading post on the trans-Saharan caravan route and as a center of Islamic culture in the 15th through the 17th century.

Answer 2

The African city you're looking for is Timbuktu. Located in present-day Mali, Timbuktu has been a significant trans-Saharan trade center for over a millennium. This historic city played a crucial role in the exchange of goods, knowledge, and culture between North Africa and West Africa, and it remains an important symbol of African history.

The answer to your question is Timbuktu. This African city has been a major trans-Saharan trade center for over a millennium, serving as a hub for the exchange of goods between North and West Africa. Traders from across the Sahara would bring goods such as gold, salt, and ivory to Timbuktu, which would then be traded for textiles, books, and other commodities. The city's strategic location on the Niger River made it an important stop for traders, and its universities and libraries made it a center of scholarship and learning in the region. Timbuktu's role in trans-Saharan trade cannot be overstated, as it helped to connect Africa with the wider world.

To know more about Timbuktu visit:

https://brainly.com/question/26787757

#SPJ11


Related Questions

The story of Jacob's ladder in Genesis 25 (also called "the stairway to heaven") has inspired works of art, music, movies, toys, the titles of many TV episodes, and even several location names. Explore the internet to find at least two of these allusions. Why do you think the world is so fascinated by this story?

Answers

Two allusions in art, music, movies, toys that have related to the story of Jacob's ladder include:

The painting "Jacob's Ladder" by William BlakeThe song "Jacob's Ladder" by Bruce Springsteen

How has Jacob's ladder been inspirational?

The story of Jacob's Ladder has been interpreted in many different ways over the centuries. Some people see it as a literal story about a ladder that reaches up to heaven. Others see it as a more symbolic story about the journey of faith. Still others see it as a combination of both literal and symbolic elements.

William Blake's artwork "Jacob's Ladder" is a captivating and striking portrayal of the narrative. The artwork portrays Jacob in a state of slumber underneath a tree, with a ladder extending to the heavens. Bruce Springsteen's "Jacob's Ladder" is a captivating and poignant melody that eloquently portrays the exploration of one's spiritual path.

Find out more on Jacob's ladder at https://brainly.com/question/29616009

#SPJ1

the protest tactic initiated by black students in greensboro, north carolina, was

Answers

Answer:

The Greensboro sit-in was a civil rights protest that started in 1960, when young African American students staged a sit-in at a segregated Woolworth's lunch counter in Greensboro, North Carolina, and refused to leave after being denied service. The sit-in movement soon spread to college towns throughout the South.

Explanation:

The protest tactic initiated by black students in Greensboro, North Carolina, was the sit-in.

On February 1, 1960, four African American college students from North Carolina A&T State University staged a sit-in at a racially segregated Woolworth's lunch counter. They refused to leave the premises until they were served, sparking a wave of similar protests across the South. The sit-ins were a nonviolent form of direct action aimed at challenging racial segregation and demanding equal rights.

The participants faced verbal and physical abuse, but their peaceful persistence and the attention generated by media coverage helped galvanize the Civil Rights Movement and eventually led to the desegregation of public facilities. The Greensboro sit-ins are considered a pivotal moment in the struggle for racial equality in the United States.

Learn more about protest

https://brainly.com/question/19244187

#SPJ4


Complete Question:

the protest tactic initiated by black students in greensboro, north carolina, was ___.

How did President George W. Bush respond to questions about how the September 11 plot could have gone undetected?

A.
He fired the chiefs of staff.

B.
He fired the directors of the CIA and the FBI.

C.
He introduced domestic telephone surveillance programs.

D.
He established a special commission to determine how national security had failed.

Answers

He established a special commission to determine how national security had failed. So, option D is the right choice.

In response to questions about how the September 11 plot could have gone undetected, President George W. Bush took the step of establishing a special commission. This commission, known as the 9/11 Commission or the National Commission on Terrorist Attacks Upon the United States, was formed in 2002 and had a mandate to investigate the intelligence failures and vulnerabilities that allowed the terrorist attacks to occur.

The 9/11 Commission consisted of a bipartisan group of experts and leaders, and it was tasked with conducting a thorough examination of the events leading up to the attacks, including intelligence gathering, law enforcement, immigration policies, and more. The commission held public hearings, interviewed witnesses, and analyzed extensive amounts of information to identify the shortcomings in the national security apparatus.

The commission's final report, published in 2004, provided a detailed account of the events surrounding the attacks and made recommendations for improving national security and preventing similar incidents in the future. President Bush acknowledged the findings of the commission and pledged to implement its recommendations to strengthen the country's counterterrorism efforts.

Establishing the special commission demonstrated President Bush's commitment to understanding the failures in the intelligence and security systems and taking appropriate actions to address them. It was a significant step in promoting transparency, accountability, and learning from the tragic events of September 11, 2001.

The right answer is D. He established a special commission to determine how national security had failed.

For more such question on  national security

https://brainly.com/question/29553303

#SPJ11

in hinduism, what is the name of the god of fire and acceptor of sacrifices?

Answers

Answer:

Agni, (Sanskrit: “Fire”) fire-god of Hinduism, second only to Indra in the Vedic mythology of ancient India. He is equally the fire of the sun, of lightning, and of both the domestic and the sacrificial hearth.

Explanation:

In Hinduism, the god of fire and acceptor of sacrifices is known as Agni. As a prominent deity, Agni plays a vital role in various religious rituals, where he serves as a messenger between humans and the gods. Through fire sacrifices, devotees seek blessings and communicate their desires to the divine pantheon, with Agni delivering their offerings and prayers.

In Hinduism, the god of fire and acceptor of sacrifices is named Agni. Agni is considered to be one of the most important gods in Hinduism as he is believed to represent both the destructive and regenerative aspects of fire. He is also considered to be the mediator between the gods and humans, as he is responsible for carrying the offerings and sacrifices of humans to the gods. Agni is often depicted as having red skin, two heads, and three legs, and is worshipped in many Hindu households through the use of a sacred fire pit called a homa or havan.

To know more about pantheon visit:

https://brainly.com/question/10598258

#SPJ11

how much did a burger king whopper cost when first introduced in 1957?

Answers

Answer:

History. The Whopper was created in 1957 by Burger King co-founder James McLamore and originally sold for 37 US cents (equivalent to US$3.57 in 2021).

who were the first europeans to explore the new world we now call the united states

Answers

Answer:

10th Century — The Vikings: The Vikings' early expeditions to North America are well documented and accepted as historical fact by most scholars. Around the year 1000 A.D., the Viking explorer Leif Erikson, son of Erik the Red, sailed to a place he called "Vinland," in what is now the Canadian province of Newfoundland.

The first Europeans to explore the New World, now known as the United States, were the Norse Vikings, led by Leif Erikson, around the year 1000 AD. However, the most notable exploration occurred in the late 15th century when Christopher Columbus, an Italian explorer, initiated the Age of Discovery by reaching the Americas on behalf of Spain.

The first Europeans to explore the New World that is now the United States were the Vikings, around the year 1000 AD. Led by Leif Erikson, they established a settlement called Vinland in present-day Newfoundland, Canada. However, their exploration did not result in any long-term colonization. Subsequently, numerous other European explorers, such as John Cabot and Amerigo Vespucci, contributed to the exploration and understanding of this new land. These early encounters ultimately led to European colonization and the establishment of the United States. Christopher Columbus is often credited as the first European to discover the New World, but he actually landed in the Caribbean, not what is now the United States. It wasn't until 1497 that the Italian explorer Giovanni Caboto (also known as John Cabot) arrived on the shores of North America, specifically Newfoundland, becoming the first European to explore the continent in over 500 years.

To know more about Norse Vikings visit:

https://brainly.com/question/32145896

#SPJ11

which of the following athletes would be most likely to peak the earliest?

Answers

In general, athletes who specialize in explosive, high-intensity events such as sprinting or weightlifting are more likely to peak earlier in their careers.

This is because these events rely heavily on explosive power and speed, which tend to decline with age and years of training. In contrast, athletes who specialize in endurance events such as distance running or cycling may continue to improve well into their thirties and even forties. However, it's important to note that every athlete is unique, and factors such as genetics, training regimen, and injury history can all affect an athlete's peak performance. Among various athletes, gymnasts typically peak the earliest. This is due to the physical demands of the sport, which emphasize flexibility, balance, and strength. As the body matures, maintaining these qualities becomes more challenging, leading to a younger peak age for gymnasts, often occurring in their late teens to early twenties. Other athletes, such as swimmers and runners, may reach their peak performance later in their careers, as their sports focus on different skill sets and physical attributes. In conclusion, gymnasts are the athletes most likely to peak the earliest among different sports disciplines.

To know more about athletes visit:

https://brainly.com/question/17404705

#SPJ11

how was indian slavery in the vedic age similar to slavery in mesopotamia?

Answers

Indian slavery in the Vedic age was similar to slavery in Mesopotamia in several ways.

Both societies had a hierarchical social structure, with slaves occupying the lowest rung of the ladder. In both places, slaves were primarily obtained through war or debt bondage.

They were used for agricultural labor, domestic work, and as soldiers. Both societies had laws governing the treatment of slaves, but these laws did not protect them from cruelty and mistreatment. Additionally, slaves were considered property and could be bought, sold, or traded. Overall, the similarities between Indian slavery in the Vedic age and slavery in Mesopotamia demonstrate the prevalence and universality of slavery throughout history.

For more about Mesopotamia:

https://brainly.com/question/438594

#SPJ11

speaking of davy crockett, what kind of weapon was named after him in the 1950s?

Answers

The Davy Crockett rifle, also known as the "coon skin cap rifle," was a type of rifle that was popular in the United States in the mid-twentieth century.

It was named after the frontiersman and politician Davy Crockett, who was a famous figure in American history and was often associated with the frontier and hunting.

The Davy Crockett rifle was a lever-action rifle that used cartridges with a .45-70 Government caliber. It was first produced in the late nineteenth century and became popular in the early twentieth century, particularly among hunters and outdoorsmen.

In the 1950s, a company called the Winchester Repeating Arms Company began producing a new version of the rifle called the "Davy Crockett Big Bore." This version of the rifle was designed to be more powerful and was marketed as a weapon for hunting large game such as moose and bear.

Learn more about United States

https://brainly.com/question/1527526

#SPJ4

which roman emperor became famous after his death for allegedly making his horse a roman consul?

Answers

The Roman Emperor who became famous for allegedly making his horse a Roman consul is Caligula.

The roman emperor who became famous after his death for allegedly making his horse a roman consul was Caligula. Caligula ruled as emperor from 37-41 CE and was known for his unpredictable behavior and cruelty. The story goes that he was so delusional that he appointed his horse, Incitatus, as a consul, but this claim is widely disputed by historians. It's possible that this was a rumor or exaggeration spread by his enemies after his death. Regardless, Caligula's reign was marked by violence and excess, and his death was brought about by a conspiracy of senators and palace officials. Despite being a controversial ruler, there is no evidence to support the claim that he actually appointed his horse as a consul, and it is likely a myth or a political slander.

To know more about Roman Emperor visit:

https://brainly.com/question/929869

#SPJ11

the approaches of dr. martin luther king, jr. and malcolm x to the civil rights movement differed in that

Answers

Dr. Martin Luther King Jr. and Malcolm X were two influential leaders in the civil rights movement with different approaches to achieving their goals. Their beliefs and philosophies shaped their strategies and had a significant impact on the movement. Option D is the correct answer.

He believed in the power of love and nonviolence to overcome hate and injustice. On the other hand, Malcolm X believed in self-defense and the use of any means necessary to protect oneself and one’s community. He argued that Black people had the right to defend themselves against violence and oppression.

In terms of their religious beliefs, Dr. King was a Baptist minister while Malcolm X was a Muslim minister. Their religious beliefs influenced their approaches to the civil rights movement and their views on how to achieve equality and justice.

Dr. King focused on integration and believed that Black and white people could live together in harmony. He worked towards desegregation and equal rights for all. Malcolm X, on the other hand, focused on separation and Black nationalism. He believed that Black people should have control over their own communities and institutions.

To learn more about Martin Luther King

https://brainly.com/question/10821145

#SPJ4

Complete question:

The approaches of Dr. Martin Luther King Jr. and Malcolm X to the civil rights movement differed in that:

a) Dr. King advocated for nonviolent resistance while Malcolm X believed in self-defense and the use of any means necessary

b) Dr. King was a Baptist minister while Malcolm X was a Muslim minister

c) Dr. King focused on integration while Malcolm X focused on separation

d) All of the above

what was the population of the settlement in 1924 when it surrendered its charter to the english crown

Answers

The population of the settlement that surrendered its charter to the English crown in 1924 is not specified or known.

Without specific information about the settlement in question, it is not possible to determine its population in 1924 when it surrendered its charter to the English crown. The question does not provide any details about the location or name of the settlement, making it difficult to ascertain its population at that specific time.

To provide a more accurate answer, it would be necessary to have additional information regarding the settlement in question. This could include the name of the settlement, its geographical location, or any historical context that could help identify the population at the time of surrendering the charter. Without such details, it is not possible to provide an accurate population figure for the specified settlement in 1924.

Learn more about English crown here:

https://brainly.com/question/717389

#SPJ11

According to Ali how was americas fight against totalitarian rule Vietnam hypocritical?

Answers

According to the  Ali, America's fight against totalitarian rule in Vietnam was hypocritical because the America claimed to be fighting for freedom and the democracy, yet it was supporting a corrupt and oppressive government in South Vietnam.

The US government also used the  tactics such as carpet bombing and napalm, which caused the massive civilian casualties and destruction, contradicting their supposed commitment to the  human rights.

Furthermore, Ali argued that the US government's actions in Vietnam were driven by their own interests and not the interests of the Vietnamese people, which undermined their claim of fighting for democracy and freedom.

For more questions on: totalitarian rule

https://brainly.com/question/26370371

#SPJ11

the territorial ambitions of the nazi party in the 1930s exemplified the idea of

Answers



The territorial ambitions of the Nazi Party in the 1930s exemplified the idea of expansionism, imperialism, and aggressive militarism.

Adolf Hitler's vision for Germany was to create a powerful and dominant nation that could rival the other European powers. This vision was based on the concept of Lebensraum, or living space, which called for the expansion of German territory and the acquisition of new lands for settlement and resources. Hitler believed that Germany needed more land to feed its growing population and to provide room for its people to live and prosper.
The Nazi Party's territorial ambitions led to the invasion and occupation of Austria, Czechoslovakia, and Poland, which ultimately sparked World War II. The Nazi regime sought to expand its influence and power in Europe by conquering other nations and incorporating them into the German empire. This expansionist policy was driven by the belief in the superiority of the Aryan race and the desire to create a new order in Europe under German leadership.

The Nazi Party's territorial ambitions were not only aggressive and imperialistic but also fundamentally racist and genocidal. Hitler and his followers believed in the elimination of all groups deemed inferior, including Jews, Romani people, homosexuals, and disabled individuals. This led to the Holocaust, one of the worst atrocities in human history, in which millions of innocent people were systematically murdered by the Nazi regime.

In conclusion, the Nazi Party's territorial ambitions represented a dangerous and destructive ideology that caused immense suffering and devastation across the world.

To know more about Nazi Party visit:

https://brainly.com/question/1167256

#SPJ11

in the late nineteenth century there were gender tensions in many black churches.a. trueb. false

Answers

The given statement "In the late nineteenth century, there were gender tensions in many black churches" is true because These tensions arose from the social and cultural norms of the time that placed men in positions of power and authority. Option A .

Black women in the church were often subjected to discrimination and marginalization. They were expected to serve in subordinate roles and were not allowed to hold positions of leadership or authority.

This led to a growing sense of frustration and disillusionment among black women who felt that their contributions and talents were being overlooked and undervalued.

One of the most significant examples of gender tensions in black churches was the Women's Convention of the National Baptist Convention.

The convention was formed in 1895 as a way for black women to come together and address the issues they were facing within the church. However, they faced significant opposition from male leaders who believed that women should not have a voice in matters of church governance.

Despite these challenges, black women continued to fight for their rights and played a critical role in shaping the black church as we know it today. They established their own churches, founded women's organizations, and worked tirelessly to break down gender barriers and promote equality.

In conclusion, gender tensions in black churches were a significant issue in the late nineteenth century. However, black women's determination and perseverance paved the way for greater inclusion and equality within the church and beyond. So Option A is correct.

For more question on gender visit:

https://brainly.com/question/9873909

#SPJ11

During American Imperialism
What were the major arguments in favor of adopting a policy of expansion?

Answers

The major arguments in favor of adopting a policy of expansion included :

Economic OpportunitiesManifest Destiny

Why did some people support American imperialism ?

Supporters of expansion argued that acquiring new territories would open up new markets for American goods and provide access to valuable natural resources.

The ideology of manifest destiny, which held that it was the destiny of the United States to expand and spread its democratic ideals, played a significant role in justifying expansion.

Control over key territories was believed to provide a buffer against potential rivals and safeguard American trade routes.

Find out more on American imperialism at https://brainly.com/question/30018629


#SPJ1

The prolonged period of few sunspots between 1645 and 1715 is known at the MaunderMinimum.T/F

Answers

The statement is True. The prolonged period of few sunspots between 1645 and 1715 is indeed known as the Maunder Minimum.

"Prolonged" refers to the state of something lasting for an extended period of time beyond what is considered normal, expected, or typical. It suggests a duration that is longer than usual, often implying a delay, persistence, or continuation beyond the anticipated timeframe. The term can be applied to various contexts, such as medical conditions, events, processes, or situations.

In the medical field, a prolonged illness or condition refers to an ailment that persists for an extended period, exceeding the usual recovery time. It may require additional treatment, monitoring, or interventions to address the prolonged nature of the illness. In broader contexts, the term can be used to describe situations like a prolonged drought, which indicates a long period of insufficient rainfall; a prolonged negotiation, suggesting that the process has extended beyond the expected timeframe; or a prolonged economic recession, signifying an extended downturn in economic activity.

To know more about Prolonged refer to-

brainly.com/question/31826841

#SPJ4

which of these is not one of holmes’ aspects of moral reasoning for christians?

Answers

Utilitarianism is not one of Holmes' aspects of moral reasoning for Christians. (Option d)

Holmes emphasizes the importance of Scripture, tradition, and reason in Christian moral reasoning. Utilitarianism, which is a consequentialist ethical theory focused on maximizing overall happiness or utility, is not explicitly mentioned as one of the aspects highlighted by Holmes. While Christians may consider the consequences of their actions, Holmes emphasizes the unique role of Scripture, tradition, and reason in shaping Christian ethical perspectives.

Utilitarianism, with its emphasis on utility rather than religious or scriptural foundations, does not align with Holmes' framework of moral reasoning for Christians.

Learn more about Utilitarianism

https://brainly.com/question/14453548

#SPJ4

Complete Question:

which of these is not one of holmes’ aspects of moral reasoning for christians?

a. Scripture

b. Tradition

c. Reason

d. Utilitarianism

this group of italian artists believed that war was a "cleansing agent" and promoted the dynamism of speed and machine technology

Answers

The group of Italian artists that held the belief that war was a "cleansing agent" and promoted the dynamism of speed and machine technology is known as the Futurists.

They believed that war was necessary to bring about change and progression in society, and they celebrated the advancements in technology that came with it. This belief was reflected in their art, which often featured dynamic, abstract compositions and emphasized movement and speed. The Futurists were active from the early 20th century until the end of World War II, and their influence can still be seen in contemporary art and design.

This group of Italian artists, known as the Futurists, believed that war was a "cleansing agent" and promoted the dynamism of speed and machine technology. Founded in 1909 by Filippo Tommaso Marinetti, Futurism aimed to break away from the traditional, static art forms of the past and celebrate modernity, movement, and the industrial age. The Futurists embraced the concept of war as a means to purge society of its outdated values and make way for a new era of progress.

Through their artwork, they sought to capture the energy, speed, and power of machines, using dynamic lines and bold colors to convey a sense of motion and vitality. This revolutionary artistic movement challenged conventional aesthetics and pushed the boundaries of what art could represent, ultimately influencing later art movements such as Cubism and Dadaism.

To know more about revolutionary artistic  visit :

https://brainly.com/question/25390368

#SPJ11

why did malcolm x leave the nation of islam? he disagreed with its religious views. he wanted to promote separatist views. he believed that christiani

Answers

Malcolm X left the Nation of Islam primarily because he wanted to distance himself from its leader, Elijah Muhammad. (Option d)

After learning about Elijah Muhammad's extramarital affairs and questionable moral conduct, Malcolm X became disillusioned with the organization and its leadership. He felt betrayed by Elijah Muhammad, whom he had previously revered. Additionally, Malcolm X underwent a transformation in his ideological beliefs during his pilgrimage to Mecca, where he encountered a more inclusive and diverse form of Islam.

This experience led him to embrace a more universalist and inclusive approach, which contrasted with the separatist ideology promoted by the Nation of Islam. As a result, Malcolm X decided to leave the organization and form his own religious and political movement.

Learn more about malcolm x

https://brainly.com/question/30434901

#SPJ4


Complete Question:

Why did Malcolm X leave the Nation of Islam? Was it:

a) He disagreed with its religious views.

b) He wanted to promote separatist views.

c) He believed that Christianity was a superior religion.

d) He sought to distance himself from Elijah Muhammad.

which role in musical life was socially acceptable for eighteenth-century women?

Answers

In the eighteenth century, the role of women in musical life was limited due to societal expectations and gender norms.

While women were encouraged to participate in music-making as amateurs in their homes, their involvement in professional music was seen as socially unacceptable. However, there were some roles that were deemed appropriate for women in musical life, such as singing in the church choir or performing in private concerts. Women were also allowed to teach music as long as it was to other women and children. It was not until the late eighteenth century that women began to gain more opportunities in the music profession, with the rise of female composers and performers. Despite the limitations, many women continued to pursue their passion for music and played important roles in the musical world, both professionally and socially.

To know more about eighteenth-century visit:

https://brainly.com/question/31025073

#SPJ11

this singer-songwriter was a piano prodigy trained at the peabody conservatory.

Answers

Answer:

The given quotation states that a singer-songwriter was a prodigy on the piano and had received training at the Peabody Conservatory. Here is a step-by-step explanation of the quotation:

Step 1: Who is the subject of the quotation?

The subject of the quotation is a singer-songwriter.

Step 2: What was the singer-songwriter's special talent?

The singer-songwriter was a piano prodigy, which means they had exceptional talent and ability when it came to playing the piano.

Step 3: Where did the singer-songwriter receive their training?

The singer-songwriter received their training at the Peabody Conservatory, which is a renowned music school located in Baltimore, Maryland, in the United States.

Step 4: What is the Peabody Conservatory?

The Peabody Conservatory is a music school that was founded in 1857 and is affiliated with Johns Hopkins University. It is one of the oldest and most prestigious music schools in the United States.

Step 5: What is a prodigy?

A prodigy is a person who demonstrates exceptional talent or ability in a particular field at a young age.

Step 6: How does the quotation relate to the singer-songwriter's career?

The quotation suggests that the singer-songwriter's early training as a piano prodigy at the Peabody Conservatory may have contributed to their success as a musician and songwriter.

The policy of the Kennedy administration towards Vietnam included
a. the sending of thousands of additional American troops in support of the Diem government in North Vietnam
b. The sending of thousands of additional American advisors along with removal of support for Diem government in South Vietnam
c. massive escalation of the war through the introduction of hundreds of thousands of American troops
d. increased support for the French effort to end the insurgency by communist revolutionaries

Answers

B, thousands of US advisers to assist and train the South Vietnamese armed forces
The policy of the Kennedy administration towards Vietnam included the sending of thousands of additional American advisors along with removal of support for Diem government in South Vietnam.

Jainism, like Hinduism, places great emphasis on the Vedas.
T
F

Answers

The fact that the Jainism, like Hinduism, places great emphasis on the Vedas is false. Because jainism is a separate religion.

In other words, While Hinduism places great emphasis on the Vedas, Jainism does not. Jainism originated in ancient India and has its own unique set of beliefs and practices.

The Vedas are ancient Hindu scriptures that were compiled over thousands of years and are considered to be the oldest and most sacred texts of Hinduism.

While Jainism and Hinduism share some similarities due to their common origins in India, they are distinct religions with their own unique traditions and beliefs.

Jainism places great emphasis on non-violence, compassion, and the importance of spiritual self-discovery and liberation. It is important to note that religions, like all aspects of culture, adapt to the demands of their followers and evolve over time.

Learn more about the jainism: https://brainly.com/question/32217035

#SPJ11

the right to vote in political elections is known as which of the following.
A. activism
B. suffrage
C. urbanization
D. endowment

Answers

The right to vote in political elections is knowns as (B) Suffrage

Dictionary Definition of Suffrage:
the right to vote in political elections

which of the following best describes pavlov's reaction to köhler's work on tenerife?a. He replicated it with the same results b. He did not attempt to replicate it because he thought it was nonsensical.c. He replicated it but found it to be "chaotic".d. He revised his own system as a result of it.e. He replicated it with the same results.

Answers

Pavlov's reaction to Köhler's work on Tenerife is best described as option e - he replicated it with the same results.

Pavlov was impressed with Köhler's work and the insights it provided into animal behavior, particularly the idea of insight learning. Pavlov himself attempted to replicate the experiments and found that the results were consistent with Köhler's findings. This led Pavlov to incorporate insight learning into his own theories and revise his system to include this concept. Overall, Pavlov's reaction to Köhler's work was one of admiration and a willingness to incorporate new ideas into his own research.

To know more about Pavlov's reaction visit:

https://brainly.com/question/30486217

#SPJ11

how did american women respond to the denial of their right to vote in the late nineteenth century?

Answers

Answer:

they formed temperance movements

Final answer:

American women responded to the denial of their right to vote in the late nineteenth century through organizations like NAWSA and WSPU, using peaceful protests, lobbying, and radical actions. Their efforts led to the passage of the 19th Amendment in 1920.

Explanation:

American women responded to the denial of their right to vote in the late nineteenth century through a variety of methods and organizations. One prominent organization was the National American Women Suffrage Association (NAWSA), which used peaceful protests, lobbying, and public speeches to advocate for women's suffrage. Another organization, the Women's Social and Political Union (WSPU) in Britain, took more radical actions like hunger strikes and civil disobedience.

The suffragists faced opposition from anti-suffrage groups and politicians who believed women were not capable of participating in politics. However, their efforts eventually led to the passage of the 19th Amendment in 1920, granting American women the right to vote.

Keywords: American women, denial of right to vote, late nineteenth century, National American Women Suffrage Association (NAWSA), Women's Social and Political Union (WSPU), suffragists, 19th Amendment

Learn more about American women's response to the denial of their right to vote in the late nineteenth century here:

https://brainly.com/question/34610742

#SPJ2

why did president johnson get the united states so deeply into vietnam? what could he have done to avoid going deeper into the quagmire? provide three points to support your answer.

Answers

President Johnson was motivated to get the United States deeply involved in Vietnam because he believed in the domino theory.

This theory stated that if one country fell to communism, other neighboring countries would also fall like dominoes. Johnson believed that if the United States did not intervene in Vietnam, then other countries in the region would also become communist, leading to a significant threat to US national security. To avoid getting deeper into the quagmire, Johnson could have taken several actions. Firstly, he could have sought a diplomatic solution instead of escalating the war. Secondly, he could have avoided committing ground troops and instead used air power to contain the situation. Lastly, he could have worked with South Vietnamese leaders to strengthen their military and political systems, rather than trying to impose US values on the country.

Learn more about domino theory from here:

https://brainly.com/question/28082356

#SPJ11

how do teens in the u.s. differ from teens in other countries when it comes to employment?

Answers

Answer:

How do teens in the U.S. differ from teens in other countries when it comes to employment? Teens in the U.S. spend a great deal more time working than teens in other industrialized nations. Which of the following terms would be applied to someone who is low in masculinity and femininity?

When it comes to employment, teens in the United States differ from teens in other countries in several ways. Firstly, the legal working age in the U.S. is 16, while in some countries it can be as low as 14. This means that teens in other countries may have more opportunities to start working earlier in their teenage years.

When it comes to employment, teens in the United States differ from teens in other countries in several ways. Firstly, the legal working age in the U.S. is 16, while in some countries it can be as low as 14. This means that teens in other countries may have more opportunities to start working earlier in their teenage years. Additionally, the types of jobs that teens are able to work in can differ between countries. For example, in some European countries, teens are able to work in the hospitality industry, such as restaurants and bars, at a younger age than in the U.S.

However, on the other hand, teens in the U.S. have more opportunities to work part-time jobs while in school. Many high schools have work-study programs or partnerships with local businesses, which allow teens to gain work experience while also completing their studies. This is not always the case in other countries.

Overall, the differences between teens in the U.S. and other countries when it comes to employment can be influenced by legal regulations and cultural norms. It's important to note that each country has its unique characteristics when it comes to teens in the workforce.

To know more about teenage visit:

https://brainly.com/question/28542580

#SPJ11

marking the end of imperialist impunity, in 1956 the joint british, french, and israeli attack on egypt to seize control of the suez canal failed. this failure left the arab nationalist more firmly in power and made him a hero in egypt.

Answers

The joint British, French, and Israeli attack on Egypt in 1956 marked a turning point in the history of imperialism.

The failure of the attack to seize control of the Suez Canal was a clear indication that imperialist powers could no longer act with impunity. This failure also served to strengthen Arab nationalist sentiment and elevated the status of the Egyptian leader as a hero to his people. The event demonstrated that the age of unchecked imperialist aggression was coming to an end, as the oppressed people of the world were increasingly emboldened to resist their subjugation.

The attack on Egypt was driven by several factors, including the nationalization of the Suez Canal by Nasser, who sought to assert Egyptian sovereignty and gain control over a vital waterway that was previously under Western influence.

Learn more about history of imperialism here:https://brainly.com/question/377688

#SPJ11

Other Questions
if an mrna sequence contains uaa, uag or uga, how would that translate to a ribosome? Which of the following has contributed the LEAST to the boom in entrepreneurship?1)Information technology2)Economies driven by innovation3)Education4)Demographic and economic trends An object is placed 10 cm from a convex lens with a focal length of magnitude 20 cm. What is the magnification? A) 0.50 B) -2.0 C) 1.5 D) 2.0 E) -2.5 how does same-sex or other-sex childhood sexual exploration influence adult sexual orientation? Which of the following is an example of intrapersonal conflict?a.role conflictb.an argument between coworkersc.a conflict with a customerd.role reversal you are in the lab trying to identify protein x. the first gel you run for protein x gives you one band at 30 kd and another band at 75 kd. you run another gel for protein x using another technique. this time, you get one band at 210 kd. which technique did you use to obtain these results? project integration management must occur just within the context of a particular project.tf Long division by single digit (no remainder)Grade 4 Division WorksheetFind the quotient.1.3 5612.2 3083.8 2884.7 6165.5 3656.9 9907.6 2948.6 1809.5 205 You and a group of friends wish to start a company. You have an idea, and you are comparing startup incubators to apply to. (Start up incubators hold classes and help startups tto contact venture capitalists and network with one another) Assume funding is normally distributed. Incubator A has a 70% success ratio getting companies to survive at least 4 years from inception. The average venture funding of the 57 companies reaching that 4 year mark, is 1.3 million dollars with a standard deviation of 0.6 million Incubator B has a 39% success ratio getting companies to survive at least 4 years from inception. The average venture funding of the 40 companies reaching that 4 year mark, is 1.9 million dollars with a standard deviation of 0.55 million a. Are the success ratios significantly different? a. Are the assumptions met? If so: i. Do the test in canvas ii. Calculate the test using the normal approximation b. Is the average funding in incubator B significantly different? (use a=0.01) i. Use the normal approximation, assume standard deviations are the same! In the regulation of enzyme activity by phosphorylation (as discussed in class), the introduction of phosphate to the enzyme being controlled: A. requires a protein kinase enzyme but not ATP B. requires a protein kinase enzyme plus ATP C. requires a protein phosphatase enzyme plus ATP D. requires a protein phosphatase enzyme but not ATP 24 you have the following sequencing reads. using these reads, create a sequence contig by dragging and dropping the boxes into the correct order. make sure to show the overlap.CGAACTTTTGGCCGTGATGGGCAGTTCC CGTGATGGGCAGTTCCGGTG CTATCCGGGCGAACTTTTGGCCG TTGGCCGTGATGGGCAGTT TTCCGGTGCCGGAAAGA TGGCCGTGATGGGCAGTTCCGGTG A nurse is teaching a client who has gastroesophageal reflux disease about managing his illness. Which of the following recommendations should the nurse include in the teaching?A. Limit fluid intake not related to meals.Rationale: The nurse should recommend consuming liquids between meals rather than with meals to help reduce abdominal distention.B. Chew on mint leaves to relieve indigestion.Rationale: The nurse should instruct the client to avoid items like mint that can increase gastric acid secretion.C. Avoid eating within 3 hr of bedtime.Rationale: The nurse should instruct the client to eat small, frequent meals but to avoid eating with 3 hr of bedtime.D. Season foods with black pepper.Rationale: The nurse should instruct the client to avoid items such as black and red pepper that can increase gastric acid secretion. The intensity of a polarized electromagnetic wave is 12 W/m^2 .Part A) What will be the intensity after passing through a polarizing filter whose axis makes the angle = 0 with the plane of polarization?The intensity of a polarized electromagnetic wave is 12 W/m^2 .Part A) What will be the intensity after passing through a polarizing filter whose axis makes the angle = 0 with the plane of polarization? the following contain tandem repeats? a) strs (short tandem repeats) b) telomeres c) centromeres d) intergenic sequences e) all of the above suppose we have a 4096 byte byte-addressable memory that is 64-way high-order interleaved, what is the bit-size of the memory address module offset field? question 17 options: a. 12b. 6c. 10d. 8 what is the most logical order of exercises in a weight training circuit? in terms of friendships, ethnic boundaries may become sharper during adolescence due to which state's motto is" by the sword we seek peace, but peace only under liberty"? Given the peak absorbance wavelength of the Blue 1 dye, which of the following statements is true? O Select one: a. The peak absorbance occurs at a wavelength that is different from the color that is perceived because we see the wavelengths that are reflected. b. The peak absorbance wavelength is the same as the wavelength that we see because we see the wavelengths that are absorbed by the sample. c. The peak absorbance wavelength is the same as the wavelength that we see because we see the wavelengths that are reflected. O d. The peak absorbance occurs at a wavelength that is different from the color that is perceived in the eye because we see the wavelengths that are absorbed by the sample. (Characteristic Polynomial.) One of the most celebrated linear algebra results relating to eigenvalues is the Cayley-Hamilton theorem. Recall that the characteristic polynomial is given by p(1) = det(XI A) = \" + An-111-1 + +ail+ao. The Cayley-Hamilton theorem states that n = = P(A) = AM + An-1 An-1 +...+Q1A + Qol = = 09 where we now view p: R*n Rnxn as a mapping on the space of Rnxn matrices. This theorem holds in general for any matrix. In this problem you will show it holds for the following easier setting. Suppose A is diagonalizable. a. Recall that in Mod3-L1 we saw how to compute powers of matrices that are diagonalizable i.e., Ak = VAKV-1, = where V is a matrix containing the eigenvalues of A, and A is a diagonal matrix with the eigenvalues. Consider a polynomial q(s) Amsm + am-18m-1 +...+ a1s + ao. Show that 9(A) =V9(A)V-1 where q(A) = diag(q(11), ..., 9(\n)). = = = b. Now, apply part a. to the polynomial p(X) = det(XI A) to show that p(A) = 0.