What are the answers here? Select all that apply.

Answer:

During translation, ribosomes move along an mRNA strand, and with the help of proteins called initiation factors, elongation factors, and release factors, they assemble the sequence of amino acids indicated by the mRNA, thereby forming a protein.

Explanation:

Answer:

Explanation:

Los ARN mensajeros, también conocidos como ARNm, son uno de los tipos de ARN que se encuentran en la célula. Éste en particular, como la mayoría de los ARN, se sintetiza en el núcleo y luego se exporta al citoplasma, donde la maquinaria de traducción, la maquinaria que realmente fabrica las proteínas, se une a las moléculas de ARNm y lee en ellas el código para producir una proteína específica. Así que en general, un gen, el ADN de un gen, puede ser transcrito en una molécula de ARNm que puede acabar dando lugar a una proteína específica.

Answer:

c

Explanation:

Answer:

Primary consumer.

Explanation:

Ok, so a producer is stuff like grass. Then you've got decomposers, which are maggots and vultures and animals like that (ew). Our primary consumer is the bird, then you've got the snake which eats the bird, and then there's the alpha predator, the hawk, which can eat both the snake and the bird. We call the alpha predator the tertiary consumer.

Do you get it now?

Answer:

ATP and NADPH

Explanation:

they use it to reduce carbon dioxide and convert the energy into chemical bond energy in carbohydrates such as glucose

Answer:

6 [tex]x^{2}[/tex]  +  7 x  −  20

Answer:

many things..........

Answer:

energy

Explanation:

hope its is correct!!

Answer:

Radiation has a potential of causing germ cell mutations that may be passed on to future generations.

Explanation:

i think so, hopefully this helps;(

Ionizing radiation damage cells and cause double-strand breaks that let more DNA in. These additional fragments of DNA find their way to the nucleus and cause cellular mutations. Protective gears are worn to prevent this.

X-rays are a form of electromagnetic wave radiation. Using X-ray imaging, your body's interior can be visualized. The photos depict the various bodily parts in various shades of black and white. This is due to the fact that various tissues absorb radiation in different ways.

Ionizing radiation, a type of radiation that x-rays create, has the ability to destroy living tissue. This is a risk that gets worse the more exposures someone has over the course of their lifetime. However, exposure to radiation normally carries a low risk of acquiring cancer.

Therefore, protective gears are worn during x-rays to avoid mutations.

Learn more about X-rays, here:

https://brainly.com/question/2833441

#SPJ2

Answer:

the second, fourth and fifth ones are balanced.

Answer:

amino acids

Explanation:

A protease is an enzyme capable of catalyzing the breakdown of proteins into polypeptide fragments and single amino acids, which are the building block of proteins. Proteases act by breaking peptide bonds by a process called hydrolysis, a reaction where water molecules break down peptide bonds (hydro means water and lysis means split). Proteases can be classified depending on the catalytic residue into cysteine, serine, threonine, aspartic, glutamic and metalloproteases.

The product that will be present in the test tube will be amino acids.

Protease is an enzyme that acts on protein by converting it into different

types of amino acids.

Amino acids are referred to as the building block of life and are important

nutrients in growth and replacement of worn-out tissues. The protease acts

on the protein by breaking the peptide bonds under the required

temperature.

An inadequate temperature may result in the denaturing of the enzyme

which was why the test was done at 37°C. This is the body temperature of

humans which led to the formation of amino acids which is absorbed by cells

of the body.

Read more on https://brainly.com/question/20299415

Answer:

This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.

Explanation:

This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Answer:

A

Explanation:

I took the question in a online quiz

Answer: B || Geothermal energy comes from the internal heat of Earth.

Explanation:

hope it helped xx :))

Answer: It’s not in shape like it’s cut out

Explanation:

Answer:

he could not complete it cut he out of shape

Answer:

an estuary

Explanation:

A wetland which contains a mixture of fresh water and salt water is called as an estuary. Thus, the correct option is A.

An estuary is an example of a partially enclosed, coastal water body where the freshwater from rivers and streams mixes up with the salt water from the ocean bodies. Estuaries, and their surrounding lands, are the places of transition from the land area to the sea area.

Estuaries and their surrounding wetlands are the bodies of water which are usually found where the rivers meet the sea. Estuaries are the home to many of the unique plant and animal communities which have adapted to the brackish water, which is a mixture of fresh water draining from the land and the salty seawater.

Therefore, the correct option is A.

Learn more about Estuary here:

https://brainly.com/question/17564221

#SPJ6

Answer:The energy change in a chemical reaction is due to the difference in the amounts of stored chemical energy between the products and the reactants. This stored chemical energy, or heat content, of the system is known as its enthalpy.

Explanation:

Answer: The energy in this reaction (photosynthesis) comes from light.

Sorry about cutting it close, hope this helps.

Answer:

In our respiratory system, carbon dioxide is the waste material that we expel when we breathe out. The answer is C, Carbon Dioxide

I hope you have a great day!

The waste product of respiration is

C. Carbon dioxide

The oxygen consumed via stomata is used up by cells.

Oxygen from the air enters a leaf through stomata and reaches all the cells by the process of diffusion. This oxygen is used in respiration in cells of the leaf. The carbon dioxide produced during diffuses out from the leaf into the air through same stomata. The oxygen used by cells in the leaves to disintegrate glucose into water and carbon dioxide.

Thus, option C is correct.

Find more information about Respiration here:

brainly.com/question/18169685

Lipids don't store genetic informations so the answer is 2

they absorb liposoluble vitamins they offer insulation/cushioning they store energy

Answer:

C

Explanation:

hope this helps

The list of biomes that shows environments from the highest average temperature to the lowest average temperature is desert, swamp, and mountain. Therefore, option C is correct.

Since they belong to certain areas or zones that, due to their geographical characteristics, share a climate, vegetation, and wildlife, biomes provide the primary support for the harmony of nature.

Any biome can include a wide range of habitats because the term "biome" is more general than "habitat." An area's climate and geography determine the biome classification. Communities that have adapted to the unique climate and ecology of the biome make up each one. Depending on the surroundings, they come in a variety of forms. The temperate deciduous biome is the ideal environment for human habitation.

The list of biomes that shows environments from the highest average temperature to the lowest average temperature is desert, swamp, and mountain. Therefore, option C is correct.

Learn more about biomes, here:

https://brainly.com/question/18601179

#SPJ6

Answer:

Due presence of Sahara desert that is responsible for the formation of this hurricane and its movement towards Florida.

Explanation:

Hurricane Harvey traveled from the Africa towards the Florida because these hurricane formed at the African region due to the presence of Sahara desert. The hot and dry wind of Sahara desert meets with the cool, moist air from the south produces these hurricane which then moves from the Africa to the west side where Florida is located so that's why Hurricane Harvey traveled from Africa towards the Florida.

Answer:

Section 4: Answer the following analysis questions about your proposed solutions.  

Describe the ways your proposed solutions decrease the negative effects of habitat destruction and human activity on your selected ecosystem. The Koalas won’t be extinct.

Describe the costs, safety, and reliability of your proposed solutions, as well as any social, cultural, and environmental impacts your solutions address. They will impact because they will be helping.

Evaluate your proposed solutions for their impact on overall environmental stability and changes. Which solution has more impact? Explain your reasoning for picking one solution over another. I would pick the food because they need to have protein to live longer.

How could you refine one of your proposed solutions to further reduce environmental impact and loss of biodiversity while also addressing human needs? If people want to see them at the zoo, then they should take care of them.

There u go!!!! Hope this helps.

And if someone else answers, can I have the brainliest?

Have an amazing day :D

Protein is found throughout the body—in muscle, bone, skin, hair, and virtually every other body part or tissue.

It makes up the enzymes that power many chemical reactions and the hemoglobin that carries oxygen in your blood. At least 10,000 different proteins make you what you are and keep you that way.

Protein is made from twenty-plus basic building blocks called amino acids.

Because we don’t store amino acids, our bodies make them in two different ways: either from scratch, or by modifying others. Nine amino acids—histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine—known as the essential amino acids, must come from food.

Therefore, Protein is found throughout the body—in muscle, bone, skin, hair, and virtually every other body part or tissue.

To learn more about protein, refer to the link:

https://brainly.com/question/17095120

#SPJ5

Answer:

predators keep the population of mice under control, insects pollinate flowers, and worms decompose leaf litter. All species are important and help keep the ecosystem balanced.

Explanation:

Answer:

keystone species

Explanation:

Answer:because time and society are different

Explanation:

Answer:

TAAGCGCTA

Explanation:

Answer:

15

Explanation:

Gametes have half the amount of dipliod somatic ells

I’m 90% this is right

Sorry if I’m wrong

Answer:  c

Explanation:

Answer:

Explanation:

If the entire square is shaded and that 24m being the measurement of just one side just multiply 24 by 24 which is 576[tex]m^{2}[/tex]

If you are saying that 24 is the length of all of the sides combined just divide 24 by 4 to get one side and square it. 6 times 6 and you get 36[tex]m^{2}[/tex]