What happens at the temperature shown?

Answer/Explanation:

During low elevated tides, the Earth itself is pulled marginally toward the moon, making elevated tides on the contrary side of the planet. Earths pivot and the gravitational draw of the sun and moon make tides on our planet. As the sea swells toward the moon, an elevated tide is made.

But because the Earth rotates, circulating air is deflected. Instead of circulating in a straight pattern, the air deflects toward the right in the Northern Hemisphere and toward the left in the Southern Hemisphere, resulting in curved paths. This deflection is called the Coriolis effect.

Answer:

Cytokinesis,

Explanation:

Cytokinesis, the division of the cytoplasm to form two new cells, overlaps with the final stages of mitosis. It may start in either anaphase or telophase, depending on the cell, and finishes shortly after telophase.

The division of the cytoplasm, which follows Mitosis, is called Cytokinesis. This is further explained below.

Generally, Mitosis is simply defined as a kind of cell division that produces two daughter cells with the same number and type of chromosomes as the parent nucleus, as seen in normal tissue growth.

In conclusion, Cytokinesis is simply defined as the division of the cytoplasm that occurs after mitosis to produce two daughter cells.

Read more about Cell

https://brainly.com/question/2622341

#SPJ2

Answer:

Transcription is unidirectional because you are copying only ONE side of the DNA. Remember that DNA is a double stranded helical structure. One strand of DNA is complementary to the other strand.

Explanation:

Answer:

diffusion and osmosis

Explanation:

lipid_ soluble substance

through lipid baleyer

through protein channel

Transported proteins carry small substances like water, amino acids, and charged ions. One to fifteen angstroms is the range in molecule size that can pass through the membrane. The easier it is for a molecule to move across the cell membrane, the smaller it is.

All cells have a cell membrane, also known as a plasma membrane, which separates the interior of the cell from the external environment. A semipermeable lipid bilayer makes up the cell membrane. The movement of materials into and out of the cell is controlled by the cell membrane.

Small molecules or ions can traverse the cell membrane passively without the cell providing any energy. The three basic types of passive transport are osmosis, assisted diffusion, and diffusion.

Gases like oxygen and carbon dioxide, as well as small hydrophobic compounds, quickly traverse membranes. Water and ethanol are examples of small polar molecules that can move across membranes, though more slowly.

Thus, The easier it is for a molecule to move across the cell membrane, the smaller it is.

To learn more about cell membrane, follow the link;

https://brainly.com/question/13524386

#SPJ2

Answer:

DNA analysis has little to offer forensic science is false.

Explanation:

DNA may be found on the handle or tip of a baseball bat if it is used in a crime. The evidence is used for DNA analysis

Answer: PpTt x PpTt

Explanation:

The cross PpTt × PpTt leads to the phenotype Number of offspring Tall with purple flowers 291 Short with purple flowers 97 Tall with white flowers 101 Short with white flowers 32, hence option C is correct.

Two creatures that are identically hybrid for two characteristics are said to have mated to create a dihybrid cross. When an organism is heterozygous, it signifies that there are two distinct alleles present at a certain genetic location.

An attempt in producing two creatures that are identical hybrids for two qualities is a dihybrid cross.

The people with this sort of character are homozygous for that particular trait.

Therefore, to put it another way, a dihybrid cross is a union of two organisms that are heterozygous for two separate features, hence option C is correct.

Learn more about dihybrid, here:

https://brainly.com/question/12540319

#SPJ2

Answer:

A

Explanation:

its not D or C and B might be true but its A okay

Why must an mRNA copy be made for Protein Synthesis because C. Ribosomes are too big to enter the nucleus

mRNA is the molecule that includes the message contained within DNA to the ribosome. Ribosomes are where proteins are produced. mRNA is vital because ribosomes cannot attain the DNA inside our cell nucleus, which is the region within the mobile wherein DNA is housed.

Why is it important to make an mRNA reproduction of a DNA gene earlier than protein synthesis?

So as for cellular to fabricate these proteins, particular genes inside its DNA should first be transcribed into molecules of mRNA; then, these transcripts must be translated into chains of amino acids, which later fold into completely useful proteins.

Learn more about Ribosomes at https://brainly.com/question/8773679

#SPJ2

Answer:

b

Explanation: peeps in washington are going crazy.

Answer:

Although scales measure force, they give you measurements of mass in kilograms, grams, pounds, or whatever.

Explanation:

Answer: Mitochondria are membrane-bound cell organelles (mitochondrion, singular) that generate most of the chemical energy needed to power the cell's biochemical reactions. Chemical energy produced by the mitochondria is stored in a small molecule called adenosine triphosphate (ATP).

Explanation:

Answer: The mitochondrionis a double membrane-bound organelle found in most eukaryotic organisms. Some cells in some multicellular organisms lack mitochondria (for example, mature mammalian red blood cells). A number of unicellular organisms, such as microsporidia, parabasalids, and diplomonads, have reduced or transformed their mitochondria into other structures.

Explanation:

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

Answer:

A

Explanation:

the northern hemisphere is the opposite from the southern hemisphere

Since northern and southern hemisphere are in opposite directions therefore, option (A) is correct.

The axis of rotation of the Earth is inclined with regard to the plane in which it orbits the sun. This is the root reason of the changing of the seasons. When the axis of the earth is aligned with the sun, summer arrives in that hemisphere of the planet. Expect winter to arrive when the axis of the earth is tilted away from the sun.

Different places of Earth receive the Sun's most direct rays throughout the year. When the North Pole tilts toward the Sun, it's summer in the Northern Hemisphere. When the South Pole tilts toward the Sun, the Northern Hemisphere experiences winter.

Learn more about seasons, here:

https://brainly.com/question/12028829

#SPJ2

Answer:

CARBON

Explanation:

Answer:

genes are segments of chromosomes that form tight coils called dna

The statement that best describes the relationship between DNA, genes, and chromosomes is as follows:

Thus, the correct option is D.

A Chromosome may be defined as a thin thread-like structure that appears during the process of cell division. Such types of thread-like structures are significantly present in the nucleus of the cell.

Chromosomes are made up of DNA, RNA, histones, and some non-histone proteins. Chromosomes were first discovered by E. Strausburger in 1875.

Genes are small stretches that significantly considered the segments of chromosomes. Together they form a tightly coiled structure remarkably known as DNA. Genes carry nucleotide sequences that can produce functional enzymes or proteins.

All such parts carry genetic information with respect to the existence of organisms on the basis of morphology and function.

Therefore, the correct option for this question is D.

To learn more about Chromosomes, refer to the link:

https://brainly.com/question/11912112

#SPJ6

Answer: The basic answer could be because of the tectonics plates.

Explanation: Because when two forces act towards each other from opposite sides, rock layers are bent into folds.

Typically, sedimentary rocks are arranged in layers, one on top of the other, the oldest items are listed last, followed by the youngest, this is the concept of "superposition.

Erosion has removed the top layers of the rocks, resulting in the formation of valleys and hills, the top layer might be penetrated with sufficient power. The plates might shift due to erosion, and plate movement.

Many of the stratified rocks, however, are no longer horizontal, we know that sedimentary rocks that are not horizontal either were created in unique ways.

Therefore, more frequently, were shifted from their horizontal position by subsequent processes, such as tilting during episodes of mountain construction, thanks to the Law of Original Horizontality.

Learn more about rocks, here:

https://brainly.com/question/29561452

#SPJ2

Answer:

DNA needs to be transcribed itself as a mechanism for the multiplication of its molecules, and this transcription process is called DNA replication.

Explanation:

DNA replication is a mechanism that allows it, from one molecule, to obtain two molecules identical to the original. In other words, it transcribes the information from one of its strands to a new strand.

The process of DNA replication is semi-conservative, because each new molecule is formed by an original strand and a new strand, which contributes to maintaining the integrity of the genetic information.

As a requirement of the cell division process, as mitosis,  DNA must replicate so that each daughter cell has the same genetic information as the original cell. This is why replication of this nucleic acid occurs.

Answer:

it takes 50 min

Explanation:

20 is twice of ten so if it take 25 min to cook ten then it is 50 min to cook 20.

Work for it:

10 x 2 = 20

10 eggs=10 min

25x2=50

Answer:

it takes 50 minutes to cook 20 eggs

Explanation:

ok first you have to see how long it takes 1 egg to cook so 25/10=2.5minute an egg then u multiply 2.5 x 20=50

hope this helps

Answer:

Look down!!! ;)

Explanation:

In a human karyotype, autosomes or “body chromosomes” (all of the non–sex chromosomes) are generally organized in approximate order of size from largest (chromosome 1) to smallest (chromosome 22). However, chromosome 21 is actually shorter than chromosome 22.

Hope this helps!! ;)

Answer:

OF COUSE IT C

Explanation:

Answer:

C

Explanation:

I think the answer is C.

The different kinds of water effects the water and the sunlight. This helps show how much water and sunlight each plant gets and it will bring results.

I hope this helps you! Have a great day!

Answer:

Carbohydrates

Explanation:

Ex: Glucose (monosaccharide)

Answer:

a) ATGCATACGGCATACCCGTAA

B) AUGCAUACGGCAUACCCGUAA

Explanation:

For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine

For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.

Answer:

a regulatory proteins

Explanation:

njnjnj

Answer:

LOL THIS IS NOT THE PLACE FOR THIS XDDDDDD

Explanation:

Answer:

thanks for the points

Explanation:

Answer:

its malaria

Explanation:

I got it wrong and it showed me that it was malaria