What forces the blood to circulate through vessels in a closed circulatory system?
a.
the notochord

b.
the nerve cord

c.
the cranium

d.
the heart

Answers

Answer 1

Answer:

a.

Explanation:

Answer 2

Answer:

the heart, i took the quiz


Related Questions

The sodium-potassium pump requires a carrier protein that binds
three sodium and two potassium ions.
two sodium and three potassium ions.
one sodium and four potassium ions.
three sodium and four potassium ions

Answers

Active transport carrier proteins are sodium-potassium pumps.

The Correct Answer is : three sodium and two potassium ions.

What is Sodium-potassium pump (Na+/K+ pump)?Antiporters include the Na+/K+ pump. Na+ and K+ ions can bind to it at specific locations. The pump needs an energy source because the movement of these ions is opposed to their concentration gradients. In order to hydrolyze ATP into ADP, it attaches to it. Energy is thus released as a result. The pump modifies its form using this energy. The ions release from the pump following the conformational shift, but they do so in different directions. K+ ions are injected into the cell while Na+ ions are pumped out. The Na+/K+ pump plays a critical role in maintaining the potential of cell membranes and transmitting nerve impulses, making its role extremely important. Motor neurons' ability to operate normally can be interfered with by a lack of K+ ions, which will cause the target.Motor neurons' and consequently the target muscles' functionality may be compromised by a lack of K+ ions.

To Learn more About sodium-potassium pumps refer To:

https://brainly.com/question/14101500

#SPJ4

gene sequencing is used to identify the flu virus. why would you sequence the hemaglutinin or neuraminidase?

Answers

In order to effectively induce membrane fusion, the hemagglutinin-neuraminidase (HN) protein, which is in charge of virus attachment, interacts with the fusion protein in a virus type-specific manner.

What distinguishes hemagglutinin from neuraminidase?

The main distinction between hemagglutinin and neuraminidase is that while neuraminidase cleaves sialic acid from viral receptors to release the progeny viruses from the host cells, hemagglutinin binds with cell target cells' surface sialic acid promotes viral attachment to host cells.

What part does neuraminidase play in the influenza virus?

Influenza Hemagglutinin (HA) glycoprotein is typically used by a viruses to bind to cell surface sialic acid receptors, and neuraminidase (NA) glycoprotein is used to cleave the receptor and release the virus.

To know more about hemaglutinin visit:-

https://brainly.com/question/14045160

#SPJ4

gender structures social relationships between people unequally. this is a statement that would be supported by which group?

Answers

Social interactions between people are structured differently based on gender. This sentence serves as an illustration of the feminist stance on gender.

Feminism is the term used to describe the advocacy of women's rights on the grounds of gender equality. In our open step, experts explain gender equality. introduction to gender inequality implies that everyone, regardless of gender identity, is entitled to the same respect, rights, and opportunities. In order to completely attain gender equality in both theory and practice, feminism generally attempts to remove feminist , exploitation, and oppression.

Gender equality reduces violence against women and girls. It is essential for the economy to expand. Societies that treat women and men equally are safer and better. The equality of genders is a fundamental human right.

Learn more about feminist  here:

https://brainly.com/question/14840949

#SPJ4

All body cells in an organism have the same dna what makes blood, skin and bone cells different

Answers

Answer:

These cells are different because they use the same set of genes differently. So even though each of our cells has the same 20,000 or so genes regulation is how a cell controls which genes, out of the many genes in its genome, are "turned on" (expressed). Thanks to gene regulation, each cell type in your body has a different set of active genes.

Explanation:

A specialized cell in a tree leaf
what is this type of specialized cell?
A. Tracheid
B. Palisade cell
C. Guard cell
D. Osteocyte

Answers

Answer:

Palisade Cell

Explanation:

The leaf of a plant contains many different specialized cells. One example is the palisade cells, which form a layer near the top of the leaf. These cells are elongated, cylindrical in shape, and contain many chloroplasts.

each chromosome in this homologous pair possesses a different allele for flower color. which statement about this homologous pair of chromosomes is correct?

Answers

The correct statement is the homologous chromosomes represent the maternal and paternal chromosomes.

These chromosomes represent maternal and the chromosomal pattern indicates the presence of two chromosomes. This represents the two sets of conversion materials used by Gan. From these descriptions, the chromosome composed of these two chromosomes is the chromosome in genetics, the SLAM model, we call the maternal chromosome, and the chromosome inherited from the father is called the paternal chromosome. So this is still a chromosome and colored. They are formed by DNA replication and non-systems, not Tacoma nonsense.

To know more about maternal chromosome

https://brainly.com/question/13791557

#SPJ4

Which is TRUE regarding the Yellowstone ecosystem in Wyoming?
[LS2-1, LS2-2]
A. abiotic factors like weather have no impact on this ecosystem

B. the main herbivores on the island are elk

C. the wolves in the park have many choices of prey species

D. the ecosystem here has only been studied for a few years

Answers

Answer:

(B) is true.

Explanation:

The most prevalent big mammal in Yellowstone is the elk. Elk, the term for moose in Europe, was used to characterise the animal by European immigrants in North America (causing great confusion for European visitors). Elk is also known by the Shawnee term "wapiti," which means "white deer" or "white-rumped deer." Elk in North America are regarded as belonging to the same species as red deer in Europe.

Elk are consumed by wolves, therefore when they disappeared, the elk population skyrocketed. The park had very few young aspen trees because the elk consumed young aspen trees.

To know more about elk,

https://brainly.com/question/27600240

#SPJ4

when the bladder contains 400 to 500 ml of urine, this is referred to as specific gravity. anuria. renal clearance. functional capacity.

Answers

A bladder containing 400 - 500 ml of urine is referred to as functional capacity.

Urine is defined as excess liquid waste products of metabolism in human as well as other animals. The kidneys filter nitrogen rich human metabolism byproducts such as urea and creatinine from blood, then transport it to the ureters, then the urine is excreted from the body via urethra. In order for micturition (a process of excretion of urine from the bladder) to happen, the bladder must maintain a functional capacity at a level of 400 - 500 ml of urine stored inside it, after which the excess level of liquid will be excreted from the body.

To learn more about urine visit: https://brainly.com/question/21951089

#SPJ4

How does cholesterol help stabilize the plasma membrane in hot and cold temperatures.

Answers

Answer:

through raising or lowering the melting point

Explanation:

In High temperatures, cholesterol stabilises the plasma membrane through raising the melting point, meaning the degree of fluidity is kept the same. In Low temperatures, cholesterol intercalates between the phospholipid bi-layer and therefore prevents clustering.

Which of the following provides the best summary of the process of natural
selection?
• A. Mutations help an individual survive and reproduce.
• B. Individuals pass on their best traits to their offspring.
• C. Well-adapted individuals survive and reproduce.
D. Population sizes increase with every generation.

Answers

Answer:
B

Explanation:
That’s what they made the answer :)

Have an AWESOME day everyone! :)

The development that freed vertebrates from water for reproduction and allowed them to radiate into diverse terrestrial environments was the _____.

Answers

Answer:

Ecdysis

Explanation:

The innovation that freed vertebrates from being tied to water for reproduction and allowed them to radiate into diverse terrestrial environments was the development of A. ecdysis.

The primary difference between a community and an ecosystem is that an ecosystem includes . . .
A.biotic factors
B.abiotic factors
C.biosphere
D.populations

Answers

Explanation:

An ecosystem contains biotic and abiotic factors as well as populations.The only thing it does not contain is the biosphere because the biosphere actually contains all ecosystems where life exists.

PLEASE ANSWER ASAP
Explain why it is important that FSH is not secreted during pregnancy.

Answers

Answer:

During pregnancy, serum FSH concentrations are quite low due to the inhibitory effects of the elevated concentrations of estrogen and progesterone on the hypothalamus and the pituitary gonadotropes.

you find an animal with a bilateral larval form but what appears to be a radial adult form. which taxa would you presume it to belong to?

Answers

Answer:

Cnidaria

Explanation:

order the steps in the clonal expansion of antibodies and the production of antibodies.

Answers

1. The Th cell detects the viral epitope presented by the b cell using its TCR.2. The Th cell's cytokines stimulate the B cell, which divides to form the memory and plasma cells.3. Antibodies produced by plasma cells can detect viruses.

What does clonal growth and selection mean?

According to the hypothesis of clonal selection, random mutations that occurred during lymphocytes' initial maturation and proliferation led to unique antigen receptors developing on them before they were exposed to an antigen.Selected lymphocytes that have the required antigen receptor go through clonal proliferation after antigen presentation.

What causes clonal expansion to happen?

The process through which daughter cells develop from a parent cell is known as clonal expansion.Many copies of the B cell that share affinity for and specificity for the same antigen are created during B cell clonal growth.

To know more about production of antibodies visit:

https://brainly.com/question/7806340

#SPJ4

WILL GIVE BRAINLIST TO FIRST PERSON WHO ANSWERS !!!!!



Compounds Lab Report
Instructions: In this virtual lab you will build chemical compounds from known elements. Record your hypothesis and compound results in the lab report below. You will submit your completed report to your instructor.
Note: If you cannot complete this lab as directed, please contact your instructor for assistance.

Name and Title:


Objectives(s): The purpose of this virtual lab was to use different elements and make chemical compounds.


Hypothesis:
I can create five new compounds using oxygen, hydrogen, and carbon in about four minutes.
Procedure:
The amount and sorts of elements I chose for my compounds are the independent variables. The types of chemicals created are the dependent variable.

Data:
Record the composition of each of your compounds below. Be sure to include the number of atoms for each element. An example has been supplied for you.

Compound Name
Chemical Formula
Sodium (Na) Atoms
Calcium (Ca) Atoms
Hydrogen (H) Atoms
Oxygen (O) Atoms
Carbon (C) Atoms
Chlorine (Cl) Atoms
Ex: Sodium
hypochlorite














Water














Glucose














Formic














Botanic Acid














Carbon Dioxide














Carbon Monoxide














Fructose
























































Conclusion:
Your conclusion will include a summary of the lab results and an interpretation of the results. Please answer all questions in complete sentences using your own words.
Using two to three sentences, summarize what you investigated and observed in this lab.
Why do you believe knowing how elements and compounds react together is essential in everyday matters?
Some elements are more "reactive" than other elements; why do you think this is?
Choose one of the compounds from the table and explain how you know the numbers of atoms in your formula.
Is it possible for two different compounds to be made from the exact same two elements? Why or why not? With a limited number of elements (less than 120 are known), does this mean we also have a small number of compounds or do we have a large number of compounds in this world?

Answers

Here you go buddy!

Hypothesis and Conclusion

Using two to three sentences, summarize what you investigated and observed in this lab.

In this lab, we created five new compounds using oxygen, hydrogen, and carbon. We observed the chemical formulas and the number of atoms of each element in each compound.

Why do you believe knowing how elements and compounds react together is essential in everyday matters?

Knowing how elements and compounds react together is essential in everyday matters because it helps us understand the chemical processes that occur in the world around us. This knowledge allows us to predict the outcomes of chemical reactions and design new compounds with specific properties and uses.

Some elements are more "reactive" than other elements; why do you think this is?

Some elements are more reactive than other elements because they have a higher tendency to gain or lose electrons, forming chemical bonds with other elements. This can be due to differences in their atomic structure, such as their number of valence electrons or their electron configuration.

Choose one of the compounds from the table and explain how you know the numbers of atoms in your formula.

For example, let's choose glucose as one of the compounds from the table. We know that the chemical formula of glucose is C6H12O6, which indicates that it contains six carbon atoms, twelve hydrogen atoms, and six oxygen atoms. This information is provided in the table and is derived from the chemical formula of the compound.

Is it possible for two different compounds to be made from the exact same two elements? Why or why not? With a limited number of elements (less than 120 are known), does this mean we also have a small number of compounds or do we have a large number of compounds in this world?

Yes, it is possible for two different compounds to be made from the exact same two elements. This is because the arrangement of atoms in a compound determines its chemical properties and structure, and different arrangements of the same elements can produce different compounds. For example, water (H2O) and hydrogen peroxide (H2O2) are made from the same two elements, hydrogen and oxygen, but have different chemical properties and structures. Despite the limited number of elements known, there is a large number of possible compounds that can be formed by combining these elements in different ways. This is because the number of possible compounds increases exponentially as the number of elements increases.

what are the columns of muscle produced by the extension of the epimysium into the body of the muscle called?

Answers

The epimysium spreads into the muscular body, generating muscle columns known as fascicles. The epimysium is a connective tissue layer that surrounds and protects muscles. It is made up of thick regular connective tissue and collagen fibers organized in a basket-weave pattern.

Fascicles are groupings of muscle fibers that are joined together by a sheath of connective tissue and are important for a muscle's overall structure and form. Fascicles are normally grouped cylindrically or parallelly, and their size, shape, and quantity vary depending on the kind of muscle. Fast-twitch muscles, such as those in the legs and arms, have fewer and bigger fascicles than slow-twitch muscles, such as those in the belly and back.

Because of the diversity in the number and size of fascicles, the muscle may create varying amounts of force and contraction speed. Muscle fibers, which are bundles of individual muscle cells, make up fascicles. The endomysium is a thin layer of connective tissue that surrounds each muscle fiber.

The endomysium protects the muscle fiber while also allowing it to glide easily over adjacent fibers. This enables the muscle to contract and relax more effectively.

Learn more about Epimysium here:

https://brainly.com/question/12418238

if a cell is placed in an isotonic medium, there will be no net movement of water.

Answers

There won't be a net migration of water towards the  isotonic  solution or the cell since the concentration of the solute and water are identical both within and outside the cell.

When cells are dissolved in an isotonic solution, what happens?

If a cell is submerged in an isotonic solution, there won't be any net water inflow or outflow, and the volume of the cell will stay constant. If neither the solute concentration outside the cell nor the solute concentration inside the cell can cross the membrane.

What is the net movement of water in an isotonic solution?

There won't be any net water flow into or out of the water when a cell is submerged in an isotonic solution. When a cell is put in a hypertonic solution, however, there will Water will be leaking from the cell on a net basis. Red blood cell formation will result from this.

To know more about isotonic visit :-

https://brainly.com/question/28020628

#SPJ4

How does the circulatory system keep each cell in an organism alive and healthy?.

Answers

Answer:

The heart, blood, and blood vessels work together to service the cells of the body. Blood vessels carry blood to the lungs for oxygen. Then your heart pumps oxygen which keeps you alive and healthy.

Explanation:

if frog eggs taken from a freshwater pond are placed in a saltwater aquarium, what will most likely happen?

Answers

water will leave the eggs

What is the frequency of a wave that has a velocity of 2m/s and wavelength of 12m/s

Answers

Answer:

The answer should be 0.1666667 but there is some problems with your question, A Wavelength cannot be measured by meters per second usually.

Explanation:

The reason why is because of how far wavelengths actually move and extend.

what is one abiotic-abiotic interaction affected by the wildfires in California?​

Answers

Answer:

Anthropogenic. Air pollution. Fire. Oil spills. Radioactive contamination.Climatological.Geophysical.Hydrological.Meteorological.

Which description properly describes a step involved in cellular respiration?

Glucose is created, then the energy gained is transferred to the energy molecule.
Carbon dioxide and water are released after the energy molecule is charged.
Water is divided into carbon dioxide and glucose.
Oxygen is combined with ATP to energize it.

Did the quiz and A is incorrect.

Answers

Answer:

2nd choice

Explanation:

glucose+ oxygen gives water+ carbon dioxide + energy

if someone said that the inside of a cell is hollow what would you tell them to correct their misinterpretation​

Answers

Answer: The cell is made up of different part such as the nucleus, mitochondria, etc.

Explanation:

the pancreas secretes digestive enzymes and hco3− into the small intestine to break down food and neutralize acidity.

Answers

The statement 'the pancreas secretes digestive enzymes and HCO3 into the small intestine to break down food and neutralize acidity' is true.

The pancreas can be described as the organs that secrete digestive enzymes as well as bicarbonate ions into the small intestine in order to facilitate the process of digestion. Apart from this, the pancreas also secretes hormones into the blood.

In the digestive juice that is produced by the pancreas, there are enzymes that break down carbohydrates, proteins, and fats all of which are majorly present in the food that we consume. The bicarbonate is produced in order to neutralize the acidity that was produced in the stomach as the stomach has a high concentration of HCl.

Although a part of your question is missing, you might be referring to this question:

The pancreas secretes digestive enzymes and HCO3− into the small intestine to break down food and neutralize acidity. true or false

To learn more about pancreas, click here:

https://brainly.com/question/791197

#SPJ4

compare and contrast promoter-proximal elements and the operator of the lac operon. what do they have in common?

Answers

Both are nearby promoter-located regulatory regions in the DNA.

What interacts with the promoter-proximal components?

The PSE-binding transcription factor particularly binds the proximal sequence element (PSE), which is present in small nuclear RNA (snRNA) genes that are transcribed by both RNA polymerase II (Pol II) and RNA pol III (PTF).

Enhancers or promoter-proximal elements?

Proximal control elements are placed near the promoter, hundreds of nucleotides away from enhancers.Enhancers are DNA sequences, while transcription factors are proximal control elements.

To know more about promoter-proximal elements visit:

https://brainly.com/question/7291467

#SPJ4

Which essential molecule in the body is out of equilibrium because of a cftr gene defect?.

Answers

Mutations in the gene that codes for the cystic fibrosis transmembrane conductance regulator (CFTR) protein lead to cystic fibrosis.

Cystic fibrosis is brought on by mutations, or mistakes, in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which either prevent the production of any CFTR protein or cause it to be malformed and unable to carry out its essential cellular role.

The deletion of phenylalanine 508 (F508del) in the cystic fibrosis transmembrane conductance regulator is a mutation that has been linked to the disease (CFTR). The CFTR's first nucleotide-binding domain (NBD) contains the amino acid. Gating issues and faulty channel processing result from this mutation.

CFTR is a complex protein that is present on the cell surface membrane in a number of tissues and serves as a controlled chloride ion channel. On the apical membrane of the cells lining the airways in the lung, CFTR is present.

Learn more about CFTR to visit here;

https://brainly.com/question/14231150

#SPJ4

What takes place in a cell’s mitochondria?

Answers

Explanation:

The mitochondria is called the powerhouse of the cell because it is responsible for producing most of the cell’s energy, or adenosine tri-phosphate (ATP). The mitochondria converts chemical energy from the food we eat into an energy form that the cell can use. This process is called oxidative phosphorylation.

Answer:

Known as the “powerhouses of the cell,” mitochondria produce the energy necessary for the cell's survival and functioning.

Explanation:

Mitochondria, using oxygen available within the cell convert chemical energy from food in the cell to energy in a form usable to the host cell. The process is called oxidative phosphorylation and it happens inside mitochondria

i hope this helped

The muscle group that helps the prime movers and protects from unwanted movements are known as.

Answers

The muscle group that helps the prime movers and protects from unwanted movements are known as Synergists.

Synergists are muscles that assist the prime mover in its role. Synergists help prime movers by adding a little extra force to the same movement or else by reducing unnecessary movements that might occur as the prime mover contracts. Synergistic muscle groups help prevent instability or unwanted movements.

Synergists muscle contract at the same time as the prime mover. They helps to hold the body in position so that the prime mover can work smoothly.

To learn more about Synergists muscle , here

brainly.com/question/12978163

#SPJ4

Which action is taking place at the apical meristem of a plant stem?

A. Mature cells differentiate into specialized cells.

B. The plant's oldest cells rapidly divide to extend the stem.

C. A cluster of tiny, unspecialized cells continuously divide.

D. Cells die off and form a barrier that protects new cells.

Answers

Answer: C

Explanation: The apical meristem is a region at the tip of a plant's stem or root that contains a cluster of tiny, unspecialized cells called meristematic cells. These cells are capable of dividing rapidly, allowing the plant to grow in length. As the cells at the tip of the stem or root differentiate and mature, they become specialized for different functions, such as photosynthesis or support. The apical meristem is responsible for the primary growth of a plant, which is the growth in length that occurs during its early stages of development.

Other Questions
Classify these sequences based on their potential to modify protein products. The plain letters in the sequences represent protein coding regions, and the bold letters represent noncoding regions.TACCTTAATT TACCTTAATTATTGAGACCGT GAGACCAGT HELPPP PLEASE ASPPP!!!!!! Examine the graph below. Calculate the slope. Find the absolute extrema if they exist, as well as all values of x where they occur, for the function f(x)=(x-64)^{1/11} on the domain [-8,9]Select the correct choice below and, if necessary, fill in the answer boxes to complete your choice.A. The absolute maximum is , which occurs at x= (Round the absolute maximum to two decimal places as needed. Type an exact answer for the value of x where the maximum occurs. Use a comma to separate answers as needed.)B. There is no absolute maximum. What challenges you face during a searching for a business conference ? Explain when in psychoanalysis, the patient is asked to reveal whatever thoughts, feelings, or images come to mind, this technique is called: ACTIVITY 3: What is the message of the picture? Why did mom and dad hace ti hice marjis posters? Northerners were concerned about expansion because they felt it couldpossibly lead to:OA. war with foreign powers over land in the West.B. an attack on their cultural traditions and economy.O C. a system where they would pay more for goods and services.O D. new federal policies that would only benefit the South. Please help !!! John paid $280 for a new mountain bicycle to sell in his shop. He wants to price it so that he can offer a 30% discount but still make 10% of the price he paid for it. At what price should the bike be marked? Suppose it is know that sigma is equal to 30. What is the minimum number of people the pollster should survey in order to have a margin of error of 10 miniutes at 95% confidence? show work. Kayden's math teacher said that eachquestion answered correctly on a test wouldbe worth 7 points. Answer the questionsbelow regarding the relationship betweenthe number of questions correct and thescore on the test. function rule to find f(10). Question 16 of 20What is one way political parties shape public policy?A. Working toward dissolving the two-party systemB. Voting on the issues that are of most concern to party membersC. Creating and passing legislationD. Helping elected officials who belong to the party work togethermore effectively calculate the number of grams of aluminum required to prepare 299.0 g of chromium metal by the first reaction. what are three powers that have values greater than 120 and less than 130. ? Is the system of equations consistent and independent, consistent and dependent, or inconsistent?y=x+12y=2x+2Select the correct answer from the drop-down menu. Which of the following does AWS perform on its customer's behalf for EBS volumes to make it less prone to failure?A. Replication of the volume across Availability ZonesB. Replication of the volume in the same Availability ZoneC. Replication of the volume across RegionsD. Replication of the volume across Edge locations a woman who is 36 weeks pregnant arrives at the labor and delivery unit complaining of vaginal bleeding. which signs/symptoms indicate that the client's bleeding is caused by placenta previa? select all that apply. boron company has sales of $60,000, beginning inventory of $7,000, purchases of $35,000, and ending inventory of $5,000. the cost of goods sold is If your marginal propensity to consume is 0.75 and you get an additional $400 in income, you would spend ___________ on consumption.a. $400.00b. $200.00c. $300.00d. $533.33e. $1,600.00