What are three ways that synthetic materials benefit human society?

Answers

Answer 1

Answer:

The benefits in synthetics are many, they have properties that we can't find in nature, they allow us to make things stronger, lighter, more fuel-efficient, shiner, longer lasting. And at the same time, we do add to the pollution of our world, affect the health of animals and humans, and requires energy to make.

Explanation:

Answer 2

Synthetic materials, also known as man-made or artificial materials, have made significant contributions to human society. Like Improved Performance and Durability, Expanded Range of Applications, etc.

Here are three ways in which synthetic materials benefit us:

Synthetic materials often possess superior properties compared to natural materials, such as increased strength, durability, and resistance to wear and tear.

Expanded Range of Applications: Synthetic materials have opened up new possibilities by offering characteristics that may not be readily available in nature.

Resource Conservation and Environmental Benefits: Synthetic materials can help conserve natural resources by providing alternatives to scarce or unsustainable materials.

Thus, while synthetic materials have numerous benefits, it is essential to consider their environmental impact throughout their lifecycle, including disposal and potential hazards.

For more details regarding synthetic materials, visit:

https://brainly.com/question/24357817

#SPJ6


Related Questions

what is the level of organization in living things

Answers

an organism is the level of organization in living things
Organisms in ecosystems

Please look at these, i'm confused, i need the questions answered, and i need a graph or just need to know how to make the graph (idk how).

Answers

Set up a graph that shows voltage on the x axis and the number of paper clips picked up on the y axis.

When you graph anything your points are made up of an x value and a y value (x,y).

You’re going to use the voltage as your x value and the average number of paper clips picked up at that given voltage as your y value.

I’ll do the first one for you! For the 25-turn electromagnet at a voltage of 1.5V the average number of paper clips picked up was 6. Giving us the point (1.5,6) that’s what you should be graphing. Do the same for all of the others.

Comment if you need more clarification! I hope this helps!

This separation of charge on (blank) of the molecule is called (blank).

Answers

Answer:

Polar and Non-Polar Molecules

Explanation:

Polar and non polar

HELPPPPP

How does the acceleration of an object affect its force?

Answers

By a other object using force
states that the acceleration of an object increases with increased force and decreases with increased mass. ... Notice how mass and force affect acceleration. Newton's second law. The acceleration of an object increases with increased force, decreases with increased mass, and is in the same direction as the force.

What is needed in order to create nuclear power? CHECK ALL THAT APPLY.

Uranium

Carbon

Atoms

Oxygen

Molecules

Answers

Answer:

uranium and atoms

Explanation:

should be uranium and atoms

Please help ASAP I will give 19 points please help


Don’t answer if you don’t know it, if you answer that is really rude because I need the answer and only 1 more person would be able to answer not 2 people to not answer if you have no answer. I am making it clear again DO NOT ANSWER IF YOU DONT KNOW THE ANSWER

Answers

Answer:

Can you pls clarify this

Explanation:

I dont

the right answers are on quizlet!!! it’s a great use.

What is the function of a cell wall?

Answers

It acts as a skeleton for plants, protects the internal contents of the cell, and regulates cell growth

Which one would charge faster?

Answers

the corrects answer is C

a sample substance has the chemical formula: H2CO3 , one molecule of the sample contains __ ????

Answers

Answer:

1,6,8

Explanation:

Periodic Table- H=1.C=6,O=8

Hydrogen is H, Carbon is C, Oxygen is O

Answer:

H=hydrogen

C=carbon

O=oxygen

H- 1

C- 6

o- 8

Explanation:

New Orleans has an altitude at and below sea level, a latitude near the Tropic of Cancer (the equator-zone), is surrounded by water, and has no mountains near by. What would you expect the climate to be?

Answers

Answer:

Rainy, sunny and humid.

Explanation:

Human activities can have more affect on the environment than you may think. When a dam is built, what are some of the impacts it will have on the surrounding environment?

Practice
Answer in at least 2 complete sentences.

Answers

Answer:

When a dam is built, the rest of the lake will begin to drought and remove moisture for the wildlife. Making the wildlife adapt, and in severe cases, become endangered.

Which one is right pls help

Answers

Answer:

The answer is Electron

Explanation:

Answer:

the answer is electron

What does the conversation of mass say about the amount of atoms in the reactants compared to the products?

Answers

Answer:

the mass of any one element at the beginning of a reaction will equal the mass of that element at the end of the reaction. If we account for all reactants and products in a chemical reaction, the total mass will be the same at any point in time in any closed system.

Answer:

[tex]\boxed {\boxed {\sf Atoms \ in \ reactants \ = atoms \ in \ products}}[/tex]

Explanation:

The Law of Conservation of Mass states that mass cannot be created or destroyed.

In a chemical reaction, this means the mass of the reactants (substances going in and being changed) must equal the mass of the products (new substances from the reaction).

In addition, the amount of atoms must stay the same. The atoms can and will reconfigure to form different compounds, but the number of atoms stays the same.

What is the difference between a homogeneous and heterogeneous mixture?

Answers

A homogeneous mixture is made up of multiple different substances. (You can see different parts)
Ex: Cereal in milk or ice in soda

A heterogeneous mixture is a mixture that is mixed well. ( you can’t see the different parts)
Ex: Rain or air
You wake up in the morning and make yourself a cup of coffee. You pour the coffee in your cup, add milk, add sugar, and stir everything together. The result is a uniform cup of caffeinated goodness. Each sip should taste and look the same.

This is an example of a homogeneous mixture. In this type of mixture, the components are evenly distributed throughout and the mixture has a uniform appearance. You shouldn't be able to pick out the individual components. Additionally, you can describe a homogeneous mixture as having only one phase. A phase is any part of the mixture that has the same chemical properties and uniform distribution of the components.


Heterogeneous

When you're eating a bowl of cereal, you are consuming a heterogeneous mixture. You can easily see the different things that make up this mixture: the milk and the cereal. Each spoonful will have different distributions of the components.

A heterogeneous mixture has components that are not evenly distributed. This means that you can easily distinguish between the different components. A heterogeneous mixture has two or more phases. This doesn't necessarily mean phases of matter, like liquid or solid. For example, a mixture of water and oil has two liquid phases. Each phase has its own distinct chemical properties.

Look at the table that shows values for Coast Guard search and rescue operations. Write an evaluation of the success of the Coast Guard’s efforts. Be sure to support your answer with evidence from the data table.

Answers

Answer:stats are higher than before

Explanation: its their evaluation because the stats are higher than beofre

Pollen is transferred from the stamen of one flower to the stigma of another. What has occurred?

Answers

Cross-pollination is the transfer of pollen from the anther of one flower to the stigma of another flower on a different individual of the same species. Self-pollination occurs in flowers where the stamen and carpel mature at the same time, and are positioned so that the pollen can land on the flower's stigma.
I think that does little animals are Making honey

How are the volvox, euglena, paramecium, and amoeba similar and different in how they move, and eat?

Answers

Answer:

Both can hunt for their food (heterotrophs), but euglena can also make their own food (autotroph) with its chloroplasts. Amoeba have pseudopods to move/eat, but euglena have flagella to move. How are euglena and paramecium similar and different? ... Both also use flagella to move, but volvox move together in colonies.

Explanation:

Answer: wattskennedy is right

Explanation:

Does anyone know the Lab Report of acids and bases???? HELP PLZ WILL GIVE BRAINLIEST WHOEVER HELPS PLZ

Answers

Answer:

Litmus is a natural acid-base indicator extracted from a type of lichen. If you have red and blue litmus paper, you can test different solutions for whether they are acids or bases. Blue litmus paper turns red when a solution is acidic; red litmus paper turns blue in basic solutions

Explanation: Hope this helped

help me pls omg , im stuck

Answers

Answer:

b

Explanation:

I NEED HELP ASAP DON'T JUST ANSWER FOR POINTS OR YOU WILL GET REPORTED!
How many protons, neutrons, and electrons does potassium's neutral atom have?

Answers

Answer:

The number of neutrons is entirely dependent on the Mass number of the particular atom. The standard mass for potassium is 39.

Potassium is element number 19, so it has 19 protons and 19 electrons in the neutral atom. It has therefore 39-19 = 20 Neutrons.

Explanation:

Answer:

Number of Protons 19

Explanation:

Number of Neutrons 20

Number of Electrons 19

Melting Point 63.65° C

im literally gonna cry . what is this

Answers

Ok I will!!!!!!!!!!!
what is the picture lol , it looks like it was took on a calculator....

If density is calculated by mass divided by volume and the mass increases, what would happen to the density of an object?



Would it increase or decrease?

Answers

It would increase becuase it wouldn’t make sense if it decreased

What causes the electrons to move and form static electricity?
moist air
dry air
friction

Answers

Answer:

friction

Explanation:

The rubbing of certain materials against one another can transfer negative charges, or electrons.

The friction generating between the surface of two objects causes the electrons to move from one body to the other and form static electricity. Hence, option c is correct.

What is static electricity ?

Static electricity is the flow of electrons that occurs due to the temporary polarization of two bodies. When a conducting surface rub on other surface, they gets electrons by frictional force.

These free flow of electrons make them negatively charged. When this negatively charged body comes in contact with a non conducting surface they latter gets polarized by the electrons of negatively charged body.

The positive charges of the nonconducting surface gets attracted to the negative body and the electrons flow from the negatively charged body to the partially polarized positive body. This is called static electricity.

Find more on static electricity:

https://brainly.com/question/22172098

#SPJ6

Which of the following elements does NOT need to be diatomic to exist in nature?

A. Hydrogen
B. Oxygen
C. Carbon
D. Nitrogen

Answers

I am pretty sure it is A

How do living and nonliving things differ?

Answers

Answer:

Hey mate.....

Explanation:

This is your answer,

Living things differ from non living things through motion, action, expression, way of living and etc......

Livings things:-

1. Livings things means something that keeps on moving or doing any particular work.

2. Livings things mostly consume, remove, and reproduce through different ways.

3. Examples of livings things are humans, animals, birds, reptiles, and even the germs like bacteria, fungi, ameoba and etc....

Non Livings things:-

1. Non Living things means something that just stays like a statue usually and never move or do a particular work.

2. Non living things do not consume, remove or reproduce anything.

3. Examples of non living things are table, chair, fan, house, book etc....

hope it helps you mate....

MARK ME AS THE BRAINLIEST.....

Follow me.....!!!!

Which of the following is a combination of more than on simple machine?

A.Pulley
B.Wedge
C.Scissors
D.Incline

Answers

Answer:

D.

Explanation:

Answer:

It is D. Incline

Energy can be neither created nor destroyed. This fact means that even though energy sources can be depleted (used up), the energy in them is not destroyed. Instead, it is transformed to other forms of energy. And almost all energy resources here on Earth can have their energy traced back to the Sun’s gravitational or light energy.

Electricity is often thought of as a secondary source of energy because it must be gained by transforming some other kind of energy (a primary source). Think about where the electricity generated by a wind turbine comes from. Describe the path that wind energy takes from the Sun’s light to electricity.
plz help ioo points
hurry

Answers

The heating of the Earth's surface and atmosphere by the sun drives convection within the atmosphere and ocean. This convection produces winds and ocean currents. The greater the pressure differences between a low-pressure area and a high-pressure area, the stronger the winds.
Hope this helps :)
The path is through a primary source and through a source of energy

Of the first 103 elements, how many have 2 letters in their symbols?​

Answers

90 chemical elements have two letters in their symbols.

the hydrogen atoms are (blank) to one side of the oxygen atom, resulting in a water molecule having a positive charge on the side where the hydrogens reside and a negative charge on the other side, where the oxygen atom resides.

Answers

Answer:

gngbfvgnbgfdzfxc

Explanation:

Can anyone help me out with these questions

Answers

Answer:

2. B It is the outermost layer of Earth, composed of solid rock and divided into sections called plates. 3. B The inner core is kept solid by the intense pressure of all the layers above it.

Explanation:

Other Questions
what should be added2x ^3+ 3x^2+8x-4to get 0 ? pls help asap! This homework is really hard what is the meaning of zest Which outcome was a benefit of the Pax Romana?The citizens of Rome were allowed to participate in government.AThe Roman Empire entered a period of economic prosperity.BThe citizens of Rome were encouraged to move up in classThe Roman Empire encouraged religious freedom.D Newspaper Article #3 Planning and Rough Draft:Directions: Using the prompt below, you will brainstorm and draft your second article for your magazine. Make sure to complete each days tasks on time, so that you dont fall behind. On Friday, you will be creating your final draft of this article and putting it in your newspaper. ________________________________________Monday: Read the prompt below and write a hook, transition sentence, and thesis. brainstorm one example per HELPS for each of your reasons that you could use to support your stance.Informational Essay Prompt = Cause and EffectThe medical advances of the Twentieth Century have many beneficial effects for humanity.Prompt: Think about an important medical breakthrough. How has the discovery/invention of __________________ affected society?Paragraph 1Hook:Transition sentence:Write thesis (restate prompt + 2 reasons): DIRECTIONS: use a computer to find examples with LOTS of details for the HELPS chart to support the above prompt. You must have AT LEAST 3 examples for each reason in your thesis (total of 6).HHistorical Examples**EEveryday News -Current Events**LLiterature/ Magazines/ Movies/ TV Shows**PPerson you know / Personal Experience**SSports / Science**________________________________________Tuesday: Use the Description text structure to write your essay. Plan which HELPS best support your thesis and where they will be in your essay. Use an outline or the shapes tool to create the graphic organizer here.Example: Outline TemplateI. CauseA. Effect (reason 1)i. Support (HELPS)ii. Support (HELPS)II. CauseA. Effect (reason 2)i. Support (HELPS)ii. Support (HELPS)_______________________________________________________________________CREATE IT HEREUsing your organizer above, draft your 1st body paragraph (paragraph 2). Remember, in your 1st body paragraph, focus on the 1st of your two reasons from your thesis statement and use HELPS to support it. Your conclusion should remind your reader of your points without repeating and include a reworded thesis statement. Draft your first body paragraph here: ________________________________________Wednesday:Continuing to use your organizer above, draft your 2st body paragraph (paragraph 3). Remember, in your 2nd body paragraph, focus on the 2nd of your two reasons from your thesis statement and use HELPS to support it. You will also write your conclusion (paragraph 4). Your conclusion should remind your reader of your points without repeating the information and should include a reworded thesis statement. Draft your second body paragraph here:Draft your concluding paragraph here:Thursday: Today you will put together all of your four drafted paragraphs into one solid article below. You will then use your ARMS and CUPS checklist and tasks below to revise and edit your article. Copy and paste your full article here:ARMS and CUPS:1. Highlight in yellow a sentence/word you added. 2. Highlight in blue a sentence/word you need to remove. 3. Highlight in green a sentence/word you need to move.4. Highlight in pink a sentence/word that you need to substitute.5. Highlight in purple word(s) that you need to add capital letters to.6. Highlight in dark blue words that are used too much and need to be replaced.7. Highlight in grey where punctuation marks need to be added. 8. Highlight in teal words that need to be spelled correctly.________________________________________Friday: You will follow the directions in your newspaper template PowerPoint to add your second article to your newspaper. Please give me the correct answer *20 POINTS*What took place off the coast of Brazil that would lead to Ferdinand Magellans fleet of five ships being reduced to four ships? Why do you think this happened? Sale! 25% OFF of the original price! Laura wants to buy a sleeping bag. The original price is $56. How much will Laura pay if she buys it during the sale. A certain first-row transition metal ion forms many different colored solutions. When four coordination compounds of this metal, each having the same coordination number, are dissolved in water, the colors of the solutions are red, yellow, green, and blue. Further experiments reveal that two of the complex ions are paramagnetic with four unpaired electrons and the other two are diamagnetic. What can be deduced from this information about the four coordination compounds Describe how chimpanzees use touch to communicate.No searching please. I already tried that and it wasnt the answer you need for the question. Give brainliest! 25 points! pls show work if can!!!!!!!! Why would more food lead to more jobs? Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo should the fact that a person has children in the UK over-rule their deportation after the have served a prison sentence ? What Solutions to population growthmight a penson from Europe suggest? What is 12x 9x 4x + 3 in factored form? hurry... Would you need circumference or area to find the amount of oil it takes to cover the bottom of a frying pan? At a book store there are 25 books on the clearance section. 20 of the books are young adult novels and the rest of the books are picture books. Which statement is not true?For every 4 young adult novels, there is 1 picture bookFor every 5 books, 4 are young adult novelsThe ratio of picture books to young adult novels is 1:4There is 1 picture book for every 5 booksAll statements are true As a result of the problems of the Industrial Age, some influential reforna new economic system.a single world government.a dictatorship in the United States. an end to all factories. pls help meh...... with the question.....pls it's urgent ...........